The nucleotide sequence of metallothioneins (MT) in liver of the Kafue lechwe (Kobus leche kafuensis) and their potential as biomarkers of heavy metal pollution of the Kafue River

Gene 506 (2012) 310–316

Contents lists available at SciVerse ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

The nucleotide sequence of metallothioneins (MT) in liver of the Kafue lechwe (Kobus leche kafuensis) and their potential as biomarkers of heavy metal pollution of the Kafue River Ethel M'kandawire a,⁎, Michelo Syakalima a, Kaampwe Muzandu b, Girja Pandey a, Martin Simuunza a, Shouta M.M. Nakayama c, Yusuke K. Kawai c, Yoshinori Ikenaka c, Mayumi Ishizuka c a b c

Department of Disease Control, School of Veterinary Medicine, University of Zambia, P.O. Box 32379, Lusaka, Zambia Department of Biomedical Sciences, School of Veterinary Medicine, University of Zambia, P.O. Box 32379, Lusaka, Zambia Laboratory of Toxicology, Department of Environmental Veterinary Sciences, Graduate School of Veterinary Medicine, Hokkaido University, Kita18, Nishi9, Kita-ku, Sapporo 060 0818, Japan

a r t i c l e

i n f o

Article history: Accepted 3 July 2012 Available online 13 July 2012 Keywords: Kobus leche kafuensis Liver Metallothionein 1 Phylogenetic analysis Heavy metals mRNA expression

a b s t r a c t The study determined heavy metal concentrations and MT1 nucleotide sequence [phylogeny] in liver of the Kafue lechwe. Applicability of MT1 as a biomarker of pollution was assessed. cDNA-encoding sequences for lechwe MT1 were amplified by RT-PCR to characterize the sequence of MT1 which was subjected to BLAST searching at NCBI. Phylogenetic relationships were based on pairwise matrix of sequence divergences calculated by Clustal W. Phylogenetic tree was constructed by NJ method using PHILLIP program. Metals were extracted by acid digestion and concentrations of Cr, Co, Cu, Zn, Cd, Pb, and Ni were determined using an AAS. MT1 mRNA expression levels were measured by quantitative comparative real-time RT-PCR. Lechwe MT1 has a length of 183 bp, which encode for MT1 proteins of 61AA, which include 20 cysteines. Nucleotide sequence of lechwe MT1 showed identity with sheep MT (97%) and cattle MT1E (97%). Phylogenetic tree revealed that lechwe MT1 was clustered with sheep MT and cattle MT1E. Cu and Ni concentrations and MT1 mRNA expression levels of lechwe from Blue Lagoon were significantly higher than those from Lochinvar (pb 0.05). Concentrations of Cd and Cu, Co and Cu, Co and Pb, Ni and Cu, and Ni and Cr were positively correlated. Spearman's rank correlations also showed positive correlations between Cu and Co concentrations and MT mRNA expression. PCA further suggested that MT mRNA expression was related to Zn and Cd concentrations. Hepatic MT1 mRNA expression in lechwe can be used as biomarker of heavy metal pollution. © 2012 Elsevier B.V. All rights reserved.

1. Introduction MTs are considered important biomarkers of heavy metal exposure in many species (Viarengo et al., 1999). Heavy metal cations

Abbreviations: MTs, metallothioneins; MT 1, metallothionein 1; mRNA, messenger ribonucleic acid; GMAs, game management areas; HNO3, nitric acid; Cr, chromium; Co, cobalt; Cu, copper; Zn, zinc; Cd, cadmium; Pb, lead; Ni, nickel; AAS, atomic absorption spectrophotometer; RNA, ribonucleic acid; cDNA, complementary deoxyribonucleic acid; TRI, total RNA isolation; RT, reverse transcription/transcriptase; dNTP, deoxyribonucleotide triphosphate; PCR, polymerase chain reaction; MT 2, metallothionein 2; DEPC, diethylpyrocarbonate; TBE, tris boric acid EDTA; DNA, deoxyribonucleic acid; BLAST, basic local alignment search tool; NCBI, national center for biotechnology information; NJ, neighbor joining; qPCR, quantitative polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PCA, principal component analysis; ORF, open reading frame; MT 1E, metallothionein 1E; AA, amino acids. ⁎ Corresponding author at: University of Zambia, School of Veterinary Medicine, Department of Disease Control, P.O. Box 32379, Lusaka, Zambia. Tel.: + 260 975 496 205; fax: + 260 211 293 727. E-mail addresses: [email protected], [email protected] (E. M'kandawire). 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2012.07.002

which accumulate within cells stimulate MT neosynthesis by enhancing MT gene transcription (Andersen and Werser, 1979). By measuring the MT gene expression levels, it is possible to correlate that to the amount of heavy metal contamination. Unfortunately, the Kafue lechwe is not among the species where MT has been characterized and/or applied as a biomarker of heavy metal pollution. It is also unknown whether the MT in the lechwe has any similarities to the one of the species where it has been applied as a biomarker. The Kafue lechwe is a semi-aquatic antelope naturally found nowhere else in the world other than the Kafue River basin in Zambia (Sheppe, 1985). It occupies an important role in the food chain in that it is consumed by humans, vultures and predators and it is a major source of manure food for fish; the fish in turn are the major food for aquatic birds and humans. It therefore has immense ecological, economical and health impact to the nation and local communities. The Kafue River basin is also a unique ecological site and has received international acclaim and recognition because it is home to a diversity of wildlife, birds and fish species (World Wildlife Fund, 2001). However, it is reported to be polluted by mining activity (Pettersson and Ingri, 2000; Pettersson et al., 2000) and wildlife species such as the Kafue

E. M'kandawire et al. / Gene 506 (2012) 310–316

311

2. Materials and methods

lanthanum chloride (atomic absorption spectrometry-grade, 100 g La/L solution, Wako Pure Chemicals, Osaka, Japan) was added. The volume was then made up to 20 ml with 2 % HNO3. A reagent blank was prepared using the same procedure. We measured the concentrations of 7 elements (Cr, Co, Cu, Zn, Cd, Pb and Ni) in lechwe liver using an atomic absorption spectrophotometer (AAS, Z-2010, Hitachi High-Technologies Corporation, Tokyo, Japan) with either an acetylene flame or argon non-flame, after preparation of the calibration standard. The overall recovery rates (mean ±S.D.) of Cr, Co, Cu, Zn, Cd, Pb and Ni were 91 ± 3.0, 92 ±3.4, 89±5.6, 91 ±2.3, 111±8.3, 90± 3.5, 92 ±4.2%, respectively. The instrument detection limits (IDLs, μg/kg) of Cr, Co, Cu, Zn, Cd, Pb and Ni were 0.5, 0.5, 1.0, 0.1, 0.2, 1.0 and 0.5, respectively. Each metal concentration was converted from mg/kg wet-weight (wt) to mg/kg dry-wt using the water content.

2.1. Animal tissue samples

2.3. RNA isolation and cDNA synthesis

Liver samples from a total of 36 Kafue lechwe were collected in 2009 from Lochinvar (n=22) and Blue Lagoon (n=14) GMAs (Fig. A.1). The samples were collected under the Zambia Wildlife Authority license for disease surveillance. Postmortems were conducted on these “hunter harvested” lechwes as described in literature (Gracey and Collins, 1992). All liver samples were frozen in liquid nitrogen immediately after dissection and then transported to the laboratory for storage at −80 °C.

Total RNA was prepared from each liver sample by the single-step method (Chomczynski and Sacchi, 1987) using TRI reagent (Sigma Chemical Co. St. Louis, MO, USA). RNA concentration and purity levels were determined spectrophotometrically (Nanodrop ND-1000) at 260 and 280 nm (Youdim et al., 2007). The cDNA was synthesized from total RNA by reverse transcription. The reaction mixture was a final volume of 20 μl and consisted of 1 μg total RNA and 0.25 pmol/μl oligo dT (Toyobo, Osaka, Japan) which were incubated at 70 °C for 10 min and then cooled on ice for 1 min. One unit of concentrated RT buffer (Toyobo, Osaka, Japan), 1 mM dNTP mixture (Toyobo, Osaka, Japan), and 1 μl of reverse transcriptase (ReverTra Ace), (Toyobo, Osaka, Japan) were added to the mixture and then incubated at 42 °C for 50 min and at 99 °C for 5 min. PCR was performed on Bio-Rad iCycler™ Thermal Cycler. The forward and reverse primers (Sigma Genosys, Hokkaido, Japan) 11 selected to amplify 183 bp fragments lechwe MT1 cDNAs were

lechwe which is indigenous to the Kafue River basin have been reported to be exposed to heavy metal pollutants that have a potential of accumulating thus causing adverse effects (Syakalima et al., 2001a, 2001b). The Kafue lechwe as a semi aquatic animal thus represents a better convergence indicator species of water and land pollution. Using it to measure heavy metal pollution would be ideal to add to the existing literature. In this study, we analyzed metal levels and MT1 mRNA expressions in the liver of Kafue lechwe from Lochinvar and Blue Lagoon GMAs and evaluated regional differences of these levels. The study also characterized MT1 in this species. The molecular phylogeny of Kafue lechwe MT1 was also determined in order to relate the MT to known species where it is applied as a biomarker.

2.2. Metal extraction and analysis Metals in the Kafue lechwe liver samples were extracted by acid digestion using a method by Nakayama et al. (2011). Briefly, 1 g of fresh tissue was placed in a 200 ml flask and 20 ml of spectrometry-grade HNO3 (Kanto Chemical, Tokyo, Japan) was added. The samples were gradually heated up to 225 °C on a hotplate, and left for 12 h to evaporate to approximately 5 ml. When the samples became clear liquid, 0.2 ml of

N

Kafue River Zambezi River

Luangwa River

S13 S14 S15

E23

E24

E25

E26

E27

E28

E29

E30

E31

E32

E33

Fig. A.1. Maps showing the location of the Kafue River and Lochinvar and Blue Lagoon National Parks.

312

E. M'kandawire et al. / Gene 506 (2012) 310–316

5′-atggacccgaactgctcctgc-3′ and Reverse: 5′-ggcgcagcagctgcacttgtccg-3′. The primers were designed using the Y-MT-SP primers by changing s to g and r to g according to the sequence result of lechwe MT1 obtained. The cDNAs were also amplified with GAPDH (accession number type BC102589) (Pfister-Genskow et al., 2005) as a housekeeping gene. The GAPDH primers (Sigma Genosys, Hokkaido, Japan) used were Forward: 5′-ggcgtgaaccacgagaagtataa-3′ and Reverse: 5′-ccctccacgatgccaaact-3′. Conditions for quantitative real-time (RT)-PCR were as follows: holding stage at 95 °C for 15 s, cycling stage (35 cycles) at 95 °C for 15 s and 62 °C for 1 min, melt curve stage at 95 °C for 15 s, 60 °C for 1 min and then increased by 0.3 °C until 95 °C and 95 °C for 15 s. A single band of 183 bp and 120 bp for MT 1 and GAPDH respectively was separated by electrophoresis on 1.5% agarose gel stained with ethidium bromide (0.25 μg/ml) in TBE buffer. Amplification efficiency (E) and slope value of real-time PCR for each gene were analyzed by making calibration curves of dilution series of cDNA. The following formula was used for the calculation of amplification efficiency, E = 10(−1/slope) −1. In the current study, slope and E values of MT 1 gene were −3.4947 and 0.933, respectively. For GAPDH gene, slope and E value were −3.6995 and 0.863, respectively.

Y-MT-SP1:5′-atggacccgaactsctcctgc-3′ s = c,g and Y-MT-SP2:5′-ggc rcagcagctgcacttgtccg-3′ r=a,g. The primers were designed based on the coding region sequences of MT1 and MT2 in the cow (Bos taurus), sheep (Ovis aries), mouse (Mus musculus), rabbit (Oryctolagus cuniculus), and pig (Sus scrofa) (Wu et al., 2007). The PCR reaction was prepared in a total volume of 20 μl consisting of 0.5 μM of each primer (Sigma Genosys, Hokkaido, Japan), 13.3 μl of DEPC water (Sigma-Aldrich Co, St. Louis, MO, USA), 0.2 mM dNTP mixture (Takara Bio. Inc., Otsu, Japan), 1 unit Ex taq buffer (Takara Bio. Inc., Otsu, Japan), 0.1 μl of Ex taq (Takara Bio. Inc., Otsu, Japan) and 1.0 μl of 25-fold cDNA. Thermal cycler conditions for the PCR reaction were as follows: 94 °C for 1 min, 40 cycles of 94 °C for 30 s, 54.6 °C to 61 °C for 30 s and 72 °C for 1 min, and final extension period of 72 °C for 5 min. Gradient annealing temperatures were used to determine the optimal annealing temperature. A single band of 183 bp was separated by electrophoresis on 1.5% agarose gel stained with ethidium bromide (0.25 μg/ml) in TBE buffer and the PCR products with the brightest bands for each locus were chosen for direct sequencing. 2.4. Direct sequencing of PCR products The sequencing reaction was performed using the PCR products (60 to 100ng/μl) and Big Dye Terminator kit according to the manufacturer's instructions (Applied Biosystems, CA, USA) at 96 °C for 15 s, and 40 cycles of 96 °C for 20 s, 55 °C for 15 s, and 60 °C for 4 min. Ethanol precipitation was performed after the amplification, and the nucleotide sequence was analyzed using the automated DNA sequencer (ABI Prism 310 genetic analyzer, Applied Biosystems, CA, USA). Sequence identities were then confirmed by BLAST search against the NCBI sequence database.

2.7. Statistics Statistical analyses were performed using JMP 9 (SAS Institute, Cary, NC, USA). Data were normalized by base 10 logarithm transformations. Regional differences in MT mRNA expressions and metal accumulations were analyzed by Student's t test (p b 0.05). Since there was no sex difference in MT mRNA expressions and metal concentrations from each sampling site, the samples were treated as the same group for each sampling site. Spearman's rank correlation test was performed to reveal the relationships between MT mRNA expressions and metal levels in lechwe liver. PCA was performed on the basis of normalized values of each metal.

2.5. Phylogenetic relationships The phylogenetic relationships were estimated based on the pairwise matrix of sequence divergences calculated by Clustal W (Thompson et al., 1994). Phylogenetic trees for nucleotide sequences were constructed by the NJ method (Kimura's 2-parameter model, (Kimura, 1980)) using the PHILLIP program based on the MT fragments of the seven mammalian species. Nucleotide sequences with the following GenBank accession numbers were used in the phylogenetic analysis: O. aries (sheep) X00953, B. taurus (cattle) NM_001040492, S. scrofa (pig) NM_001001266, S. scrofa (boar) AB000790, Bos grunniens (yak) AY513744, Homo sapiens (human) NM_005954 and Balaena mysticetus (whale) AF022117. The sequences were retrieved from the GenBank database. Bootstrap values were tested with 1000 replications for the NJ trees. Comparison of amino acids sequence among several animal species was performed by Clustal W (Thompson et al., 1994).

3. Results 3.1. Metal concentrations in the liver of Kafue lechwe Mean, range and median concentrations of Cr, Co, Cu, Zn, Cd, Pb and Ni in the liver of 36 Kafue lechwe from Lochinvar and Blue Lagoon GMAs were determined as shown in Table A.1. Concentrations of Cu and Ni in lechwe from Blue Lagoon were significantly higher compared with those from Lochinvar (Student's t test, pb 0.05). 3.2. Characterization of MT1 in Kafue lechwe

2.6. Quantification of MT 1 mRNAs

Amplification of MT1 from cDNA fragments of Kafue lechwe liver was achieved and the partial nucleotide sequence (183 bp) of lechwe MT1 was obtained, as indicated in Fig. A.2. The accession number for lechwe MT1 after deposition in GenBank was AB720873. The nucleotide sequences were translated into proteins containing 61 amino acids, which include 20 cysteines. The tripeptides highly conserved across species were as follows: MDPN CXC—CXC—CXC—CXC—C—CCXCC—CXXC— CXC—CXCC—, where X designates amino acid of the MT1 excluding cysteines (Fig. A.2).

Messenger RNA expression levels of MT 1 were measured by quantitative comparative (relative) real-time (RT)-PCR using 2 μl of 25 fold cDNA and DyNamo™ HS SYBR Green qPCR Kit according to the manufacturer's instructions (Finnzymes, Espoo, Finland). A Step one plus real-time PCR system (Applied Biosystems, Japan) was used for PCR amplification and data analysis (step one software version 2.0). The MT1 primers (Sigma Genosys, Hokkaido, Japan) used were Forward:

Table A.1 Mean, range and median concentrations of metals in lechwe from Blue Lagoon and Lochinvar (mg/kg dry-wt).

Blue Lagoon (N = 14) Lochinvar (N = 22)

Range Median Average Range Median Average

Cu

Zn

Cd

Pb

Co

Cr

Ni

6–169 32 51 1–55 6 16

67–227 127 135 78–153 100 109

0.006–0.042 0.01 0.02 0.005–0.03 0.01 0.01

0.05–0.4 0.1 0.1 0.01–1 0.1 0.2

0.3–1 0.5 0.6 0.2–1 0.4 1

0.2–11 0.6 1.4 0.2–3 1 1

0.3–5 0.8 1.3 0.1–2 0.3 1

E. M'kandawire et al. / Gene 506 (2012) 310–316

313

Kafue lechwe MT 1 ATGGACCCGAACTGCTCCTGCCCCGCTGGCGGCTCCTGCAGCTGCGCTGGTTCCTGCACC TGCAAGGCCTGCAGATGCCCCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGTGGG CTGTGCCAAGTGTGCCCAGGGCTGTGTCTGCAAAGGAGCCTCGGACAAGTGCAGCTGCT GCGCC 1

61

Fig. A.2. Partial nucleotide sequences of Kafue lechwe MT 1.

(Fig. A.5). PCA results also suggested that MT mRNA expression could relate to Zn and Cd concentrations (Fig. A.5).

3.3. Phylogenetic relationships of Kafue lechwe MT1 The homology of the isolated lechwe MT1 with MTs of other mammals calculated by Clustal W revealed that lechwe MT1 showed higher identities with that of sheep _ORF (97%) and cattle _ORF (97%) followed by yak _ORF (95%), boar _ORF and pig _ORF (91%) and whale _ORF (84%) (Table A.2). Phylogenetic analysis of mammalian MT generated a rooted tree and revealed that Kafue lechwe MT1 was clustered together with sheep MT and cattle MT 1E (Fig. A.3). 3.4. Quantities of Kafue lechwe MT1 mRNA in Lochinvar and Blue Lagoon GMAs MT1 mRNA was expressed in all liver samples of Kafue lechwe from both Lochinvar and Blue Lagoon GMAs (data not shown) and the mean and standard error about the mean of the expression levels was 13.09±4.41 and 25.00±7.48 for Lochinvar GMA and Blue Lagoon GMA respectively. Data were normalized by base 10 logarithm transformations. Lechwe from Blue Lagoon showed significantly higher expression levels of MT1 mRNA compared to those from Lochinvar (Student's t test, pb 0.05) (Fig. A.4). 3.5. Correlations between metals and between MT 1 mRNA expression and metal levels in liver of Kafue lechwe According to Spearman's rank correlation test, the significant positive correlations of metals are summarized in Table A.3. Correlations between Cu, Co concentrations and MT mRNA expression were found. Results of PCA supported the positive correlations between MT mRNA expression and concentrations of Cu and Co in Spearman's rank correlation test

Table A.2 Nucleotide identities of the MT 1 for lechwe, cattle, yak, boar, pig and whale.

Sheep Cattle Yak Boar Pig Whale

Cattle

Yak

Boar

Pig

Whale

Lechwe

98

96 96

92 92 92

92 92 93 97

84 84 84 87 97

97 97 95 91 91 84

4. Discussion Results of sequencing showed that the amplified fragment was an open reading frame of cDNA-encoding MT1 of Kafue lechwe with a length of 183 bp (AB720873). Although this is not a full length sequence, to our knowledge this is the first information on the cDNA sequences of MT1 in liver of Kafue lechwe. Metallothioneins have been cloned in other mammals, namely, mouse (M. musculus) MT1 (NM_013602) and MT2 (NM_008630), sheep (O. aries) MT1 (X04626) and MT2 (X07975), and rabbit (O. cuniculus) MT1 (X07790) and MT2 (X07791). Kafue lechwe cDNA nucleotide sequences were translated into proteins containing 61 AA, which include 20 cysteines. Previous studies have reported that mouse (Beach and Palmiter, 1981; Durnam et al., 1980; Searle et al., 1984; Stallings et al., 1984), sheep (Peterson and Mercer, 1986; Peterson et al., 1988), rabbit (Tam et al., 1988) and yak (Wu et al., 2007) have MT proteins with 61 AA containing 20 cysteines. Comparisons of AA sequences of MT1 in Kafue lechwe with conserved sequences in the cattle, sheep, yak and pig showed many conserved tripeptides, such as C– X–C, C–C–X–C–C, and C–X–X–C, which are highly conserved in their evolution and derivation. By studying the homology of the isolated lechwe MT1 with MTs of other mammals, lechwe MT1 showed higher similarities with MT of sheep (97%) and MT1E of cattle (97%). MT1 is ubiquitously expressed in all mammalian tissues (Aschner, 1996). This was in agreement with the phylogenetic analysis of the nucleotide sequences which confirmed the lechwe MT1 gene to be part of the MT1 subfamilies and revealed that Kafue lechwe MT1 was clustered with that of sheep MT and cattle MT1E. These results therefore suggest that lechwe, sheep and cattle MT1 genes could have evolved from a common ancestor and that the lechwe MT1 gene is closely related to MT of ruminant artiodactyls. Therefore, possibilities exist for similar metabolism of heavy metals and tolerance to heavy metals in these animals. Levels of Cu and Zn in this study were high. This was in agreement with studies by Syakalima et al. (2001a, 2001b) where levels of Cu, Co, Zn and Pb in water, fish, grass and Kafue lechwe liver from the Kafue Flats were reported to vary from trace to above normal. In cattle the upper limit for Cu accumulation in the liver tissue for chronic toxicity to be observed was found to be 560 mg/kg (Humphreys, 1988). Levels above the upper limit mentioned above have been

314

E. M'kandawire et al. / Gene 506 (2012) 310–316

Fig. A.3. Phylogenetic analysis of the mammalian MT 1 based on the multiple alignments of the deduced nucleotide sequences retrieved from the GenBank database using the following accession numbers: Ovis aries (sheep) X00953, Bos taurus (cattle) NM_001040492, Sus scrofa (pig) NM_001001266, Sus scrofa (boar) AB000790, Bos grunniens (yak) AY513744, Homo sapiens (human) NM_005954 and Balaena mysticetus (whale) AF022117. A number at each branch and the length of the stem indicate bootstrap value based on 1000 samplings. Human MT 3 was used as an out-group species.

implicated in a number of pathological conditions such as a hemolytic crisis in animals and man. Subacute Cu toxicity has also been observed in sheep at ranges between 107 and 691 mg/kg liver dry weight (Humphreys, 1988). The levels of up to 169 mg/kg Cu dry weight in liver tissue observed in lechwe during this study are within this range and if lechwes are as susceptible as sheep then it is likely that subacute toxicity exists. In cattle Zn toxicity was observed after metal concentration in the liver exceeded 34.2 mg/kg dry weight (Humphreys, 1988). In this study concentrations were much higher than the figure of up to 227 mg/kg. It is likely that these levels can cause toxicity as observed in cattle since possibilities could exist for similar metabolism of heavy metals and tolerance to heavy metals. Concentrations of Cu and Ni in lechwe from Blue Lagoon were significantly higher compared with those from Lochinvar (p b 0.05). Interestingly, in addition to Cu and Ni concentrations, lechwe from Blue Lagoon showed significantly higher expression levels of MT1 mRNA compared to those from Lochinvar.

ΔCt of mRNA expression

*

There were significant positive correlations between metals. Between essential metals, positive correlations were recorded between Co–Cu and Ni–Cu. Positive correlations were also recorded between toxic and essential metals. This was between Cd–Cu, Pb–Co and Cr–Ni. This agrees with an earlier study in Spain where Pb and Cu in the liver positively correlated (Blanco-Penedo et al., 2006). Although mechanisms of these interactions are not clearly defined, interactions between toxic and essential metals may disrupt the metabolism of essential metals (Quig, 1998). The positive correlation between toxic and essential metals observed in this study suggests that there is disruption in the metabolism of essential metals in Kafue lechwe making the animals prone to essential metal deficiencies. Hg and Cd readily displace zinc and copper from metallothionein, which serves as the intracellular “sink” for these essential elements. Copper and zinc are co-factors for superoxide dismutase, and copper is required for the synthesis of catecholamines. Zinc is also critical for wound healing, immune function and the metabolism of protein and nucleic acids. Possible toxicities resulting from toxic metal accumulation may be manifested in the impairment of physiological functions such as respiratory osmoregulation and energy metabolism or may appear as decreased reproductive efficiency, increased susceptibility to disease or predation and/or a decreased adaptability to the environment, anemia, eventual development of cancerous tissue growth (particularly in fish), neurological damage, and birth defects in offspring. The most obvious effect of environmental pollution on animals is death that occurs immediately after exposure to high concentrations of toxic components. Interestingly, there were positive correlations between metals and metallothioneins. Spearman's rank correlation test showed significant Table A.3 Relationship between MT mRNA expression and metal levels in liver of Kafue lechwe.

Blue Lagoon

Lochnivar

Fig. A.4. Regional difference of MT-1 mRNA expressions in lechwe. * indicates significant difference (Student's t test, p b 0.05). ΔCt indicates the difference of mRNA expression levels between MT-1 and GAPDH.

Pair

Spearman ρ

p Value

Cd–Cu Co–Cu Co–Pb Cr–Pb Ni–Cu Ni–Cr Cu–MT Co–MT

0.343 0.340 0.449 0.361 0.369 0.610 0.394 0.404

0.043 0.046 0.007 0.033 0.029 b0.0001 0.019 0.016

E. M'kandawire et al. / Gene 506 (2012) 310–316

315

Fig. A.5. PCA relationship between MT mRNA expression and metal levels in liver of Kafue lechwe.

positive correlations between Cu, Co concentrations and MT mRNA expression. According to Altman (1991), Spearman's rank correlation test is used as a measure of linear relationship between two sets of ranked data, that is, it measures how tightly the ranked data clusters around a straight line. A positive correlation is one in which the ranks of both variables increase together. A negative correlation is one in which the ranks of one variable increase as the ranks of the other variable decrease. Therefore in our study, the increase in the level of Cu and Co would suggest an increase in MT synthesis. Results of PCA supported the positive correlations between MT mRNA expression and concentrations of Cu and Co and also showed significant positive correlation between MT mRNA expression and Zn and Cd concentrations. Therefore, PCA results suggested that MT mRNA expression could relate to Zn and Cd concentrations. This has been demonstrated in earlier studies that MTs can be induced by Cd in the liver and kidneys of exposed animals and MTs can also bind Zn (Wentink et al., 1988). Positive correlations could be attributed to the fact that metals in the following order Cu>Cd >Zn induce MT synthesis (Eaton and Toal, 1982). 5. Conclusion The molecular phylogeny of MT1 in liver of Kafue lechwe related to the MT in sheep and cattle where heavy metal toxicities such as copper toxicity have been reported. Therefore, possibilities exist for similar metabolism of heavy metals and tolerance to heavy metals in these animals especially that the levels of Cu and Zn in this study were high. The interactions between toxic and essential metals observed in this study show that there could be a disruption in the metabolism of essential metals in Kafue lechwe thus making the animals prone to mineral deficiencies and possible toxicities resulting from toxic metals. Positive correlations between metals and MT 1 imply that MT mRNA expression in Kafue lechwe has the potential to be used as a biomarker of environmental pollution by heavy metals, especially for Cu, Co, Zn and Cd in the Kafue River. Acknowledgments This study was supported by Ministry of Science, Technology and Vocational Training, Government of the Republic of Zambia, University of Zambia and in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan awarded to M. Ishizuka (No. 19671001) and Y. Ikenaka (No. 23710038) and foundations of JSPS AA Science Platform Program, Sumitomo, Heiwa Nakajima, and Mitsui & Co., Ltd. One of the authors (Shouta M.M.

Nakayama) is a Research Fellow of the Japan Society for the Promotion of Science (No. 2200517701). We thank Zambia Wildlife Authority for their cooperation and assistance. We are grateful to the members of staff at University of Zambia and Hokkaido University who participated in fieldwork and laboratory work.

References Altman, D.G., 1991. Practical Statistics for Medical Research. Chapman & Hall, London, pp. 285–288. Andersen, D., Werser, U., 1979. Partial purification and translation in vitro of metallothionein messenger RNA. Experientia 34, 303–310. Aschner, M., 1996. The functional significance of brain metallothioneins. FASEB J. 10, 1129–1136. Beach, L.R., Palmiter, R.D., 1981. Amplification of the metallothionein-I gene in cadmium-resistant mouse cells. Proc. Natl. Acad. Sci. U. S. A. 78, 2110–2114. Blanco-Penedo, I., et al., 2006. Influence of copper status on the accumulation of toxic and essential metals in cattle. Environ. Int. 32, 901–906. Chomczynski, P., Sacchi, N., 1987. Single-step method of isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Durnam, D.M., Perrin, F., Gannon, F., Palmiter, R.D., 1980. Isolation and characterization of the mouse metallothionein-I gene. Proc. Natl. Acad. Sci. U. S. A. 77, 6511–6515. Eaton, D.L., Toal, B.F., 1982. Evaluation of cadmium/hemoglobin affinity assay for rapid determination of metallothionein in biological tissues. Toxicol. Appl. Pharmacol. 66, 134–142. Gracey, J.F., Collins, D.S., 1992. Meat Hygiene, ninth ed. Ballière Tindall, London, pp. 307–351. Humphreys, D.J., 1988. Veterinary Toxicology, third ed. Ballière Tindall, London, pp. 15–19. Kimura, M., 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Nakayama, M.M.S., et al., 2011. Heavy metal accumulation in lake sediments, fish (Oreochromis niloticus and Serranochromis thumbergi) and crayfish (Cherax quadricarinatus) in Lake Itezhi-tezhi and Lake Kariba Zambia. Arch. Environ. Contam. Toxicol. 59 (2), 291–300. Peterson, M.G., Mercer, J.F., 1986. Structure and regulation of the sheep metallothionein-1A gene. Eur. J. Biochem. 160, 579–585. Peterson, M.G., Hannan, F., Mercer, J.F., 1988. The sheep metallothionein gene family: structure, sequence and evolutionary relationship of five linked genes. Eur. J. Biochem. 174, 417–424. Pettersson, U.T., Ingri, J., 2000. The geochemistry of Co and Cu in the Kafue River as it drains the Copperbelt mining area, Zambia. Chem. Geol. 177, 399–414. Pettersson, U.T., Ingri, J., Andersson, P.S., 2000. Hydrogeochemical processes in the Kafue River upstream from the Copperbelt mining area, Zambia. Aquat. Geochem. 6, 385–411. Pfister-Genskow, M., et al., 2005. Identification of differentially expressed genes in individual bovine preimplantation embryos produced by nuclear transfer: improper reprogramming of genes required for development. Biol. Reprod. 72, 546–555. Quig, D., 1998. Cysteine metabolism and metal toxicity. Altern. Med. Rev. 3 (4), 262–270. Searle, P.F., Davison, B.L., Stuart, G.W., Wilkie, T.M., Norstedt, G., Palmiter, R.D., 1984. Regulation, linkage, and sequence of mouse metallothionein 1 and 2 genes. J. Mol. Cell. Biol. 4, 1221–1230. Sheppe, W.A., 1985. Effects of human activities on Zambia's Kafue flats ecosystem. Environ. Conserv. 12, 49–57. Stallings, R.L., Munk, A.C., Longmire, J.L., Hildebrand, C.E., Crawford, B.D., 1984. Assignment of genes encoding metallothioneins 1 and 2 to Chinese hamster chromosome 3: evidence for the role of chromosome rearrangement in gene amplification. J. Mol. Cell. Biol. 4, 2932–2936.

316

E. M'kandawire et al. / Gene 506 (2012) 310–316

Syakalima, M.S., et al., 2001a. Bioaccumulation of lead in wildlife dependent on the contaminated environment of the Kafue flats. Bull. Environ. Contam. Toxicol. 67, 438–445. Syakalima, M.S., et al., 2001b. An investigation of heavy metal exposure and risks to wildlife in the Kafue Flats of Zambia. JVMS 63, 315–318. Tam, Y.C., Chopra, A., Hassan, M., Thirion, J.P., 1988. Cloning, nucleotide sequence and characterization of a New Zealand rabbit metallothionein-I gene. J. Biochem. Biophys. Res. Commun. 153, 209–216. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionsspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Viarengo, A., Burlando, B., Donderp, F., Marro, A., Fabrri, R., 1999. Metallothionein as a tool in biomonitoring programmes. Biomarkers 4, 455–466.

Wentink, G.H., Wensing, T., Baars, A.J., Van Beek, H., Zeeuwen, A.A.P.A., Schotman, A.J.H., 1988. Effects of cadmium on some clinical and biochemical measurements in heifers. Bull. Environ. Contam. Toxicol. 40, 131–138. World Wildlife Fund, . Investing in the Kafue flats wetlands to ensure clean water and wildlife for later years, http://www.partnersforwetlands.org/report/report-zambia (Accessed 2001). Wu, J.P., Ma, B.Y., Ren, H.W., Zhang, L.P., Xiang, Y., Brown, M.A., 2007. Characterization of metallothioneins (MT-1 and MT-2) in the yak. J. Anim. Sci. 85, 1357–1362. Youdim, K.A., Tyman, C.A., Jones, B.C., Hyland, R., 2007. Induction of cytochrome P450: assessment in an immortalized human hepatocyte cell line (Fa2N4) using a novel higher throughput cocktail assay. Drug Metab. Dispos. 35, 275–282.