- Email: [email protected]
The novel compound Z060228 inhibits assembly of the HBV capsid
Life Sciences 133 (2015) 1–7
Contents lists available at ScienceDirect
Life Sciences journal homepage: www.elsevier.com/locate/lifescie
The novel compound Z060228 inhibits assembly of the HBV capsid Hua Guan a,b,1, Guoming Zhao a,1, Wei Chen a, Guoyi Wu c, Hongying Liu a, Xingkai Jiang a, Song Li a,⁎, Li-li Wang a,⁎⁎ a b c
Beijing Institute of Pharmacology and Toxicology, Beijing 100850, People's Republic of China Department of Radiation Toxicology and Oncology, Beijing Key Laboratory for Radiobiology, Beijing Institute of Radiation Medicine, Beijing 100850, People's Republic of China Peking University, Beijing 100871, People's Republic of China
a r t i c l e
i n f o
Article history: Received 6 November 2014 Received in revised form 1 April 2015 Accepted 7 April 2015 Available online 25 April 2015 Keywords: Z060228 HBV Capsid Cp149 HAPs
a b s t r a c t Aims: The effective anti-HBV drugs on the market are mainly immunomodulators or nucleoside analogs. The uses of INF-α and lamivudine (3TC) are considerably limited by their low response rate, side effects, drug resistance and HBV recurrence. Thus, new mechanism-based drugs remain in urgent need. This study aimed to investigate the anti-HBV effects of the novel compound Z060228 and to confirm its anti-HBV mechanisms. Main methods: HepG2.2.15 cells and HBV-transgenic mice were used to evaluate the anti-HBV activity of Z060228. Conformational changes of the capsid structure induced by Z060228 were detected with highresolution electron microscopy (EM), size-exclusion chromatography (SEC), and atomic force microscopy (AFM). Key findings: The HBV DNA replication in the supernatants of the HepG2.2.15 cells was effectively inhibited by Z060228 and Bay41-4109. In the liver of HBV-transgenic mice, the HBcAg content was significantly decreased and HBV DNA replication was also inhibited after high-dose (30 mg/kg) Z060228 treatment. Z060228 and Bay41-4109 exhibited similar effects on the self-assembly of Cp149. SEC data revealed that Z060228 altered the equilibrium (a state of stability) of Cp149 assembly. EM data further demonstrated that Z060228 could prevent Cp149 from self-assembling to the correct core particles. Additionally, AFM results showed that a low concentration of Z060228 caused Cp149 syncretizing, whereas a high concentration caused Cp149 to polymerize. Significance: Z060228 was demonstrated to be a potential capsid targeting anti-HBV drug candidate. The methods employed here could be used as a general strategy to study mechanisms of self-assembling protein-targeted drugs. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Chronic hepatitis B virus (HBV) infection is a serious pandemic disease. The effective anti-HBV drugs on the market are mainly immunomodulators, such as interferon (INF), or nucleoside analogs [7,12]. INF-α was the first anti-HBV drug approved by FDA, but its use is considerably limited by its low response rate and side effects [13]. Lamivudine (3TC) is a nucleoside analog and an effective inhibitor of HBV DNA replication in vitro and in vivo. The long-term use of 3TC for HBV elimination, however, results in drug resistance and HBV recurrence [14]. Based on this information, it is necessary to develop innovative drugs exhibiting different mechanisms of action. Recent studies have elucidated the HBV life cycle in detail and revealed several key functional HBV proteins [1]. The capsid, a stable polymer composed of 90 or 120 homo-dimers of the core protein, can self-assemble in vitro. Within the capsid, viral DNA is synthesized by ⁎ Corresponding author. Tel.: +86 10 66932674; fax: +86 10 68240321. ⁎⁎ Corresponding author. Tel.: +86 10 66931250; fax: +86 10 68240321. E-mail address: [email protected] (S. Li), [email protected] (L. Wang). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.lfs.2015.04.011 0024-3205/© 2015 Elsevier Inc. All rights reserved.
the HBV polymerase using viral RNA as the template [3,9]. Based on these functions, the capsid, a critical structure of HBV replication and subsequent infection in host cells, is an important component of the HBV life cycle. In recent years, targeting the HBV capsid and preventing the core protein from naturally forming the capsid has become a new therapeutic strategy for developing effective anti-HBV drugs [5,9]. BAY41-4109, also referred to as heteroarylpyrimidines (HAPs), was identified as an antiviral agent that inhibits production of HBV virions both in vitro and in vivo [8]. Additionally, this compound demonstrated a more favorable inhibitory concentration (IC50) relative to lamivudine in a cell-based HBV DNA replication assay and an efficacy similar to that of 3TC in a transgenic mouse model [18]. Previous works suggested that BAY41-4109 may inhibit virus replication by inducing core protein assembly incorrectly and decreasing the stability of normal capsids [16]. These studies have indicated that targeting the HBV capsid and preventing the core protein assembly may provide a novel therapeutic strategy for anti-HBV. Since 2006, a series of novel compounds targeting the HBV capsid have also been designed and synthesized in our laboratory. Several of these compounds had potent anti-HBV activity in HepG2.2.15 cells, and Z060228 was identified as one of the most representative [19,20].
2
H. Guan et al. / Life Sciences 133 (2015) 1–7
of HBV-DNA by dot-blot hybridization (as described previously), and others were analyzed for HBcAg content. Z060228 was dissolved in the vehicle solution (distilled water containing 5% DMSO) prior to oral gavage. Mice were treated once per day for 28 days. Approximately 6 h after the last treatment, the animals were sacrificed, and their livers were removed and immediately frozen for subsequent analysis. Blood was obtained via cardiac puncture of the anesthetized animals. 2.5. Immunohistological analyses
Fig. 1. Structure of Z060228 and BAY41-4109.
2. Materials and methods 2.1. Compounds and control drugs Fig. 1 depicts the structures of Z060228 and BAY41-4109. They were synthesized in our laboratory and characterized by 1H NMR and mass spectrometry. Master stocks of Z060228, BAY41-4109, and 3TC were maintained in dimethyl sulfoxide (DMSO). Working stocks of these three drugs were freshly prepared in 50 mM HEPES to eliminate any carrier effects. 2.2. Cell culture and treatment The human HBV-transfected cell line HepG2.2.15 (preserved by the Institute of Medicinal Biotechnology) was maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal calf serum, 380 μg/ml G418, 100 unit/ml kanamycin, and 1% L-glutamine (all from Invitrogen, USA). Cells were incubated with various concentrations of Z060228 in a 96-well plate at 37 °C and 5% CO2. The medium was changed at day 4, and the cytotoxic effects of Z060228 and 3TC were assayed at day 8. The anti-HBV activity of each fraction was evaluated using a radioimmunoassay kit for HbsAg in the cultured HepG2.2.15 cells according to the manufacturer's instructions. TC50 and TC0 were calculated according to the Reed and Muench methods. Two samples from each group were analyzed for the presence of HBV-DNA by dotblot hybridization and were quantified using Lumi-Imager quantification analysis (Roche Diagnostics, Mannheim, Germany). 2.3. Animals Human HBV-transgenic mice from Guangzhou Air Force Hospital (Guangzhou, China) were maintained under a 12/12-h light/dark cycle with standard commercial diet and water ad libitum.
Liver specimens from either one or two lobes were fixed in 4% formaldehyde solution overnight at room temperature and embedded in paraffin. Two paraffin sections (5 μm) were prepared from each liver and stained with hematoxylin and eosin. For the immunohistological analyses, paraffin-embedded sections were deparaffinized and rehydrated. Non-immune rabbit serum served as a positive control. Additional steps were performed according to the avidin–biotin procedure from a Vectastain ABC kit as described by the manufacturer (DingGuo Bio-Tech, Beijing, China). Liver sections were counterstained with hematoxylin. Normal serum from non-immunized mice was used as a positive control. 2.6. Cp149 expression and purification The assessment of protein expression and the purification of the truncated HBV capsid protein (Cp149) were achieved with isopropylβ-D-l-thiogalactoside induction. Cp149 dimers were purified from Escherichia coli using size exclusion over a superpose 610/300GL column in an Akta chromatography system (both from GE Healthcare, Piscataway, NJ), as previously described [21]. Protein levels were quantified by absorbance at 280 nm. Purified Cp149 was identified by SDSPAGE, and Cp149 purity was N90% as assessed by HPLC. For all assembly experiments, the reaction buffer consisted of 100 mM HEPES (pH 7.5) and 300 mM sodium chloride. 2.7. Size-exclusion chromatography (SEC) assay The capsid assembly was initiated by mixing Cp149 with the test compounds and incubating the solutions for 24 h. The reaction buffer consisted of 100 mM HEPES (pH 7.5) and 300 mM sodium chloride. Assembly reactions were examined using SEC on a Superose column (Biosep-SEC-S3000) mounted on an HPLC system equipped with an auto-injection module. The column was equilibrated with 100 mM HEPES (pH 7.5) and 300 mM NaCl. For the time-course experiments, the assembly was initiated robotically and allowed to proceed for the indicated time prior to automatic loading. The recovered protein was classified as the void (8–9 min), capsid (9–10.5 min), intermediate elution (14.5–15 min), or dimer (15–16.5 min) based on the elution of Cp149, which contained only the capsid and dimer.
2.4. Treatment of transgenic mice 2.8. Electron microscopy (EM) The HBV-transgenic mice were assessed for HBV-specific DNA in the serum by real-time PCR prior to the experiments. DNA was extracted from serum using the QIAamp DNA blood minikit (Qiagen, Germantown, Maryland). For the analysis, 200 μl of cell culture supernatant or 100 μl of mouse serum was digested with 1 μl of RNase-free DNase I (10 to 50 U/μl; Sigma, St., Louis, MO, USA) at 37 °C for 30 min, and the DNA was recovered from a minispin column in 200 μl of eluent. Realtime PCR was carried out as described previously [10] in a Chromo 4 (Bio-Rad, Hercules, CA). The sequences of these primers are as follow: 5′ACATCAGGATTCCTAGGACC3′ (HBSF1) and 5′GGTGAGTGATTGGAGG TTG3′ (HBSR1). Following the initial evaluation, 24 HBV-transgenic male mice were divided into three groups: (1) vehicle control, (2) low dose-treated (15 mg/kg Z060228), and (3) high dose-treated (30 mg/kg Z060228). Fifteen HBV-transgenic male mice were analyzed for the presence
The capsid assembly reactions were prepared for EM as described previously [6]. For the negative staining, 10 μl of a solution containing the assembled core particles was applied to a carbon-coated grid and incubated for 1 min. The grid was then washed with water and stained with 2% uranyl acetate for 1 min. The samples were visualized on a Hitachi H-7600 transmission electron microscope, and the images were collected using an AMT 2K_2K CCD camera. 2.9. Atomic force microscopy (AFM) The capsid assembly reactions were prepared for AFM in the same manner as described for SEC. The sample was diluted to 1:1000 with 100 mM HEPES (pH 7.5) and 300 mM NaCl buffer. A 10-μl drop of diluted particle solution was deposited onto freshly cleaved mica.
H. Guan et al. / Life Sciences 133 (2015) 1–7 Table 1 Anti-HBV activity of Z060228 and Bay 41-4109 in HepG2.2.15 cells. Compounds
IC50 (μM)
TC50 (μM)
TIa
BAY41-4109 Z060228 3Tc
0.35 0.28 b1
5.06 106.4
14.46 380
a Therapeutic index (TI) indicates the safety of drugs. TI = TC50 / IC50; IC50 value refers effects of compound on HBV DNA secretion in HepG2.2.15 cell; TC50 is the cytotoxic dose that caused 50% of the cells to die.
3
106.4 μM, while the IC50 value for BAY41-4109 was 0.35 μM, and the TC50 value was 5.06 μM. Z060228 was significantly less toxic than BAY41-4109. The cytotoxic doses that caused 50% of the primary hepatocytes to die (TC50) were 5.06 μM for BAY 41-4109 and 106.4 μM for Z060228 (P b 0.01). This indicated that Z060228 was less toxic than BAY 41-4109 under the same conditions. The therapeutic index (TI) of Z060228 was 380, which is greater than that of BAY41-4109 (Table 1). Based on these results, it is obvious that Z060228 is a more effective inhibitor than BAY41-4109 in vitro. 3.2. Anti-HBV activity of Z060228 in HBV-transgenic mice
Table 2 Z060228 altered HBV-DNA content in the liver of HBV-transgenic mice. Groups
HBV-DNA (pg/10 μg total liver tissue DNA)
Control 15 mg/kg 30 mg/kg
875 ± 514 819 ± 812 492 ± 466⁎⁎
n=5 n=5 n=5
⁎⁎ P b 0.01 vs. control group.
The remaining steps were performed as described previously [4]. Briefly, the dried mica with the sample was kept in a neat dryer overnight and then observed by AFM. The AFM instrument was a Nanoscope IIIa Multimode scanning probe microscope (Digital Instruments Co., Santa Barbara, CA). Images were obtained at ambient temperature and humidity. The set point voltage was adjusted for optimum image quality. Both height and phase information were recorded with the scan. 2.10. HBcAg ELISA assay Cp149 was incubated with either Z060228 or BAY41-4109 under a variety of conditions in100 mM HEPES (pH 7.5) and 300 mM sodium chloride overnight. Then, the product of the reactions was examined by ELISA according to the manufacturer's instructions (HBcAg test kits, product of Beijing MDC Biotech Ltd.). After the addition of the stop solution, the microplate was read at 450 nm within 10 min. The inhibitory activity of the test compound was expressed as the percentage of decrease in optical density (OD) and calculated as 100% × ((OD450 of the Buffer control) − (OD450 of the test compound)) / (OD450 of the Buffer control). Each experiment was performed in triplicate. 3. Results 3.1. Anti-HBV activity of Z060228 in HepG2.2.15 cells Anti-HBV activity was assessed in HepG2.2.15 cells. The IC50 value for Z060228 was approximately 0.28 μM, and the TC50 value was
HBV-specific DNA in the liver of HBV-transgenic mice was analyzed (Table 2). Treatment with 30 mg/kg Z060228 resulted in a more effective reduction of HBV DNA content than that of 15 mg/kg. To assess the influence of the treatment on HBcAg, an immunohistological analysis of the liver sections was performed (Fig. 2). Relative to the vehiclecontrol group, a reduction of cytoplasmic HBcAg content was observed in the 30 mg/kg groups. Thus, 30 mg/kg Z060228 produced the most notable reductions in HBV-DNA and HBcAg content in the livers of the transgenic mice. 3.3. SEC assessment of the effect of Z060228 on capsid The effects of Z060228 on HBV capsid assembly were initially monitored by SEC (Fig. 3). When Z060228 was absent, the capsid and dimer were eluted at approximately 9 and 15 min, respectively. With increasing concentrations of Z060228, however, the peak of dimer dropped and even disappeared at 10 μM Z060228. When the concentration of Z060228 exceeded 10 μM, only a single large non-capsid polymer product was observed. Here, we call it void (Fig. 3A). Z060228 treatment can result in the reduction of more dimers. Allowing for the production of few capsids, some large non-capsid polymers were formed. In contrast, we consistently observed products resulting from the assembly reactions containing BAY41-4109 and 3TC. Treatment with BAY41-4109 increased capsid content and decreased dimer content at the lower concentrations (≤10 μM). The majority of products were the void at higher concentrations (≥10 μM), as observed in a previous report for BAY41-4109 [16]. As the reaction approached equilibrium, an intermediate appeared simultaneously. Based on these results, the effect of Z060228 was similar to that of BAY41-4109 (Fig. 3D, E). 3TC exposure did not show any effect on the dimer. The capsid peak decreased as the drug concentration increased, whereas other product peaks were not dose-dependent with the 3TC concentration (Fig. 3C, F). These results indicated that Z060228 and BAY41-4109 act through a different mechanism from 3TC. Based on these results, the effect of Z060228 was similar to that of BAY41-4109
Fig. 2. Z060228 decreased the HBcAg content in the liver of HBV-transgenic mice. (A) Control (0 mg/kg Z060228); (B) 30 mg/kg Z060228. (C) A vs. B. Data are expressed as the means ± S.D. (n = 3). **P b 0.01 vs. control group.
4
H. Guan et al. / Life Sciences 133 (2015) 1–7
Fig. 3. Effect of compounds on Cp149 assembly by SEC (A) Z060228, (B) BAY41-4109, and (C) 3TC. (D), (E), and (F) correspond to (A), (B), and (C), respectively. Data are from the three experiments, each performed in triplicate.
and Z060228 and BAY41-4109 act through a different mechanism from 3TC. 3.4. EM assessment of the effect of Z060228 on capsids To better characterize the underlying mechanisms by which Z060228 inhibits HBV replication, products of the assembly reactions were examined by EM (Fig. 4). When Z060228 was absent, the products of assembly were balloon-shaped particles (Fig. 4A), and the diameter was approximately 28 nm. As Z060228 was added, changes were observed. The open and abnormal, curly masses and the small, normal balloon-shaped particles were observed at lower concentrations (2.5 μM) (Fig. 4B). At 10 μM, balloon-shaped particles were scarce, and
the occurrence of curly structures and the volume of the products of assembly increased (Fig. 4C). When treated with 20 μM, the masses were still observed, and the volume of the products decreased (Fig. 4D). Similar effects were observed by EM for BAY41-4109 treatment (Fig. 4E–H). The results revealed that the compound Z060228 could prevent Cp149 from self-assembling virus particles correctly. 3.5. AFM assessment of the effect of Z060228 on capsids The products of the assembly reactions were also examined using AFM. In the absence of Z060228, Cp149 can self-assemble into a capsid-like virus particle in vitro (Fig. 5A). When treated with 2.5 μM Z060228, tube-shaped and circles particles were formed (Fig. 5B). The
Fig. 4. TEM images of core particles with or without the indicated drugs. Assembly reactions were performed at room temperature with 10 μM Cp149 and different concentrations of Z060228 or BAY41-4109. (A–D) were performed at 0, 2.5 μM, 10 μM and 20 μM Z060228, respectively; (E–H) were performed at 0, 2.5 μM, 10 μM and 20 μM of BAY41-4109, respectively. The bar in the micrograph represents 100 nm.
H. Guan et al. / Life Sciences 133 (2015) 1–7
5
Fig. 5. Z060228 alters Cp149 assembly reactions when performed at room temperature with 10 μM Cp149 and different concentrations of z060228 (A) 0 μM Z060228; (B) 2.5 μM Z060228; (C) 10 μM Z060228; (D) and (E) represent 2D images of (B) and (C), respectively and half-high width measures of the off-line section analysis of Cp149. Scan size, 1 mM × 1 mM.
diameter of the circles was approximately 101 nm, which was similar to that observed by EM (Fig. 5D). When treated with 10 μM Z060228, particle assembly formed a mass-structure, and an increase in the volume of the products was also noted (Fig. 5C). The diameter of these particles was about from 300 nm to 64 nm (Fig. 5E). At 20 μM Z060228, the large structures were disassembled, and various abnormal protein structures and debris were produced. Finally, treatment with the highest concentration of z060228 (40 μM) resulted in a disappearance of the large particles (data not shown). The results of the AFM demonstrate that compound Z060228 can induce the formation of abnormal Cp149 morphology.
Within the core particle, viral DNA is synthesized by HBV polymerase using viral RNA as the template [5]. Therefore, capsid assembly is critical for replication within the HBV life cycle. Due to this critical role, the assembly of the capsid has emerged as a novel target for the development of anti-HBV agents. Derivatives of HAPs were initially identified as highly potent inhibitors of HBV replication in a tissue culture-based screen [18]. Z060228 is a novel non-nucleoside anti-HBV compound that was identified from a series of HAPs. In the present study, we used BAY41-4109 as a control drug to confirm the antiviral effect and mechanism of Z060228.
3.6. Effect of Z060228 on capsids confirmed by HBcAg ELISA The immunogenicity of HBcAg can reflect the proper structure of the capsid assembled when core proteins are properly assembled. To sufficiently evaluate the effects of different concentrations of Z060228 on the Cp149 self-assembly, the immunogenicity of HBcAg was detected using ELISA methods after the Cp149 self-assembly reaction reached equilibrium. The activity of the compound inhibiting the Cp149 assembly (inhibition rate) was calculated. The inhibition rate of Z060228 was significantly higher than that of BAY4109 when the compound concentration was 2.5 μM. Both Z060228 and Bay41-4109 induced the misassembly and led to aberrant structures of the capsid protein (Cp149). The results indicated that Z060228 and BAY41-4109 had similar effects on Cp149 self-assembly, and Z060228 was more effective than BAY41-4109 in vitro (Fig. 6). 4. Discussion The capsid is assembled by the HBV core protein, pgRNA and RT. The pgRNA is encapsidated with the core protein to form a core particle.
Fig. 6. Z060228 and Bay-41-4109 inhibit Cp149 self-assembly as detected by HBcAg ELISA in vitro.
6
H. Guan et al. / Life Sciences 133 (2015) 1–7
The EC50 of Z060228 against HBV (0.28 μM) was lower than that of BAY41-4109 in HepG2.2.15 cells following an 8-day treatment. It is worth noting that the anti-HBV activity of Z060228 was greater than that of BAY41-4109 (Table 1). Immunohistological analyses were performed on the livers of transgenic mice to assess the influence of the treatment on the HBV core antigen. Relative to the vehicle control group, a reduction of HBcAg content was observed in HBV-transgenic mice treated with 30 mg/kg Z060228 (Fig. 2). Based on these results, we can conclude that Z060228 may provide a potential treatment option for chronic HBV. To confirm the mechanism of Z060228 in vitro, several tests were performed. Cp149, the truncated HBV capsid protein that was expressed and purified from E. coli that can self-assemble into a capsid-like virus particle in vitro [17], was incubated with Z060228 overnight, resulting in significant changes in the assembly products. Dimensions of the capsid particle could be observed and measured by AFM. In addition to AFM analyses, we also assessed the effects of Z060228 on Cp149 with TEM and SEC. All the results suggest that Z060228 can alter the equilibrium and change the outcome of HBV Cp149 self-assembly. Due to its objectivity, convenience, and precision, SEC is likely the best screening system for potential anti-HBV compounds that target the capsid assembly. Our present study demonstrates that treatment with Z060228 can result in the misassembly of the HBV capsid and in the formation of non-functional structures, such as hollow tubes or abnormal crinkles. These misassembled structures can accelerate core protein degradation. The results are consistent with a previous report on BAY41-4109 [11]. We confirmed that Z060228 inhibits virus replication by inducing core protein assembly incorrectly. However, the binding site of Z060228 was unclear. Currently, there are three hypotheses regarding the target of HAPs. One hypothesis is that the binding site is near the cluster of histidine residues at the base of the intradimer interface [8]. The second is that an additional HAPs binding site exists at the interdimer interface [17]. The third hypothesis is that the drug binds to a small oligomer of dimers [21]. Our SEC data revealed that exposure to both Z060228 and BAY41-4109 resulted in the decreased dimer content of Cp149 at lower concentrations in a dose-dependent manner. Additionally, the open balloon-shaped particles and abnormal curly masses were observed by TEM and AFM at lower concentrations (≤10 μM). The aberrant structures were induced in a dose-dependent manner at higher concentrations. According to the ELISA results, both Z060228 and BAY41-4109 elicited an inhibitory effect on the preformed capsid. These data indicate that Z060228 binds to the dimer and are consistent with Hacker's hypothesis. In contrast, 3TC treatment resulted in some distinct differences to that of Z060228 and BAY41-4109.Crosslinking studies have suggested that the binding site involves histidine residues that form a cluster at the base of the intradimer interface (spike) [8]. We also made these observations by TEM and AFM, with core proteins forming clusters at lower concentrations. A conformational change at the intradimer interface at the base of the spike could potentially propagate to the major core-specific antigen epitope at the tip of the spike modifying the local conformation enough to alter antibody binding [2]. This scenario is consistent with our reduced ELISA signal at the higher Z060228 concentrations. Stray et al. also reported that at ≤0.5 ratio of BAY41-4109 to the HBV Cp, binding of BAY41-4109 to the HBV Cp dimer had little effect on capsid stability [15]. The capsids that were destabilized demonstrated larger non-capsid ‘void’ oligomers at 1:1 binding of BAY41-4109 to the HBV Cp dimer. In our studies, this value at lower concentrations was consistent for the capsid, but we only identified larger non-capsid ‘void’ oligomers at higher concentrations. When assembly reactions did not reach equilibrium, the resulting products resolved as two separate peaks, described as capsid and ‘void’ (data not shown). As the reaction time increased, the capsid peak changed to that of the ‘void’ peak. In addition to the previous hypotheses stating that HAPs antagonize HBV,
we propose another possible mechanism: HAPs tend to bind to dimers, causing dimer conformational change from an assembly inactive to an assembly active state that form the capsid. Excessive HAPs then bind to the capsids, causing conformation transitions and instability to the deregulating ‘void’. In addition to destroying the construct, these conformational changes may cause RT site exposure, resulting in the inhibition of HBV activity. 5. Conclusions Z060228, a non-nucleoside analog antiviral compound that acts on the HBV capsid, offers a novel anti-HBV therapeutic strategy. Although much pre-clinical work is still needed, characterization of this novel mechanism and the strong, specific anti-HBV activity of Z060228 form the basis for future clinical studies. Conflict of interest statement The authors declare no conflicts of interest.
Acknowledgments We gratefully acknowledge the National Natural Science Foundation of China (Grant Nos. 21172263, 81173081 and 81172923) for financial support. We thank Dr. Li Lin (Institute of Chemistry, Chinese Academy of Sciences) for providing the electron micrographs in Fig. 5 and Professor Ping-kun Zhou (Beijing Institute of Radiation Medicine, Beijing, China) for help with the discussion and for editorial assistance with the paper. We are grateful to Guangzhou Air Force Hospital (Guangzhou, China) for measuring the inhibitory activity of Z060228 against HBV. References [1] D.M. Belnap, N.R. Watts, J.F. Conway, N. Cheng, S.J. Stahl, P.T. Wingfield, A.C. Steven, et al., Diversity of core antigen epitopes of hepatitis B virus, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 10884–10889. [2] B. Bottcher, M. Vogel, M. Ploss, M. Nassal, High plasticity of the hepatitis B virus capsid revealed by conformational stress, J. Mol. Biol. 356 (2006) 812–822. [3] P. Ceres, S.J. Stray, A. Zlotnick, Hepatitis B virus capsid assembly is enhanced by naturally occurring mutation F97 L, J. Virol. 78 (2004) 9538–9543. [4] H. Chen, J.H. Lu, W.Q. Liang, Y.H. Huang, W.J. Zhang, D.B. Zhang, et al., Purification of the recombinant hepatitis B virus core antigen (rHBcAg) produced in the yeast Saccharomyces cerevisiae and comparative observation of its particles by transmission electron microscopy (TEM) and atomic force microscopy (AFM), Micron 35 (2004) 311–318. [5] I.-G. Choi, Y.G. Yu, Interaction and assembly of HBV structural proteins: novel target sites of anti-HBV agents, Infectious Disorders - Drug Targets 7 (2007) 251–256. [6] R.A. Crowther, N.A. Kiselev, B. Bottcher, J.D. Berriman, G.P. Borisova, V. Oe, et al., Three-dimensional structure of hepatitis B virus core particles determined by electron cryomicroscopy, Cell 77 (1994) 943–950. [7] E. De Clercq, Antiviral drugs in current clinical use, J. Clin. Virol. 30 (2004) 115–133. [8] K. Deres, C.H. Schroder, A. Paessens, S. Goldmann, H. Hacker, O. Weber, et al., Inhibition of hepatitis B virus replication by drug-induced depletion of nucleocapsids, Science 299 (2003) 893–896. [9] D. Endres, M. Miyahara, P. Paul Moisant, A. Zlotnick, A reaction landscape identifies the intermediates critical for self-assembly of virus capsids and other polyhedral structures, Protein Sci. 14 (2005) 1518–1525. [10] M.A. Feitelson, M.M. Clayton, B. Sun, R.F. Schinazi, Development of a novel mouse model to evaluate drug candidates against hepatitis B virus, Antivir. Chem. Chemother 18 (2007) 213–223. [11] H. Hacker, K. Deres, M. Mildenberger, C. Schroder, Antivirals interacting with hepatitis B virus core protein and core mutations may misdirect capsid assembly in a similar fashion, Biochem. Pharmacol. 66 (2003) 2273–2279. [12] J.C. Humphries, J.S. Dixon, Antivirals for the treatment of chronic hepatitis B: current and future options, Intervirology 46 (2003) 413–420. [13] R. Loomba, T.J. Liang, Novel approaches to new therapies for hepatitis B virus infection, Antivir. Ther. 11 (2006) 1–15. [14] R.P. Perrillo, Current treatment of chronic hepatitis B: benefits and limitations, Semin. Liver Dis. 25 (Suppl. 1) (2005) 20–28. [15] S.J. Stray, C.R. Bourne, S. Punna, W.G. Lewis, M.G. Finn, A. Zlotnick, A heteroaryldihydropyrimidine activates and can misdirect hepatitis B virus capsid assembly, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 8138–8143. [16] S.J. Stray, A. Zlotnick, BAY41-4109 has multiple effects on hepatitis B virus capsid assembly, J Molecular Recognition 19 (2006) 542–548. [17] I. Takayuki, S. Keishin, A. Satoshi, M. Yoshinobu, M. Hiroshi, M. Tadao, Purification and characterization of the hepatitis B virus core antigen produced in the yeast Saccharomyces cerevisiae, J. Biotech 8 (1988) 149–162.
H. Guan et al. / Life Sciences 133 (2015) 1–7 [18] O. Weber, K.H. Schlemmer, E. Hartmann, I. Hagelschuer, A. Paessens, E. Graef, et al., Inhibition of human hepatitis B virus (HBV) by a novel non-nucleosidic compound in a transgenic mouse model, Antivir. Res. 54 (2002) 69–78. [19] X.Y. Yang, G.Q. Xia, X.K. Wang, Z.B. Zheng, D.M. Zhao, G.M. Zhao, et al., An efficient synthesis of enantiopure (R)-heteroarylpyrimidine analogs, Molecules 18 (2013) 11144–11152.
7
[20] G.M. Zhao, X.K. Wang, X.J. Zhu, H. Guan, W. Zhong, L.L. Wang, et al., Synthesis and anti-HBV activity of novel dihydropyrimidine analogs, Sci. Sin. Vitae 41 (2011) 971–977. [21] A. Zlotnick, P. Ceres, S. Singh, J.M. Johnson, A small molecule inhibits and misdirects assembly of hepatitis B virus capsids, J. Virol. 76 (2002) 4848–4854.
Contents lists available at ScienceDirect
Life Sciences journal homepage: www.elsevier.com/locate/lifescie
The novel compound Z060228 inhibits assembly of the HBV capsid Hua Guan a,b,1, Guoming Zhao a,1, Wei Chen a, Guoyi Wu c, Hongying Liu a, Xingkai Jiang a, Song Li a,⁎, Li-li Wang a,⁎⁎ a b c
Beijing Institute of Pharmacology and Toxicology, Beijing 100850, People's Republic of China Department of Radiation Toxicology and Oncology, Beijing Key Laboratory for Radiobiology, Beijing Institute of Radiation Medicine, Beijing 100850, People's Republic of China Peking University, Beijing 100871, People's Republic of China
a r t i c l e
i n f o
Article history: Received 6 November 2014 Received in revised form 1 April 2015 Accepted 7 April 2015 Available online 25 April 2015 Keywords: Z060228 HBV Capsid Cp149 HAPs
a b s t r a c t Aims: The effective anti-HBV drugs on the market are mainly immunomodulators or nucleoside analogs. The uses of INF-α and lamivudine (3TC) are considerably limited by their low response rate, side effects, drug resistance and HBV recurrence. Thus, new mechanism-based drugs remain in urgent need. This study aimed to investigate the anti-HBV effects of the novel compound Z060228 and to confirm its anti-HBV mechanisms. Main methods: HepG2.2.15 cells and HBV-transgenic mice were used to evaluate the anti-HBV activity of Z060228. Conformational changes of the capsid structure induced by Z060228 were detected with highresolution electron microscopy (EM), size-exclusion chromatography (SEC), and atomic force microscopy (AFM). Key findings: The HBV DNA replication in the supernatants of the HepG2.2.15 cells was effectively inhibited by Z060228 and Bay41-4109. In the liver of HBV-transgenic mice, the HBcAg content was significantly decreased and HBV DNA replication was also inhibited after high-dose (30 mg/kg) Z060228 treatment. Z060228 and Bay41-4109 exhibited similar effects on the self-assembly of Cp149. SEC data revealed that Z060228 altered the equilibrium (a state of stability) of Cp149 assembly. EM data further demonstrated that Z060228 could prevent Cp149 from self-assembling to the correct core particles. Additionally, AFM results showed that a low concentration of Z060228 caused Cp149 syncretizing, whereas a high concentration caused Cp149 to polymerize. Significance: Z060228 was demonstrated to be a potential capsid targeting anti-HBV drug candidate. The methods employed here could be used as a general strategy to study mechanisms of self-assembling protein-targeted drugs. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Chronic hepatitis B virus (HBV) infection is a serious pandemic disease. The effective anti-HBV drugs on the market are mainly immunomodulators, such as interferon (INF), or nucleoside analogs [7,12]. INF-α was the first anti-HBV drug approved by FDA, but its use is considerably limited by its low response rate and side effects [13]. Lamivudine (3TC) is a nucleoside analog and an effective inhibitor of HBV DNA replication in vitro and in vivo. The long-term use of 3TC for HBV elimination, however, results in drug resistance and HBV recurrence [14]. Based on this information, it is necessary to develop innovative drugs exhibiting different mechanisms of action. Recent studies have elucidated the HBV life cycle in detail and revealed several key functional HBV proteins [1]. The capsid, a stable polymer composed of 90 or 120 homo-dimers of the core protein, can self-assemble in vitro. Within the capsid, viral DNA is synthesized by ⁎ Corresponding author. Tel.: +86 10 66932674; fax: +86 10 68240321. ⁎⁎ Corresponding author. Tel.: +86 10 66931250; fax: +86 10 68240321. E-mail address: [email protected] (S. Li), [email protected] (L. Wang). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.lfs.2015.04.011 0024-3205/© 2015 Elsevier Inc. All rights reserved.
the HBV polymerase using viral RNA as the template [3,9]. Based on these functions, the capsid, a critical structure of HBV replication and subsequent infection in host cells, is an important component of the HBV life cycle. In recent years, targeting the HBV capsid and preventing the core protein from naturally forming the capsid has become a new therapeutic strategy for developing effective anti-HBV drugs [5,9]. BAY41-4109, also referred to as heteroarylpyrimidines (HAPs), was identified as an antiviral agent that inhibits production of HBV virions both in vitro and in vivo [8]. Additionally, this compound demonstrated a more favorable inhibitory concentration (IC50) relative to lamivudine in a cell-based HBV DNA replication assay and an efficacy similar to that of 3TC in a transgenic mouse model [18]. Previous works suggested that BAY41-4109 may inhibit virus replication by inducing core protein assembly incorrectly and decreasing the stability of normal capsids [16]. These studies have indicated that targeting the HBV capsid and preventing the core protein assembly may provide a novel therapeutic strategy for anti-HBV. Since 2006, a series of novel compounds targeting the HBV capsid have also been designed and synthesized in our laboratory. Several of these compounds had potent anti-HBV activity in HepG2.2.15 cells, and Z060228 was identified as one of the most representative [19,20].
2
H. Guan et al. / Life Sciences 133 (2015) 1–7
of HBV-DNA by dot-blot hybridization (as described previously), and others were analyzed for HBcAg content. Z060228 was dissolved in the vehicle solution (distilled water containing 5% DMSO) prior to oral gavage. Mice were treated once per day for 28 days. Approximately 6 h after the last treatment, the animals were sacrificed, and their livers were removed and immediately frozen for subsequent analysis. Blood was obtained via cardiac puncture of the anesthetized animals. 2.5. Immunohistological analyses
Fig. 1. Structure of Z060228 and BAY41-4109.
2. Materials and methods 2.1. Compounds and control drugs Fig. 1 depicts the structures of Z060228 and BAY41-4109. They were synthesized in our laboratory and characterized by 1H NMR and mass spectrometry. Master stocks of Z060228, BAY41-4109, and 3TC were maintained in dimethyl sulfoxide (DMSO). Working stocks of these three drugs were freshly prepared in 50 mM HEPES to eliminate any carrier effects. 2.2. Cell culture and treatment The human HBV-transfected cell line HepG2.2.15 (preserved by the Institute of Medicinal Biotechnology) was maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal calf serum, 380 μg/ml G418, 100 unit/ml kanamycin, and 1% L-glutamine (all from Invitrogen, USA). Cells were incubated with various concentrations of Z060228 in a 96-well plate at 37 °C and 5% CO2. The medium was changed at day 4, and the cytotoxic effects of Z060228 and 3TC were assayed at day 8. The anti-HBV activity of each fraction was evaluated using a radioimmunoassay kit for HbsAg in the cultured HepG2.2.15 cells according to the manufacturer's instructions. TC50 and TC0 were calculated according to the Reed and Muench methods. Two samples from each group were analyzed for the presence of HBV-DNA by dotblot hybridization and were quantified using Lumi-Imager quantification analysis (Roche Diagnostics, Mannheim, Germany). 2.3. Animals Human HBV-transgenic mice from Guangzhou Air Force Hospital (Guangzhou, China) were maintained under a 12/12-h light/dark cycle with standard commercial diet and water ad libitum.
Liver specimens from either one or two lobes were fixed in 4% formaldehyde solution overnight at room temperature and embedded in paraffin. Two paraffin sections (5 μm) were prepared from each liver and stained with hematoxylin and eosin. For the immunohistological analyses, paraffin-embedded sections were deparaffinized and rehydrated. Non-immune rabbit serum served as a positive control. Additional steps were performed according to the avidin–biotin procedure from a Vectastain ABC kit as described by the manufacturer (DingGuo Bio-Tech, Beijing, China). Liver sections were counterstained with hematoxylin. Normal serum from non-immunized mice was used as a positive control. 2.6. Cp149 expression and purification The assessment of protein expression and the purification of the truncated HBV capsid protein (Cp149) were achieved with isopropylβ-D-l-thiogalactoside induction. Cp149 dimers were purified from Escherichia coli using size exclusion over a superpose 610/300GL column in an Akta chromatography system (both from GE Healthcare, Piscataway, NJ), as previously described [21]. Protein levels were quantified by absorbance at 280 nm. Purified Cp149 was identified by SDSPAGE, and Cp149 purity was N90% as assessed by HPLC. For all assembly experiments, the reaction buffer consisted of 100 mM HEPES (pH 7.5) and 300 mM sodium chloride. 2.7. Size-exclusion chromatography (SEC) assay The capsid assembly was initiated by mixing Cp149 with the test compounds and incubating the solutions for 24 h. The reaction buffer consisted of 100 mM HEPES (pH 7.5) and 300 mM sodium chloride. Assembly reactions were examined using SEC on a Superose column (Biosep-SEC-S3000) mounted on an HPLC system equipped with an auto-injection module. The column was equilibrated with 100 mM HEPES (pH 7.5) and 300 mM NaCl. For the time-course experiments, the assembly was initiated robotically and allowed to proceed for the indicated time prior to automatic loading. The recovered protein was classified as the void (8–9 min), capsid (9–10.5 min), intermediate elution (14.5–15 min), or dimer (15–16.5 min) based on the elution of Cp149, which contained only the capsid and dimer.
2.4. Treatment of transgenic mice 2.8. Electron microscopy (EM) The HBV-transgenic mice were assessed for HBV-specific DNA in the serum by real-time PCR prior to the experiments. DNA was extracted from serum using the QIAamp DNA blood minikit (Qiagen, Germantown, Maryland). For the analysis, 200 μl of cell culture supernatant or 100 μl of mouse serum was digested with 1 μl of RNase-free DNase I (10 to 50 U/μl; Sigma, St., Louis, MO, USA) at 37 °C for 30 min, and the DNA was recovered from a minispin column in 200 μl of eluent. Realtime PCR was carried out as described previously [10] in a Chromo 4 (Bio-Rad, Hercules, CA). The sequences of these primers are as follow: 5′ACATCAGGATTCCTAGGACC3′ (HBSF1) and 5′GGTGAGTGATTGGAGG TTG3′ (HBSR1). Following the initial evaluation, 24 HBV-transgenic male mice were divided into three groups: (1) vehicle control, (2) low dose-treated (15 mg/kg Z060228), and (3) high dose-treated (30 mg/kg Z060228). Fifteen HBV-transgenic male mice were analyzed for the presence
The capsid assembly reactions were prepared for EM as described previously [6]. For the negative staining, 10 μl of a solution containing the assembled core particles was applied to a carbon-coated grid and incubated for 1 min. The grid was then washed with water and stained with 2% uranyl acetate for 1 min. The samples were visualized on a Hitachi H-7600 transmission electron microscope, and the images were collected using an AMT 2K_2K CCD camera. 2.9. Atomic force microscopy (AFM) The capsid assembly reactions were prepared for AFM in the same manner as described for SEC. The sample was diluted to 1:1000 with 100 mM HEPES (pH 7.5) and 300 mM NaCl buffer. A 10-μl drop of diluted particle solution was deposited onto freshly cleaved mica.
H. Guan et al. / Life Sciences 133 (2015) 1–7 Table 1 Anti-HBV activity of Z060228 and Bay 41-4109 in HepG2.2.15 cells. Compounds
IC50 (μM)
TC50 (μM)
TIa
BAY41-4109 Z060228 3Tc
0.35 0.28 b1
5.06 106.4
14.46 380
a Therapeutic index (TI) indicates the safety of drugs. TI = TC50 / IC50; IC50 value refers effects of compound on HBV DNA secretion in HepG2.2.15 cell; TC50 is the cytotoxic dose that caused 50% of the cells to die.
3
106.4 μM, while the IC50 value for BAY41-4109 was 0.35 μM, and the TC50 value was 5.06 μM. Z060228 was significantly less toxic than BAY41-4109. The cytotoxic doses that caused 50% of the primary hepatocytes to die (TC50) were 5.06 μM for BAY 41-4109 and 106.4 μM for Z060228 (P b 0.01). This indicated that Z060228 was less toxic than BAY 41-4109 under the same conditions. The therapeutic index (TI) of Z060228 was 380, which is greater than that of BAY41-4109 (Table 1). Based on these results, it is obvious that Z060228 is a more effective inhibitor than BAY41-4109 in vitro. 3.2. Anti-HBV activity of Z060228 in HBV-transgenic mice
Table 2 Z060228 altered HBV-DNA content in the liver of HBV-transgenic mice. Groups
HBV-DNA (pg/10 μg total liver tissue DNA)
Control 15 mg/kg 30 mg/kg
875 ± 514 819 ± 812 492 ± 466⁎⁎
n=5 n=5 n=5
⁎⁎ P b 0.01 vs. control group.
The remaining steps were performed as described previously [4]. Briefly, the dried mica with the sample was kept in a neat dryer overnight and then observed by AFM. The AFM instrument was a Nanoscope IIIa Multimode scanning probe microscope (Digital Instruments Co., Santa Barbara, CA). Images were obtained at ambient temperature and humidity. The set point voltage was adjusted for optimum image quality. Both height and phase information were recorded with the scan. 2.10. HBcAg ELISA assay Cp149 was incubated with either Z060228 or BAY41-4109 under a variety of conditions in100 mM HEPES (pH 7.5) and 300 mM sodium chloride overnight. Then, the product of the reactions was examined by ELISA according to the manufacturer's instructions (HBcAg test kits, product of Beijing MDC Biotech Ltd.). After the addition of the stop solution, the microplate was read at 450 nm within 10 min. The inhibitory activity of the test compound was expressed as the percentage of decrease in optical density (OD) and calculated as 100% × ((OD450 of the Buffer control) − (OD450 of the test compound)) / (OD450 of the Buffer control). Each experiment was performed in triplicate. 3. Results 3.1. Anti-HBV activity of Z060228 in HepG2.2.15 cells Anti-HBV activity was assessed in HepG2.2.15 cells. The IC50 value for Z060228 was approximately 0.28 μM, and the TC50 value was
HBV-specific DNA in the liver of HBV-transgenic mice was analyzed (Table 2). Treatment with 30 mg/kg Z060228 resulted in a more effective reduction of HBV DNA content than that of 15 mg/kg. To assess the influence of the treatment on HBcAg, an immunohistological analysis of the liver sections was performed (Fig. 2). Relative to the vehiclecontrol group, a reduction of cytoplasmic HBcAg content was observed in the 30 mg/kg groups. Thus, 30 mg/kg Z060228 produced the most notable reductions in HBV-DNA and HBcAg content in the livers of the transgenic mice. 3.3. SEC assessment of the effect of Z060228 on capsid The effects of Z060228 on HBV capsid assembly were initially monitored by SEC (Fig. 3). When Z060228 was absent, the capsid and dimer were eluted at approximately 9 and 15 min, respectively. With increasing concentrations of Z060228, however, the peak of dimer dropped and even disappeared at 10 μM Z060228. When the concentration of Z060228 exceeded 10 μM, only a single large non-capsid polymer product was observed. Here, we call it void (Fig. 3A). Z060228 treatment can result in the reduction of more dimers. Allowing for the production of few capsids, some large non-capsid polymers were formed. In contrast, we consistently observed products resulting from the assembly reactions containing BAY41-4109 and 3TC. Treatment with BAY41-4109 increased capsid content and decreased dimer content at the lower concentrations (≤10 μM). The majority of products were the void at higher concentrations (≥10 μM), as observed in a previous report for BAY41-4109 [16]. As the reaction approached equilibrium, an intermediate appeared simultaneously. Based on these results, the effect of Z060228 was similar to that of BAY41-4109 (Fig. 3D, E). 3TC exposure did not show any effect on the dimer. The capsid peak decreased as the drug concentration increased, whereas other product peaks were not dose-dependent with the 3TC concentration (Fig. 3C, F). These results indicated that Z060228 and BAY41-4109 act through a different mechanism from 3TC. Based on these results, the effect of Z060228 was similar to that of BAY41-4109
Fig. 2. Z060228 decreased the HBcAg content in the liver of HBV-transgenic mice. (A) Control (0 mg/kg Z060228); (B) 30 mg/kg Z060228. (C) A vs. B. Data are expressed as the means ± S.D. (n = 3). **P b 0.01 vs. control group.
4
H. Guan et al. / Life Sciences 133 (2015) 1–7
Fig. 3. Effect of compounds on Cp149 assembly by SEC (A) Z060228, (B) BAY41-4109, and (C) 3TC. (D), (E), and (F) correspond to (A), (B), and (C), respectively. Data are from the three experiments, each performed in triplicate.
and Z060228 and BAY41-4109 act through a different mechanism from 3TC. 3.4. EM assessment of the effect of Z060228 on capsids To better characterize the underlying mechanisms by which Z060228 inhibits HBV replication, products of the assembly reactions were examined by EM (Fig. 4). When Z060228 was absent, the products of assembly were balloon-shaped particles (Fig. 4A), and the diameter was approximately 28 nm. As Z060228 was added, changes were observed. The open and abnormal, curly masses and the small, normal balloon-shaped particles were observed at lower concentrations (2.5 μM) (Fig. 4B). At 10 μM, balloon-shaped particles were scarce, and
the occurrence of curly structures and the volume of the products of assembly increased (Fig. 4C). When treated with 20 μM, the masses were still observed, and the volume of the products decreased (Fig. 4D). Similar effects were observed by EM for BAY41-4109 treatment (Fig. 4E–H). The results revealed that the compound Z060228 could prevent Cp149 from self-assembling virus particles correctly. 3.5. AFM assessment of the effect of Z060228 on capsids The products of the assembly reactions were also examined using AFM. In the absence of Z060228, Cp149 can self-assemble into a capsid-like virus particle in vitro (Fig. 5A). When treated with 2.5 μM Z060228, tube-shaped and circles particles were formed (Fig. 5B). The
Fig. 4. TEM images of core particles with or without the indicated drugs. Assembly reactions were performed at room temperature with 10 μM Cp149 and different concentrations of Z060228 or BAY41-4109. (A–D) were performed at 0, 2.5 μM, 10 μM and 20 μM Z060228, respectively; (E–H) were performed at 0, 2.5 μM, 10 μM and 20 μM of BAY41-4109, respectively. The bar in the micrograph represents 100 nm.
H. Guan et al. / Life Sciences 133 (2015) 1–7
5
Fig. 5. Z060228 alters Cp149 assembly reactions when performed at room temperature with 10 μM Cp149 and different concentrations of z060228 (A) 0 μM Z060228; (B) 2.5 μM Z060228; (C) 10 μM Z060228; (D) and (E) represent 2D images of (B) and (C), respectively and half-high width measures of the off-line section analysis of Cp149. Scan size, 1 mM × 1 mM.
diameter of the circles was approximately 101 nm, which was similar to that observed by EM (Fig. 5D). When treated with 10 μM Z060228, particle assembly formed a mass-structure, and an increase in the volume of the products was also noted (Fig. 5C). The diameter of these particles was about from 300 nm to 64 nm (Fig. 5E). At 20 μM Z060228, the large structures were disassembled, and various abnormal protein structures and debris were produced. Finally, treatment with the highest concentration of z060228 (40 μM) resulted in a disappearance of the large particles (data not shown). The results of the AFM demonstrate that compound Z060228 can induce the formation of abnormal Cp149 morphology.
Within the core particle, viral DNA is synthesized by HBV polymerase using viral RNA as the template [5]. Therefore, capsid assembly is critical for replication within the HBV life cycle. Due to this critical role, the assembly of the capsid has emerged as a novel target for the development of anti-HBV agents. Derivatives of HAPs were initially identified as highly potent inhibitors of HBV replication in a tissue culture-based screen [18]. Z060228 is a novel non-nucleoside anti-HBV compound that was identified from a series of HAPs. In the present study, we used BAY41-4109 as a control drug to confirm the antiviral effect and mechanism of Z060228.
3.6. Effect of Z060228 on capsids confirmed by HBcAg ELISA The immunogenicity of HBcAg can reflect the proper structure of the capsid assembled when core proteins are properly assembled. To sufficiently evaluate the effects of different concentrations of Z060228 on the Cp149 self-assembly, the immunogenicity of HBcAg was detected using ELISA methods after the Cp149 self-assembly reaction reached equilibrium. The activity of the compound inhibiting the Cp149 assembly (inhibition rate) was calculated. The inhibition rate of Z060228 was significantly higher than that of BAY4109 when the compound concentration was 2.5 μM. Both Z060228 and Bay41-4109 induced the misassembly and led to aberrant structures of the capsid protein (Cp149). The results indicated that Z060228 and BAY41-4109 had similar effects on Cp149 self-assembly, and Z060228 was more effective than BAY41-4109 in vitro (Fig. 6). 4. Discussion The capsid is assembled by the HBV core protein, pgRNA and RT. The pgRNA is encapsidated with the core protein to form a core particle.
Fig. 6. Z060228 and Bay-41-4109 inhibit Cp149 self-assembly as detected by HBcAg ELISA in vitro.
6
H. Guan et al. / Life Sciences 133 (2015) 1–7
The EC50 of Z060228 against HBV (0.28 μM) was lower than that of BAY41-4109 in HepG2.2.15 cells following an 8-day treatment. It is worth noting that the anti-HBV activity of Z060228 was greater than that of BAY41-4109 (Table 1). Immunohistological analyses were performed on the livers of transgenic mice to assess the influence of the treatment on the HBV core antigen. Relative to the vehicle control group, a reduction of HBcAg content was observed in HBV-transgenic mice treated with 30 mg/kg Z060228 (Fig. 2). Based on these results, we can conclude that Z060228 may provide a potential treatment option for chronic HBV. To confirm the mechanism of Z060228 in vitro, several tests were performed. Cp149, the truncated HBV capsid protein that was expressed and purified from E. coli that can self-assemble into a capsid-like virus particle in vitro [17], was incubated with Z060228 overnight, resulting in significant changes in the assembly products. Dimensions of the capsid particle could be observed and measured by AFM. In addition to AFM analyses, we also assessed the effects of Z060228 on Cp149 with TEM and SEC. All the results suggest that Z060228 can alter the equilibrium and change the outcome of HBV Cp149 self-assembly. Due to its objectivity, convenience, and precision, SEC is likely the best screening system for potential anti-HBV compounds that target the capsid assembly. Our present study demonstrates that treatment with Z060228 can result in the misassembly of the HBV capsid and in the formation of non-functional structures, such as hollow tubes or abnormal crinkles. These misassembled structures can accelerate core protein degradation. The results are consistent with a previous report on BAY41-4109 [11]. We confirmed that Z060228 inhibits virus replication by inducing core protein assembly incorrectly. However, the binding site of Z060228 was unclear. Currently, there are three hypotheses regarding the target of HAPs. One hypothesis is that the binding site is near the cluster of histidine residues at the base of the intradimer interface [8]. The second is that an additional HAPs binding site exists at the interdimer interface [17]. The third hypothesis is that the drug binds to a small oligomer of dimers [21]. Our SEC data revealed that exposure to both Z060228 and BAY41-4109 resulted in the decreased dimer content of Cp149 at lower concentrations in a dose-dependent manner. Additionally, the open balloon-shaped particles and abnormal curly masses were observed by TEM and AFM at lower concentrations (≤10 μM). The aberrant structures were induced in a dose-dependent manner at higher concentrations. According to the ELISA results, both Z060228 and BAY41-4109 elicited an inhibitory effect on the preformed capsid. These data indicate that Z060228 binds to the dimer and are consistent with Hacker's hypothesis. In contrast, 3TC treatment resulted in some distinct differences to that of Z060228 and BAY41-4109.Crosslinking studies have suggested that the binding site involves histidine residues that form a cluster at the base of the intradimer interface (spike) [8]. We also made these observations by TEM and AFM, with core proteins forming clusters at lower concentrations. A conformational change at the intradimer interface at the base of the spike could potentially propagate to the major core-specific antigen epitope at the tip of the spike modifying the local conformation enough to alter antibody binding [2]. This scenario is consistent with our reduced ELISA signal at the higher Z060228 concentrations. Stray et al. also reported that at ≤0.5 ratio of BAY41-4109 to the HBV Cp, binding of BAY41-4109 to the HBV Cp dimer had little effect on capsid stability [15]. The capsids that were destabilized demonstrated larger non-capsid ‘void’ oligomers at 1:1 binding of BAY41-4109 to the HBV Cp dimer. In our studies, this value at lower concentrations was consistent for the capsid, but we only identified larger non-capsid ‘void’ oligomers at higher concentrations. When assembly reactions did not reach equilibrium, the resulting products resolved as two separate peaks, described as capsid and ‘void’ (data not shown). As the reaction time increased, the capsid peak changed to that of the ‘void’ peak. In addition to the previous hypotheses stating that HAPs antagonize HBV,
we propose another possible mechanism: HAPs tend to bind to dimers, causing dimer conformational change from an assembly inactive to an assembly active state that form the capsid. Excessive HAPs then bind to the capsids, causing conformation transitions and instability to the deregulating ‘void’. In addition to destroying the construct, these conformational changes may cause RT site exposure, resulting in the inhibition of HBV activity. 5. Conclusions Z060228, a non-nucleoside analog antiviral compound that acts on the HBV capsid, offers a novel anti-HBV therapeutic strategy. Although much pre-clinical work is still needed, characterization of this novel mechanism and the strong, specific anti-HBV activity of Z060228 form the basis for future clinical studies. Conflict of interest statement The authors declare no conflicts of interest.
Acknowledgments We gratefully acknowledge the National Natural Science Foundation of China (Grant Nos. 21172263, 81173081 and 81172923) for financial support. We thank Dr. Li Lin (Institute of Chemistry, Chinese Academy of Sciences) for providing the electron micrographs in Fig. 5 and Professor Ping-kun Zhou (Beijing Institute of Radiation Medicine, Beijing, China) for help with the discussion and for editorial assistance with the paper. We are grateful to Guangzhou Air Force Hospital (Guangzhou, China) for measuring the inhibitory activity of Z060228 against HBV. References [1] D.M. Belnap, N.R. Watts, J.F. Conway, N. Cheng, S.J. Stahl, P.T. Wingfield, A.C. Steven, et al., Diversity of core antigen epitopes of hepatitis B virus, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 10884–10889. [2] B. Bottcher, M. Vogel, M. Ploss, M. Nassal, High plasticity of the hepatitis B virus capsid revealed by conformational stress, J. Mol. Biol. 356 (2006) 812–822. [3] P. Ceres, S.J. Stray, A. Zlotnick, Hepatitis B virus capsid assembly is enhanced by naturally occurring mutation F97 L, J. Virol. 78 (2004) 9538–9543. [4] H. Chen, J.H. Lu, W.Q. Liang, Y.H. Huang, W.J. Zhang, D.B. Zhang, et al., Purification of the recombinant hepatitis B virus core antigen (rHBcAg) produced in the yeast Saccharomyces cerevisiae and comparative observation of its particles by transmission electron microscopy (TEM) and atomic force microscopy (AFM), Micron 35 (2004) 311–318. [5] I.-G. Choi, Y.G. Yu, Interaction and assembly of HBV structural proteins: novel target sites of anti-HBV agents, Infectious Disorders - Drug Targets 7 (2007) 251–256. [6] R.A. Crowther, N.A. Kiselev, B. Bottcher, J.D. Berriman, G.P. Borisova, V. Oe, et al., Three-dimensional structure of hepatitis B virus core particles determined by electron cryomicroscopy, Cell 77 (1994) 943–950. [7] E. De Clercq, Antiviral drugs in current clinical use, J. Clin. Virol. 30 (2004) 115–133. [8] K. Deres, C.H. Schroder, A. Paessens, S. Goldmann, H. Hacker, O. Weber, et al., Inhibition of hepatitis B virus replication by drug-induced depletion of nucleocapsids, Science 299 (2003) 893–896. [9] D. Endres, M. Miyahara, P. Paul Moisant, A. Zlotnick, A reaction landscape identifies the intermediates critical for self-assembly of virus capsids and other polyhedral structures, Protein Sci. 14 (2005) 1518–1525. [10] M.A. Feitelson, M.M. Clayton, B. Sun, R.F. Schinazi, Development of a novel mouse model to evaluate drug candidates against hepatitis B virus, Antivir. Chem. Chemother 18 (2007) 213–223. [11] H. Hacker, K. Deres, M. Mildenberger, C. Schroder, Antivirals interacting with hepatitis B virus core protein and core mutations may misdirect capsid assembly in a similar fashion, Biochem. Pharmacol. 66 (2003) 2273–2279. [12] J.C. Humphries, J.S. Dixon, Antivirals for the treatment of chronic hepatitis B: current and future options, Intervirology 46 (2003) 413–420. [13] R. Loomba, T.J. Liang, Novel approaches to new therapies for hepatitis B virus infection, Antivir. Ther. 11 (2006) 1–15. [14] R.P. Perrillo, Current treatment of chronic hepatitis B: benefits and limitations, Semin. Liver Dis. 25 (Suppl. 1) (2005) 20–28. [15] S.J. Stray, C.R. Bourne, S. Punna, W.G. Lewis, M.G. Finn, A. Zlotnick, A heteroaryldihydropyrimidine activates and can misdirect hepatitis B virus capsid assembly, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 8138–8143. [16] S.J. Stray, A. Zlotnick, BAY41-4109 has multiple effects on hepatitis B virus capsid assembly, J Molecular Recognition 19 (2006) 542–548. [17] I. Takayuki, S. Keishin, A. Satoshi, M. Yoshinobu, M. Hiroshi, M. Tadao, Purification and characterization of the hepatitis B virus core antigen produced in the yeast Saccharomyces cerevisiae, J. Biotech 8 (1988) 149–162.
H. Guan et al. / Life Sciences 133 (2015) 1–7 [18] O. Weber, K.H. Schlemmer, E. Hartmann, I. Hagelschuer, A. Paessens, E. Graef, et al., Inhibition of human hepatitis B virus (HBV) by a novel non-nucleosidic compound in a transgenic mouse model, Antivir. Res. 54 (2002) 69–78. [19] X.Y. Yang, G.Q. Xia, X.K. Wang, Z.B. Zheng, D.M. Zhao, G.M. Zhao, et al., An efficient synthesis of enantiopure (R)-heteroarylpyrimidine analogs, Molecules 18 (2013) 11144–11152.
7
[20] G.M. Zhao, X.K. Wang, X.J. Zhu, H. Guan, W. Zhong, L.L. Wang, et al., Synthesis and anti-HBV activity of novel dihydropyrimidine analogs, Sci. Sin. Vitae 41 (2011) 971–977. [21] A. Zlotnick, P. Ceres, S. Singh, J.M. Johnson, A small molecule inhibits and misdirects assembly of hepatitis B virus capsids, J. Virol. 76 (2002) 4848–4854.