The Notch co-repressor protein NKAP is highly expressed in adult mouse subventricular zone neural progenitor cells

Neuroscience 266 (2014) 138–149

THE NOTCH CO-REPRESSOR PROTEIN NKAP IS HIGHLY EXPRESSED IN ADULT MOUSE SUBVENTRICULAR ZONE NEURAL PROGENITOR CELLS M. M. A. WORLITZER a,b AND J. C. SCHWAMBORN a,b,c*

an additional role of NKAP outside of SVZ progenitor cells. Ó 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

a

Westfa¨lische Wilhelms-Universita¨t Mu¨nster, ZMBE, Institute of Cell Biology, Stem Cell Biology and Regeneration Group, Von-Esmarch-Straße 56, 48149 Mu¨nster, Germany b Interdisciplinary Center for Clinical Research (IZKF) Mu¨nster, Germany

Key words: adult neurogenesis, NKAP, notch signaling, NF-jB signaling, mature neurons.

c

Luxembourg Centre for Systems Biomedicine (LCSB), University of Luxembourg, Esch-Belval, Luxembourg

INTRODUCTION

Abstract—In the adult mammalian brain niches for neural stem cells are maintained, which enable a steady-state neurogenesis. This process is tightly regulated by multiple niche factors, including Notch and NF-jB signaling. The NF-jB-activating-protein (NKAP) has previously been shown to act as Notch co-repressor component by binding CIR and recruiting HDAC3 in T-cell development and furthermore to regulate NF-jB-dependent transcription. Here, we provide first evidence for the expression of NKAP in neurogenic cells of the adult mammalian brain. NKAP is highly expressed in Mash1+ transit amplifying cells and PSA-NCAM+ migrating neuroblasts throughout the subventricular zone (SVZ) and the rostral migratory stream (RMS), as well as in the hippocampus. We further show that NKAP expression levels are downregulated during the course of the RMS. Eventually, most differentiated cells in the olfactory bulb (OB) and the corpus callosum only display low levels of NKAP expression. Finally, large subsets of mature neurons in the OB, the hippocampus and the thalamus express NKAP at high levels, suggesting

Mammalian adult neurogenesis is a tightly regulated process that persists in the hippocampal dentate gyrus (DG) and the forebrain subventricular zone (SVZ) (Zhao et al., 2008; Faigle and Song, 2012). In the DG new neurons are produced by neural stem cells (NSCs) residing in the subgranular zone and designated mostly for local integration in the granule cell layer (GCL) of the DG. Instead, in the SVZ GFAP+/Nestin+ astrocyte-like NSCs (type B cells) generate a mobile PSA-NCAM+ neuroblasts cell type (type A cells) via amplification through local Mash1+ transit amplifying cells (type C cells). Along the rostral migratory stream (RMS) neuroblasts migrate toward the olfactory bulb (OB), where they differentiate into interneurons in the GCL and the glomerular layer (GL). Besides neuronal differentiation, RMS cell derived oligodendrogenesis in the corpus callosum (CC) has also been described (Menn et al., 2006; Walker et al., 2007). The Notch signaling pathway is of outstanding importance for the regulation of adult SVZ neurogenesis (Pierfelice et al., 2011). Canonical Notch signaling, through the DNA binding protein RBPj (also: CBF1), is involved in the regulation of stem cell maintenance, proliferation, fate decision processes and, in more differentiated cells, in the regulation of cellular and synaptic plasticity. Although there is still some debate in the field, it seems to be the case that most, if not all, SVZ cell types express Notch receptors, indicating a widespread potential for Notch signaling in the SVZ (Stump et al., 2002; Nyfeler et al., 2005; Givogri et al., 2006; Carlen et al., 2009; Wang et al., 2009; Basak et al., 2012). This raises the question, how cell context specific expression of Notch target genes, like glial fibrillary acidic protein (GFAP) expression or the repression of Mash1 by Hes transcription factors, is mediated, if most SVZ cell types have the ability to respond to Notch signaling. However, it is conceivable that the different SVZ cell types could differ in their

*Correspondence to: J. C. Schwamborn, Westfa¨lische WilhelmsUniversita¨t Mu¨nster, ZMBE, Institute of Cell Biology, Stem Cell Biology and Regeneration Group, Von-Esmarch-Straße 56, 48149 Mu¨nster, Germany. Tel: +49-2-51-83-57183; fax: +49-2-51-8358616. E-mail address: [email protected] (J. C. Schwamborn). Abbreviations: CC, corpus callosum; CIR, CBF1-interacting corepressor; DG, dentate gyrus; dpi, days post infection; DMEM, Dulbecco’s Modified Eagle’s Medium; EDTA, ethylenediaminetetraacetic acid; GAD67, glutamate decarboxylase 1; GAPDH, glyceraldehydes-3 phosphate dehydrogenase; GCL, granule cell layer; GFAP, glial fibrillary acidic protein; GL, glomerular layer; GST-Pi, glutathione S-transferase Pi; HDAC3, histone deacetylase 3; Hes, hairy/enhancer of split; LV, lateral ventricle; Mash1, mammalian achaete-scute homolog 1; MCL, mitral cell layer; NeuN, neuronal nuclei antigen; NF-jB, nuclear factor of kappa light chain gene enhancer in B cells; NKAP, NF-jB activating protein; NSCs, neural stem cells; Olig2, oligodendrocyte lineage transcription factor 2; PSA-NCAM, polysialylated-neural cell adhesion molecule; RBPj, recombination signal-binding protein for immunoglobulin kappa j region; RMS, rostral migratory stream; OB, olfactory bulb; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; SVZ, subventricular zone; TH, tyrosine hydroxylase; TuJ1, neuron-specific class III beta-tubulin. http://dx.doi.org/10.1016/j.neuroscience.2014.02.019 0306-4522/Ó 2014 IBRO. Published by Elsevier Ltd. All rights reserved. 138

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

potential to respond to Notch receptor activation. This can be achieved by modifications downstream of the Notch receptor, where the Notch intracellular domain competes with Notch co-repressor molecules for the binding to RBPj (Borggrefe and Liefke, 2012). Recently, the NF-jB activating protein (NKAP) has been described to directly interact and co-localize with the known Notch co-repressors CIR and HDAC3 in the regulation of mammalian T-cell development, resulting in repression of Notch target genes (Pajerowski et al., 2009). Other phenotypes in hematopoiesis mediated through loss of NKAP, though, seemed to be independent from Notch signaling, indicating additional, yet unknown, mechanisms (Pajerowski et al., 2010; Hsu et al., 2011). But also the eponymous signaling pathway of the NKAP protein, the NF-jB pathway, was shown to have various pro- and anti-neurogenic functions in the regulation of adult neurogenesis (Denis-Donini et al., 2005; Widera et al., 2006; Worlitzer et al., 2012). In this pathway NKAP was shown to act as activator (Chen et al., 2003). First evidence of an implication of NKAP in neurogenesis came from an RNAi screen, which showed that the knockdown of the Drosophila melanogaster gene CG6066, an NKAP ortholog, leads to overproliferation of D. melanogaster neural precursor cells resulting in lethal tumor formation (Neumuller et al., 2011). Therefore, we decided to investigate, if NKAP is expressed in the mouse brain, with focus on the neurogenic region of the SVZ.

EXPERIMENTAL PROCEDURES Material The following antibodies were used: anti-GAD67 (Sigma– Aldrich, St. Louis, MO, USA), rabbit anti-GAPDH (Abcam, Cambridge, UK), mouse anti-GFAP (Millipore, Billerica, MA, USA), mouse anti-GFP (Santa-Cruz, Santa Cruz, CA, USA), mouse anti-GST-Pi (BD Bioscience, Franklin Lakes, NJ, USA), mouse anti-Nestin (BD Bioscience), rabbit anti-NKAP (1:50–1:100, Sigma–Aldrich, HPA000916), mouse anti-NeuN (Millipore), mouse antiMash1 (BD Bioscience), mouse anti-Olig2 (Millipore), mouse-anti PSA-NCAM (Millipore), mouse-anti-Tuj1 (Covance, Princeton, NJ, USA), rabbit-anti-Tuj1 (Covance), mouse anti-TH (Millipore), mouse anti-atubulin (Sigma–Aldrich). Alexa-fluorophore conjugated antibodies (Invitrogen, Carlsbad, CA, USA) were used as secondary antibodies for immunofluorescence staining. DNA was stained with Hoechst 33342 (Invitrogen). The following plasmids were used: pMX-EGFP (kindly provided by Prof. Hans Scho¨ler, Mu¨nster), pcDNADEST53-EGFP-NKAP, pcDNA-Dest47-EGFP-NKAP, pMO93-FLAG-IRES-EGFP-NKAP.

139

BL6N mice and transgenic GFAP-EGFP (Nolte et al., 2001) reporter mice were used. RNA isolation, cDNA generation and NKAP cloning Total C57/BL6N mouse brain mRNA was isolated (RNeasy Mini Kit, Qiagen N.V., Hilden, NRW, Germany) and NKAP cDNA was produced using SuperScript II Reverse Transcriptase (Invitrogen). Flanking attB sites (italic primer parts) for Gateway technology (Invitrogen) were added to NKAP cDNA using SYBR Green Jump Start Taq ReadyMix for Quantitative PCR (Sigma– Aldrich) via PCR reaction (Primers: (1) ggggacaagttt gtacaaaaaagcaggctca-accatggctcctgtatcgggctcgcgta; (2) ggggaccactttgtacaagaaagctgggtt-cttgtcatccttccctttggtcttt). Subsequently, the PCR product was recombined into pMO93 gateway destination vector (kindly provide by Prof. Manuel Grez, Frankfurt), pDEST53-EGFP (Invitrogen) or pDest47-EGFP (Invitrogen) using Gateway technology following the manufacturer’s instructions. Western blotting HEK293T cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal calf serum, 2 mM L-Glutamine, 100 U/ml penicillin, and 100 lg/ml streptomycin and transfected using Turbofect (Fermentas, Glen Burnie, MD, USA) following the manufacturer’s instructions. Cells were lysed 48 h after transfection (in 50 mM Tris, pH 7.5, 0.5 M NaCl, 1% NP40, 1% DOC, 0.1% sodium dodecyl sulfate (SDS), 2 mM EDTA, 1 Complete Protease Inhibitor (Roche Grenzach-Wyhlen, Germany)), incubated for 30 min (4 °C), then centrifuged for 30 min (4 °C, 13,000 rpm (Centrifuge 5417R, Eppendorf AG, Hamburg, Germany)) and the supernatant was used for sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and western blotting. NSC culture NSCs were cultured as previously described (Conti et al., 2005). Murine E12.5-E14.5 embryonic brain-derived NSCs were grown on poly-D-Lysine-coated dishes in NSC maintenance medium consisting of NS-A medium (Euroclone, Milan, Italy) supplemented with 10 ng/ml b-FGF2 (Peprotech, Rocky Hill, NJ, USA), 10 ng/ml EGF (Peprotech), 1 N2-Supplement (Invitrogen), Pen/ Strep (Invitrogen) and L-Glu (Invitrogen). Neuronal differentiation was induced as described previously (Hillje et al., 2011). Briefly, the medium was changed to Neurobasal medium (Invitrogen), supplemented with 1 N2-Supplement (Invitrogen), 1 B27 Supplement (Invitrogen), Pen/Strep (Invitrogen) and L-Glu (Invitrogen). Retrovirus production and NSC transduction

Mice All mice were kept under standard conditions according to governmental rules and regulations and were of 3–6 month of age at the time point of experiment. C57/

For retrovirus production TLA-HEK293T cells (Open Biosystems, Huntsville, AL, USA) were transfected with the packaging plasmid PCL-ECO (kindly provided by Prof. Manuel Grez, Frankfurt) and the transfer vector of

140

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

choice. The supernatant was collected at days 2, 3 (morning & evening) and day 4 post transfection, centrifuged for 10 min at 1200 rpm and following for 90 Min 20,000 rpm. Pellets were re-suspended in 250 ll un-supplemented DMEM medium. For viral transduction NSCs were seeded on poly-ornithine/laminin coated glass coverslips in NSC maintenance medium. On day 2 half of the medium (250 ll) was exchanged by maintenance medium containing 10-ll concentrated retrovirus and 6 lg/ml Protamine sulfate (Sigma– Aldrich). At 1 and 3 days post infection (dpi) half of the medium was exchanged by differentiation medium. NSCs were processed for immunofluorescence staining at 4 dpi.

Microscopy and statistical analysis Microscopy was performed using a Zeiss Axiovert 40 epifluorescence microscope and a Zeiss LSM 710 confocal microscope. Images were processed and analyzed using ImageJ and Adobe Photoshop software. Manual scoring of NKAP positive and highly positive cells was done using the Image J cell counter plug-in. For the NKAP immunofluorescence mean gray value measurement in the SVZ three channel confocal images with stainings for (1) Hoechst, (2) NKAP and (3) hGFAPGFP, Mash1 or PSA-NCAM were used. The areas of nuclei of cells positive and negative for marker (3) were selected and the mean gray value for NKAP was measured in the selection. Here the following numbers of cells were measured: PSA-NCAM 643 cells (+) & 596 cells (), Mash1 183 cells (+) & 932 cells, hGFAP-GFP 222 cells (+) & 1020 cells (). For the NKAP mean gray value measurements along the RMS, 12 bit images of PSA-NCAM+ cells in the proximal RMS (close to lateral ventricle (LV)), the medial RMS (close to curved RMS region), the distal RMS (close to OB) and in the GCL of the OB were taken using the same microscope acquisition settings for each single brain section (filters, pixel dwell time, averaging, pinhole diameter, master detector gain, digital gain and digital offset). Images were converted to 8 bit and the mean gray values of NKAP immunofluorescence were assessed in the nuclear areas of PSA-NCAM+ cells with the ImageJ software, while blinded to the NKAP channel. Up to two sections per animal were analyzed and the mean value for all animals was calculated. The following numbers of cells were measured: pRMS 175 cells, mRMS 80 cells, dRMS 64 cells, GCL 65 cells. Note that a quantification of NKAP protein in those cells, though, was not pursued, but rather a relative quantitative comparison between NKAP expression levels in various regions.

Immunofluorescence staining Anesthetized animals were intracardially perfused with 50 ml 1 PBS followed by 50 ml 4%PFA/1 PBS solution. Brains then were immersed in 4% PFA/1 PBS over night at 4 °C. 40 lm sagittal brain sections were permeabilized free floating for 1 h at 4 °C in TBS+++ (TBS 0.1 M Tris, 150 mM NaCl, pH 7.4/0.5% Triton-X 100/0.1% Na-Azide/0.1% Na-Citrate/5% normal goat serum) and incubated in primary antibody containing TBS+++ for 2 days on a shaker at 4 °C, with following 2 h incubation with secondary antibody in TBS+++ at RT. Sections were mounted on glass slides in AquaMount (Dako, Denmark A/S, Glostrup, Denmark). For immunocytochemistry, cells were fixed with 4%PFA/1 PBS for 15 min at RT, permeabilized with cold 0.05% Triton X-100/1 PBS for 3 min and blocked with 10% FCS/1 PBS for 1 h at RT. The cells were further incubated with primary (90 min) and secondary (60 min) antibodies in 10% FCS/1 PBS and mounted on glass slides in AquaMount.

NKAP 1

3

1

250 130 95

GAPDH

GFP 2

*

250 130 95

2

1

3

2

3

250

*

130 95

72

72

55

55

35

35

35

28

28

28

17

17

17

72

1) GFP control 2) NKAP-GFP (C-term) 3) NKAP-GFP (N-term)

55

Fig. 1. Western blot characterization of NKAP antibody. (A) Lysates of HEK293T cells, transfected either with an EGFP control vector or one of two NKAP-EGFP fusion vectors, were used for western blotting. The anti-NKAP antibody detected two strong bands at 70 kDa (arrowhead) in all three lanes and at >95 kDa (asterisk) in the NKAP-EGFP lanes. Anti-GFP staining detected in the NKAP-EGFP lanes only the >95 kDa band (asterisk) and a >28 kDa band in the EGFP-control lane. An anti-GAPDH antibody was used for loading control.

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

141

Fig. 2. The NKAP protein is ubiquitously expressed throughout most brain regions, but at heterogeneous levels. Confocal images were taken using the same microscope acquisition settings (filters, pixel dwell time, averaging, pinhole diameter, master detector gain, digital gain and digital offset) for qualitative comparison of expression levels in brain regions with high NKAP expression based on immunofluorescence staining. Inserts 1 (NKAP & Hoechst) and 2 (Hoechst) show an enlarged cell with typical punctuate, nuclear NKAP expression pattern (upper insert) sparing regions with highly condensed chromatin (Hoechst staining; arrowhead). AV: anteroventral thalamic nucleus; CC: corpus callosum; DG: dentate gyrus; GCL: granule cell layer; LV: lateral ventricle; pRMS: proximal RMS.

Statistical analysis was performed using Microsoft Excel and (Microsoft, Redmond, WA, USA) and SigmaPlot (Systat Software, Inc., San Jose, CA, USA). For all statistics sample sizes are as indicated in the figure legends or in the previous descriptions.

RESULTS NKAP is expressed in the whole brain at heterogeneous levels We started to study NKAP expression by immunofluorescence stainings of sagittal mouse brain

sections, using a commercially available anti-NKAP antibody. Firstly, the specificity of this antibody was validated by western blotting. Lysates of HEK293T cells, transfected either with an EGFP carrying vector or vectors carrying N-, respectively C-terminal NKAPEGFP fusion genes were used. The anti-NKAP antibody detected one clear band of 70 kDa in all three samples and additionally in both NKAP expression samples a band approximately 30 kDa higher, with this difference matching the molecular weight of EGFP (Fig. 1A). This band also was detected by an anti-GFP antibody, which instead in the control sample detected a band at

142

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

NKAP

Hippocampus

RMS

LV

Thalamus

Fig. 3. Low resolution confocal TILE scan of sagittal brain section showing NKAP immunofluorescence staining in cortical regions, interbrain, midbrain and hindbrain. Note the strong immunofluorescence in the SVZ/RMS, the hippocampus, the interbrain region close to the thalamus and the midbrain. LV: lateral ventricle; RMS: rostral migratory stream.

approximately 30 kDa, matching the molecular weight of EGFP. The shift in the SDS–PAGE from the calculated molecular weight of the NKAP protein (47 kDa) to 70 kDa, which presumably is endogenous NKAP, might result from a highly basic, lysine-rich domain (aa179–258), with a theoretical isoelectric point of 10.59, or yet unknown post-translational modifications. In mouse brain sections, we found NKAP immunostaining in punctuate nuclear patterns, which spares nuclear regions with highly condensed DNA as identified by Hoechst counterstaining (Fig. 2, insert 1 and 2). We found that NKAP is nearly ubiquitously expressed throughout the brain, with highest levels in the thalamus and the midbrain, the OB, the neurogenic areas of the DG, the SVZ and the RMS. Confocal image acquisition with the same acquisition settings enabled comparative qualitative expression level analysis in various brain regions. NKAP is strongly expressed in subsets of cells in the hippocampal regions CA2 and CA3 and at the inner layer of the DG, but weaker in the CA1 region (Figs. 2 and 3). Costaining with the mature neuronal marker NeuN (neuronal nuclei antigen) shows NKAP expression in most, if not all hippocampal neurons. Few NeuN cells in the DG lacked NKAP expression. In the inner layer of the DG some NeuN+ cells showed stronger NKAP expression than most neurons (Fig. 2, insert 1 and 2). In the NeuN cells in the SVZ and the proximal RMS NKAP was expressed at very high levels, while NeuN cells in the CC and the mostly NeuN+ cells in the

striatum and the GCL of the OB expressed NKAP at lower levels. Among the non-neurogenic regions we found the strongest NKAP expression in NeuN+ cells in the thalamus and probably other interbrain and midbrain areas (Figs. 2 and 3). NKAP is strongly expressed in highly proliferative progenitor cell types in the SVZ Because of the high expression in NeuN cells in the RMS, we decided to focus on the identification of cell types expressing NKAP in the SVZ-OB neurogenic zone. In the SVZ GFAP-expressing astroglia-like cells (type B cells) were previously identified as bona-fide NSCs (Doetsch et al., 1997, 1999). We used transgenic reporter mice, expressing EGFP under the human GFAP promoter control to identify GFAP-expressing astrocytes in the SVZ (Nolte et al., 2001). By manual counting NKAP immunofluorescence was found in 93% of hGFAP-EGFP+ cells in the SVZ. Of these only a minority of 6% expressed NKAP at high levels compared to surrounding cells (Fig. 4A). Similarly, cells positive for immunostaining with an anti-GFAP antibody were NKAP+ (Fig. 4B). Type B cells give rise to Mash1+ fast dividing transient amplifying cells (type C cells). We found that almost all Mash1+ cells (>99%) showed detectable NKAP expression and a majority of 60% expressed NKAP at high levels (Fig. 4C). Further, we found that SVZ cells expressing nestin, which is expressed in both, type B and type C cells, are

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

143

Fig. 4. Neurogenic SVZ cells show different levels of NKAP protein expression. (A) Representative confocal images (orthogonal view) of GFAP promoter driven EGFP (green) expression and co-labeling with NKAP (red) in the mouse SVZ. (B) Confocal images show double immunostainings of SVZ cells with NKAP (green) and GFAP or Nestin (both red) antibodies, respectively. Arrows point to double-positive cells; nestin-positive ventricle touching protrusion (white arrowhead) are marked. (C) Representative confocal images (orthogonal view) of Mash1+ cells (red), colabeled with NKAP (green) in the mouse SVZ. (D) Representative confocal images (orthogonal view) of PSA-NCAM+ cells (red), co-labeled with NKAP (green) in the mouse SVZ. (E) Diagram shows mean NKAP gray values in SVZ cells that are positive or negative for hGFAP-GFP or Mash1 or PSA-NCAM immunostaining, respectively; continuous line: median, dashed line: mean; 5th/95th percentile (circles), 10th/90th percentile (whiskers) and 25th/75th percentile (box) are indicated. (F) Confocal TILE scan showing strong NKAP expression in PSA-NCAM+ pRMS cells. (G) Example of cells demonstrating decline of NKAP immunofluorescence intensity (green) in PSA-NCAM+ cells (red) along the RMS and in the GCL of the OB. (H) Mean NKAP gray values in nuclei of PSA-NCAM+ cells were measured in four regions along the RMS (proximal, medial and distal) and in the GCL of the OB. Mean value at the pRMS region was set to 100%. ⁄P < 0.05 Kruskal–Wallis One-Way ANOVA on Ranks followed by pairwise post hoc Dunn’s Test, n = 4 mice (pRMS, mRMS, GCL), n = 3 mice (dRMS), error bars SEM. LV: lateral ventricle; CC: corpus callosum. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

often highly positive for NKAP (Fig. 4B). Eventually, type C cells generate PSA-NCAM+ neuroblasts (type A cells), which migrate dorsally in the SVZ and from the anterior dorsal corner of the LV along the RMS toward the OB, where they mature into neurons (Zhao et al., 2008). In the SVZ 97.5% of PSA-NCAM+ cells expressed NKAP and of those 86.7% showed high NKAP levels (Fig. 4D). To obtain more accurate and unbiased measurements of NKAP levels in the SVZ, we measured the mean gray

values of NKAP immunofluorescence on confocal images of cells that were either positive or negative for hGFAP-GFP, Mash1 or PSA-NCAM (Fig. 4E). These measurements confirmed the impression from manual counting that in the SVZ, NKAP is most highly expressed in PSA-NCAM+ neuroblasts, followed by Mash1 expressing intermediate progenitor cells, while only expressed at low levels in hGFAP-GFP+ astrocytic cells. Further, we found that along the RMS NKAP

144

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

Fig. 5. Confocal analysis of NKAP expression in cells of the neuronal lineage. (A) NKAP is expressed in Tuj1+ RMS cells (arrowheads). (B–D) NKAP expression in NeuN+ and NeuN cells in the GCL (B), the GL (C) and the MCL (D) of the olfactory bulb. NeuN cells positive (arrowheads) and negative for NKAP (arrow and dashed lines) are indicated (B and B0 ). NeuN putative mitral cells with high NKAP expression are shown in detail (D and D0 ). (E and E0 ) Tyrosine hydroxylase expressing dopaminergic neurons in the GL are NKAP+. (F and F0 ) GAD67 expressing GABAergic neurons in the MCL express NKAP. EPL: external plexiform layer; GCL: granular cell layer; GL: glomerular layer; MCL: mitral cell layer.

expression levels in PSA-NCAM+ cells (Fig. 4F–H) decreased strongly. Therefore, it is tempting to speculate that high NKAP expression levels are most important in progenitor cells close to the SVZ NSC niche. NKAP expression in neuronal OB cells To investigate the expression of NKAP in the neuronal lineage we conducted immunostainings for the neuronal lineage specific markers TuJ1, NeuN, TH (tyrosine

hydroxylase) and GAD67. Co-expression of NKAP and TuJ1 was already detectable in the RMS (Fig. 5A). In the GCL of the OB the majority of all cells were NKAP positive. Particularly, NeuN-expressing cells with characteristic round nuclei of mature GCL neurons were positive for NKAP (Fig. 5B). However, the expression levels of NKAP in these NeuN+ cells were much weaker than in NeuN cells with rather longitudinal nuclei, which are typical for PSA-NCAM+ migrating neuroblasts in the GCL (Fig. 5B). Some scattered cells

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

145

Fig. 6. Confocal 63 TILE scan of the olfactory bulb shows mitral cell layer (detail 1), PSA-NCAM+ neuroblasts in the GCL (detail 2) and PSANCAM+ cell clusters of the distal RMS (detail 3). Immunostaining for NKAP (green) and PSA-NCAM (red). DNA was stained by Hoechst (blue). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

in the GCL were negative for both markers (Fig. 5B0 ). In other OB regions, the GL and the mitral cell layer (MCL), NKAP was similarly expressed in both NeuNpositive and -negative cells (Fig. 5C, D). Further, in the GL, we found co-labeling for NKAP with the dopaminergic neuron marker TH (Fig. 5E), and in the MCL NKAP was expressed in cells positive for GAD67, a marker for GABAergic neurons (Fig. 5F). Interestingly, NeuN/Gad67 cells in the MCL, which are putative mitral cells (Mullen et al., 1992), show NKAP expression levels comparable to the levels in PSA-NCAM+ OB cells (Fig. 5D, F and Fig. 6). Glial cells express NKAP only at low levels A fraction of PSA-NCAM+/TuJ1 RMS cells (coexpressing the oligodendrocyte precursor markers PDGF receptor-a and Olig2) immigrates into the CC instead of the OB, where they differentiate into mature myelinating oligodendrocytes (Menn et al., 2006). We therefore performed double-immunostaining for NKAP and the oligodendrocyte marker GST-Pi and investigated the co-expression of these two proteins in the CC. Interestingly, we found groups of cells, which build short chain-like structures with ventral-dorsal orientation in the dorsal periphery of the RMS in the CC. Highly NKAP-positive cells within these chains were PSA-NCAM+ (Fig. 4E) and GST-Pi (Fig. 7A), while GST-Pi+ cells showed rather low levels of NKAP expression, indicating NKAP downregulation during maturation into oligodendrocytes. In the GCL of the OB

GST-Pi-expressing cells express NKAP at low level or not at all (Fig. 7B). Likewise, low NKAP expression levels are found in GFAP-EGFP+ astrocytes, which surround migrating neuroblasts in the RMS, and in GFAP-EGFP+ astrocytes in the OB (Fig. 7C, D). Together, these data describe low expression levels for NKAP in glial cells and provide a possible indication for the downregulation of NKAP in SVZ/RMS-derived oligodendrocyte precursor cells.

No evidence for asymmetric NKAP distribution during cell division The asymmetric inheritance of fate specifying factors into one of two daughter cells during cell division represents one possible mechanism in cellular differentiation processes during neurogenesis (Schwamborn et al., 2009). Because of higher NKAP expression levels in more differentiated type C and type A SVZ cells compared to type B stem cells and its potential role as inhibitory factor of Notch signaling in neurogenesis, we investigated, whether NKAP shows an asymmetric segregation during mitosis. However, we did not find a single mitotic cell that displayed clearly asymmetric segregation of NKAP to one pole. Instead, NKAP showed throughout all phases of mitosis a perichromosomal localization and in some cases a strong co-localization with Hoechst stained DNA (Fig. 8). Therefore, we cannot provide evidence for NKAP as an asymmetrically segregated fate specifying factor.

146

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

Fig. 7. Confocal analysis of NKAP expression in glial cells. GST-Pi+ mature oligodendrocytes in the CC (A arrows) and the OB: GCL (B dashed lines) show low NKAP expression levels. GFAP+ astrocytes in the RMS (C dashed lines) and in the OB: MCL (D arrows) show low level or not detectable NKAP expression.

NKAP is expressed in NSCs in vitro To investigate whether NKAP is expressed in NSCs in vitro we made use of neurospheres. We kept the NSCs as neurospheres to gain heterogeneous populations of differentiated and undifferentiated cells. The neurospheres then were allowed to attach to coated culture dishes, fixed the next day and subsequently were immunostained using antibodies against NKAP and either the stem cell marker Nestin or the neuronal lineage marker TuJ1. We found co-expression of NKAP with both markers under these conditions (Fig. 9A, B). Interestingly though, expression of NKAP was mostly limited to cells in the rim of those spheres, while in the center, where the cell density is highest, cells were NKAP negative. Next, we used 2-dimensionally growing, homogeneously nestin-expressing NSC cultures (Worlitzer et al., 2012), which were retrovirally transduced for expression of EGFP or NKAP-FLAG-IRES-EGFP transgenes, respectively. The medium then was changed to differentiation medium 1 day post infection (dpi) and cells were fixed at 4dpi. These cells were coimmunostained for a variety of cell type specific markers (Nestin, Olig2 – progenitors, TuJ1 – neurons, GFAP – astrocytes, GST-pi – oligodendrocytes). For none of these markers, though, significant differences were detectable after NKAP overexpression (data not shown).

In total, our data imply that the NKAP protein could be involved in the regulation of adult neurogenesis. NKAP shows the highest expression in young neuroblasts and it is tempting to speculate that NKAP probably is important for early fate specification events during neurogenesis. However, NKAP additionally shows high expression levels in defined populations of mature neurons, suggesting a role beyond control of the cellular immaturity status.

DISCUSSION The expression pattern of NKAP in the adult mouse brain, as shown by our immunofluorescence stainings, together with its association with Notch-signaling, as published for other tissues, implicate an important function of NKAP in the regulation of SVZ neural stem or progenitor cell identity. The potential role of NKAP as part of Notch corepressor in adult neurogenesis Increasing amount of evidence shows that Notch1 is expressed and functional in SVZ NSCs as well as in the further committed neural progenitor cells in the SVZ (Stump et al., 2002; Nyfeler et al., 2005; Givogri et al., 2006; Carlen et al., 2009; Wang et al., 2009; Basak

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

147

Fig. 8. Immunostaining of NKAP (red) in mitotic cells of the SVZ and the RMS show peri-chromosomal localization of NKAP (meta- and ana-phase images) or NKAP in close association with Hoechst stained DNA (Hoechst: blue) (pro- and telo-phase). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 9. NKAP is expressed in NSCs in vitro. In attached heterogeneous neurospheres NKAP is expressed in some (arrows) but not all (arrowheads) cells that are positive for Nestin (A) or TuJ1 (B). Note that cells in the inner cell mass of the neurospheres are NKAP negative.

148

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149

et al., 2012) as well as in ependymal cells (Carlen et al., 2009). Additionally, Notch 2 and 3, together with several other Notch pathway components, seem to be expressed in the SVZ (Carlen et al., 2009; Basak et al., 2012). This widespread Notch receptor expression in cell types with various differentiation states, though, raises the questions, how the spatial and temporal expression of different Notch target genes is regulated and further how cell fate decisions are influenced via Notch signaling. Among others, an important mechanism for Notch signaling fine-tuning is the competition of the Notch intracellular domain with Notch co-repressor components for binding to the DNA binding protein RBPj (Cave, 2011; Borggrefe and Liefke, 2012). The expression of the Notch co-repressor NKAP at high levels in highly proliferative type C and migrating type A cells and lower levels in SVZ astrocytes, as we show here, might be part of this modulatory pathway in the SVZ-OB lineage, e.g. via recruitment of HDACs to Notch target gene promoters (Pajerowski et al., 2009). Interestingly, Givogri et al. describe high Notch1 expression levels in PSA-NCAM+ cells in the pRMS with a decrease of Notch1 at their arrival in the OB (Givogri et al., 2006). These findings are quite similar to our data showing decreasing NKAP expression in RMS neuroblasts close to the OB. These findings are in accordance with data from Neumu¨ller et al. that show an overproliferation of drosophila neuroblasts after NKAP knockdown (Neumuller et al., 2011). Further, it was shown that drug mediated inhibition of Notch signaling as well as cell autonomous deletion of Notch1 leads to reduction of proliferating SVZ cells (Wang et al., 2009; Basak et al., 2012). NKAP as potential NF-jB activator in the SVZ neurogenesis Another important signaling pathway that controls aspects of adult neurogenesis is the NF-jB pathway (Denis-Donini et al., 2005; Widera et al., 2006; Koo et al., 2010). Upon first description NKAP has been characterized as NF-jB activating protein (Chen et al., 2003). As several members of the NF-jB are expressed in migrating neuroblasts, but also in SVZ and RMS astrocytes (Denis-Donini et al., 2005), a function of NKAP via the NF-jB pathway is possible. Yet, it is still unknown where in the pathway NKAP may regulate NFjB signaling. Another intriguing possibility comes from recent publications (Ang and Tergaonkar, 2007) that report (reciprocal) pathway crosstalk between Notch and NF-jB signaling, e.g. in the regulation of gliogenesis during mouse development (Fujita et al., 2011). As NKAP has been described to influence both pathways, it is tempting to speculate that it serves as mediator between them. NKAP expression in mature neurons Additionally to SVZ progenitor cells, NeuN+ mature neurons in the hippocampus and the thalamus and NeuN mitral cell in the OB expressed NKAP at high levels. A known function of Notch and NF-jB signaling

in mature neurons is the remodeling of neurites (Bonini et al., 2011), where the NF-jB subtype p50 acts as transcriptional repressor of the Notch ligand jagged1 and thereby inhibiting Notch-dependent neurite remodeling (Ferrari-Toninelli et al., 2009). More specifically, in the hippocampus, where we found high NKAP expression in GCL NeuN+ neurons, but also in PSA-NCAM+ cells (data not shown), Notch signaling has been linked to both regulation of NSCs in the subgranular zone and of neurite plasticity in the GCL (Breunig et al., 2007). Considering these findings, it can be speculated, whether NKAP has a role in the regulation of neurite (re-)modeling of maturing and mature neurons as well as in the regulation of neurogenesis. Altogether, potentially NKAP is an interesting new regulator of adult neurogenesis and of maintenance and cellular plasticity of mature neurons in the brain. Its differential expression profile in various distinct cell populations together with data from previous publications is suggestive for a role of NKAP in the Notch and/or NF-jB pathways in adult neurogenesis. Acknowledgments—The authors would like to thank Sandra Stelzer, Inga Werthschulte, Anna-Lena Scho¨n and Thea van Wu¨llen for excellent technical assistance. Further, we thank Manuel Grez (Frankfurt) and Hans Scho¨ler (Mu¨nster) for plasmids. J.C.S.’s lab is supported by the German Research Foundation (DFG: Emmy Noether Program, SCHW1392/2-1; SFB629 and SPP1356, SCHW1392/4-1), Schram-Stiftung (T287/21795/ 2011), Else Kro¨ner-Fresenius-Stiftung (2011_A94) and the Boehringer Ingelheim Foundation. Additionally, this work was supported by the fund ‘‘Innovative Medical Research’’ of the University of Mu¨nster Medical School (SC120901 and SC411003) and the Interdisciplinary Center for Clinical Research (IZKF) Mu¨nster (SchwJ3/001/11).

REFERENCES Ang HL, Tergaonkar V (2007) Notch and NFkappaB signaling pathways: do they collaborate in normal vertebrate brain development and function? Bioessays 29:1039–1047. Basak O, Giachino C, Fiorini E, Macdonald HR, Taylor V (2012) Neurogenic subventricular zone stem/progenitor cells are Notch1dependent in their active but not quiescent state. J Neurosci 32:5654–5666. Bonini SA, Ferrari-Toninelli G, Uberti D, Montinaro M, Buizza L, Lanni C, Grilli M, Memo M (2011) Nuclear factor kappaB-dependent neurite remodeling is mediated by Notch pathway. J Neurosci 31:11697–11705. Borggrefe T, Liefke R (2012) Fine-tuning of the intracellular canonical Notch signaling pathway. Cell Cycle 11:264–276. Breunig JJ, Silbereis J, Vaccarino FM, Sestan N, Rakic P (2007) Notch regulates cell fate and dendrite morphology of newborn neurons in the postnatal dentate gyrus. Proc Natl Acad Sci U S A 104:20558–20563. Carlen M, Meletis K, Goritz C, Darsalia V, Evergren E, Tanigaki K, Amendola M, Barnabe-Heider F, Yeung MS, Naldini L, Honjo T, Kokaia Z, Shupliakov O, Cassidy RM, Lindvall O, Frisen J (2009) Forebrain ependymal cells are Notch-dependent and generate neuroblasts and astrocytes after stroke. Nat Neurosci 12: 259–267. Cave JW (2011) Selective repression of Notch pathway target gene transcription. Dev Biol 360:123–131.

M. M. A. Worlitzer, J. C. Schwamborn / Neuroscience 266 (2014) 138–149 Chen D, Li Z, Yang Q, Zhang J, Zhai Z, Shu HB (2003) Identification of a nuclear protein that promotes NF-kappaB activation. Biochem Biophys Res Commun 310:720–724. Conti L, Pollard SM, Gorba T, Reitano E, Toselli M, Biella G, Sun Y, Sanzone S, Ying QL, Cattaneo E, Smith A (2005) Nicheindependent symmetrical self-renewal of a mammalian tissue stem cell. PLoS Biol 3:e283. Denis-Donini S, Caprini A, Frassoni C, Grilli M (2005) Members of the NF-kappaB family expressed in zones of active neurogenesis in the postnatal and adult mouse brain. Brain Res Dev Brain Res 154:81–89. Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A (1997) Cellular composition and three-dimensional organization of the subventricular germinal zone in the adult mammalian brain. J Neurosci 17:5046–5061. Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A (1999) Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97:703–716. Faigle R, Song H (2012) Signaling mechanisms regulating adult neural stem cells and neurogenesis. Biochim Biophys Acta 1830(2):2435–2448. http://dx.doi.org/10.1016/ j.bbagen.2012.09.002 (Epub 2012 Sep 12). Ferrari-Toninelli G, Bonini SA, Uberti D, Napolitano F, Stante M, Santoro F, Minopoli G, Zambrano N, Russo T, Memo M (2009) Notch activation induces neurite remodeling and functional modifications in SH-SY5Y neuronal cells. Dev Neurobiol 69: 378–391. Fujita K, Yasui S, Shinohara T, Ito K (2011) Interaction between NFkappaB signaling and Notch signaling in gliogenesis of mouse mesencephalic neural crest cells. Mech Dev 128:496–509. Givogri MI, de Planell M, Galbiati F, Superchi D, Gritti A, Vescovi A, de Vellis J, Bongarzone ER (2006) Notch signaling in astrocytes and neuroblasts of the adult subventricular zone in health and after cortical injury. Dev Neurosci 28:81–91. Hillje AL, Worlitzer MM, Palm T, Schwamborn JC (2011) Neural stem cells maintain their stemness through protein kinase C zetamediated inhibition of TRIM32. Stem Cells 29:1437–1447. Hsu FC, Pajerowski AG, Nelson-Holte M, Sundsbak R, Shapiro VS (2011) NKAP is required for T cell maturation and acquisition of functional competency. J Exp Med 208:1291–1304. Koo JW, Russo SJ, Ferguson D, Nestler EJ, Duman RS (2010) Nuclear factor-kappaB is a critical mediator of stress-impaired neurogenesis and depressive behavior. Proc Natl Acad Sci U S A 107:2669–2674. Menn B, Garcia-Verdugo JM, Yaschine C, Gonzalez-Perez O, Rowitch D, Alvarez-Buylla A (2006) Origin of oligodendrocytes in the subventricular zone of the adult brain. J Neurosci 26: 7907–7918.

149

Mullen RJ, Buck CR, Smith AM (1992) NeuN, a neuronal specific nuclear protein in vertebrates. Development 116:201–211. Neumuller RA, Richter C, Fischer A, Novatchkova M, Neumuller KG, Knoblich JA (2011) Genome-wide analysis of self-renewal in Drosophila neural stem cells by transgenic RNAi. Cell Stem Cell 8:580–593. Nolte C, Matyash M, Pivnera T, Schipke CG, Ohlemeyer C, Hanisch UK, Kirchoff F, Kettenmann H (2001) GFAP promoter-controlled EGFP-expressing transgenic mice: a tool to visualize astrocytes and astrogliosis in living brain tissue. Glia 33:72–86. Nyfeler Y, Kirch RD, Mantei N, Leone DP, Radtke F, Suter U, Taylor V (2005) Jagged1 signals in the postnatal subventricular zone are required for neural stem cell self-renewal. EMBO J 24: 3504–3515. Pajerowski AG, Nguyen C, Aghajanian H, Shapiro MJ, Shapiro VS (2009) NKAP is a transcriptional repressor of notch signaling and is required for T cell development. Immunity 30:696–707. Pajerowski AG, Shapiro MJ, Gwin K, Sundsbak R, Nelson-Holte M, Medina K, Shapiro VS (2010) Adult hematopoietic stem cells require NKAP for maintenance and survival. Blood 116: 2684–2693. Pierfelice T, Alberi L, Gaiano N (2011) Notch in the vertebrate nervous system: an old dog with new tricks. Neuron 69:840–855. Schwamborn JC, Berezikov E, Knoblich JA (2009) The TRIM-NHL protein TRIM32 activates microRNAs and prevents self-renewal in mouse neural progenitors. Cell 136:913–925. Stump G, Durrer A, Klein AL, Lutolf S, Suter U, Taylor V (2002) Notch1 and its ligands Delta-like and Jagged are expressed and active in distinct cell populations in the postnatal mouse brain. Mech Dev 114:153–159. Walker TL, Yasuda T, Adams DJ, Bartlett PF (2007) The doublecortin-expressing population in the developing and adult brain contains multipotential precursors in addition to neuronallineage cells. J Neurosci 27:3734–3742. Wang X, Mao X, Xie L, Greenberg DA, Jin K (2009) Involvement of Notch1 signaling in neurogenesis in the subventricular zone of normal and ischemic rat brain in vivo. J Cereb Blood Flow Metab 29:1644–1654. Widera D, Mikenberg I, Elvers M, Kaltschmidt C, Kaltschmidt B (2006) Tumor necrosis factor alpha triggers proliferation of adult neural stem cells via IKK/NF-kappaB signaling. BMC Neurosci 7:64. Worlitzer MM, Bunk EC, Hemmer K, Schwamborn JC (2012) Antiinflammatory treatment induced regenerative oligodendrogenesis in parkinsonian mice. Stem Cell Res Ther 3:33. Zhao C, Deng W, Gage FH (2008) Mechanisms and functional implications of adult neurogenesis. Cell 132:645–660.

(Accepted 8 February 2014) (Available online 27 February 2014)