- Email: [email protected]
The nucleotide sequences of human GnRH receptors in breast and ovarian tumors are identical with that found in pituitary
ELSEVIER
Molecular and Cellular Endocrinology 106 (1994) 145-149
The nucleotide sequences of human GnRH receptors in breast and ovarian tumors are identical with that found in pituita~ Sham S. Kakara, William E. Grizzleb, Jimmy D. NeilI”** aDepartmen? of Physiology and Biophysics and bDepartment
ofPathology, University of Alabama a? Birmingham, Birmingham, AL 35294, USA
Received 22 August 1994; accepted I7 September 1994
Abstract inhibition of the growth of hormone related human tumor cells in vitro by GnRH agonists and antagonists suggests a direct effect on cell growth and proliferation, and this effect may be achieved through its receptors present in tumor cells. However, the nature of the GnRH receptors present in these tumors is controversiah To determine the molecular characteristics of GnRH receptors in such tumors, we used the reverse transc~ptas~~lymerase chain reaction (RT/PCR) technique to clone these receptors. Primers were selected from the human pituitary GnRH receptor cDNA sequence to amplify the open reading frame and parts of its 5’ and 3’-untranslated sequences. Nucleotide sequencing of the GnRH receptor cDNAs from a breast tumor cell line (MCF-7) and from an ovarian tumor showed identity with that of the human pituitary GnRH receptor which binds GnRH with high afftnity. GnRH receptor mRNA was found to be expressed in human pituitary, breast, breast tumor, ovary, ovarian tumor, prostate, prostate tumor and in breast tumor cell lines (MCF-7 and MDA-Mu 468) and prostate tumor cell lines (PC-3 and LNCaP). These findings demonstrate that a mRNA representing the pituitary form of the GnRH receptor (which shows high affinity binding with GnRH) is also expressed in certain normal tissues and in hormone related human tumors and tumor cell lines derived from them. Keywords:
Gonadotropin releasing hormone receptor; Molecular cloning; Breast tumor; Ovarian tumor; Prostate tumor
1. Introduction The gonadotropin releasing hormone (GnRH) receptor of the rat as measured by radioreceptor assay has high GnRH binding affinity (low nanomolar range) and is expressed primarily in the anterior pituitary gland (Clayton and Catt, 1981). However, a similar high affinity receptor is also expressed in the ovary, testis, adrenal, and mammary gland (see Klijn and Foekens, 1989). The recent molecular cloning, nucleotide sequencing, and heterologous expression of cDNAs representing the rat pituitary GnRH receptor have confirmed this high af~nity and this tissue distribution ( Kaiser et al., 1992; Perrin et al., 1993; Kakar et al., 1994). Moreover, the nucleotide sequences of ovarian and testicular GnRH-receptor cDNAs have just been reported to be identical with that of the pituitary gland (Moumni et al., 1994).
* Corresponding author. Tel. (205) 934 2499. Fax (205) 934 1445. Email: [email protected].
The human anterior pituitary gland expresses a GnRH receptor clearly having the same high affinity binding characteristics as reported for the rat (Wormald et al., 1985). Indeed, a cDNA representing the human pituitary GnRH receptor has been cloned and sequenced and, after heterologous expression, showed a high binding affinity (Kd -5 nM) (Kakar et al., 1992a). The question of GnRH receptor expression in ex~a-pitui~ry tissues, however, has remained unresolved. Most investigators have reported binding affinities that are 10-10 000-fold lower than that of the pituitary using radioreceptor assays on human ovaries and ovarian tumors, adrenals, placenta, breast cancers and breast cancer cell lines, and prostate tumor cell lines (see Eidne et al., 1985, 1987; Bramley et al., 1986, 1992; Emons et al., 1989; Klijn and Foekens, 1989; Qayum et al., 1990; Vincze et al., 1991). In contrast, there arc reports that no GnRH binding occurs in human gonadal tissues (Clayton and Huhtaniemi, 1982) or in human breast tissues and breast tumor cell lines (Mullen et al., 1992). On the other hand, Schally and his collaborators have reported binding affinities for human breast tumors and tumor cell
0303-7207/94/$07.00 0 1994Elsevier Science Ireland Ltd. All rights reserved SSDf 0303-7207(94)03407-K
146
S.S. Kahr
et al. I Molecular and Cellular Endocrinology 106 (1994) 145-149
lines (Fekete et al., 1989a,c; Segal-Abramson et al., 1992), prostate tumors (Fekete et al., 1989b), endometrial cancer cell lines (Emons et al., 1993b), and ovarian cancer cell lines (Emons et al., 1993a; Yano et al., 1994) that equal those found in human pituitary tissue (Wormald et al., 1985). Answering the question of extra-pituitary expression of GnRH receptors in humans is not only of academic interest but is also related to the numerous reports that GnRH agonists and antagonists act directly on breast, ovarian, endometrial, and prostate tumor cell lines to inhibit their growth (Miller et al., 1985; Eidne et al., 1987; Limonta et al., 1992, 1993; Segal-Abramson et al., 1992; Emons et al., 1993a,b; Yano et al., 1994). Thus, in the present studies, we have undertaken the molecular cloning and nucleotide sequencing of cDNAs representing the GnRH receptor from a breast tumor cell line and an ovarian tumor. Also, we have used the reverse transcriptase/polymerase chain reaction (RT/PCR) technique to investigate the expression of GnRH receptor mRNA in several other human tissues and tumor cell lines. 2. Materials and methods 2.1. Tissue and cell lines Various human tissues were obtained from The Tissue Procurement Facility, Comprehensive Cancer Center, University of Alabama at Birmingham. These tissues were collected at the time of autopsy (3-12 h after death) or biopsy, and were immediately frozen in liquid nitrogen and then stored at -70°C until RNA isolation. An ovarian tumor sample was collected from a 51-year-old Caucasian female by biopsy and stored in liquid nitrogen. Pathological analysis of the sample showed it to be composed of malignant cells and desmoplastic fibrous tissue which was primarily acellular; normal ovarian tissue was not identified. The breast tumor cell line (MCF-7) and prostate tumor cell lines (PC-3 and LNCaP) were obtained from the American Type Culture Collection (ATCC). Another breast tumor cell line (MDA-MB 468) was obtained from Dr. Jeffrey E. Kudlow, University of Alabama at Birmingham. The cell lines were cultured and maintained according to the recommendations of ATCC. 2.2. RNA isolation Total RNA from tissues and cell lines was prepared using the Ultraspec RNA Isolation System from Biotecx (Kakar et al., 1994). 2.3. Cloning of the GnRH receptor To clone GnRH receptors from breast and ovarian tumors, we used the reverse transcriptase/polymerase chain reaction (RT/PCR) technique. Oligonucleotide primers [sense 5’-AGCTGAATTCGCTTGAAGCTCTGTCCTGGGA-3’ (nt -25 to -5) and antisense 5’-CTACGA-
A’ITCGAGGCTCTGAAGACTGAGTT-3’ (nt 1126 to 1145)] were selected, respectively, from the 5’ and 3’ nontranslated regions of the human pituitary GnRH receptor cDNA sequence (Fig. 1) (Kakar et al., 1992a). The primer sequences contained an EcoRI restriction enzyme sequence at their 5’ ends. RNA samples from the MCF-7 cells and the ovarian tumor were subjected to first strand cDNA synthesis using an oligo(dT) primer and AMV reverse transcriptase @omega). The first strand cDNAs were then used in PCR. The PCR reaction conditions were 1.5 min at 95”C, 1.5 min at 52°C and 4 min at 72°C for 30 cycles in a Perkin-Elmer Cetus thermal cycler. The reaction mixtures were then electrophoresed through a 1.0% agarose gel and stained with ethidium bromide. The cDNAs were eluted from the gel and subcloned into the AZAPII vector at its EcoRI site. Recombinant clones were screened using 32Plabeled human GnRH receptor cDNA (comprised of its open reading frame) as a probe according to the procedure described previously (Kakar et al., 1992a). A large number of positive clones were obtained. Several of the positive clones were purified to homogeneity. Three clones from MCF-7 cells and two clones from the ovarian tumor were completely sequenced (Kakar et al., 1992b). Sequence comparisons were performed using the Wisconsin GCG program on a VAX computer. 2.4. GnRH receptor expression in tissues, tumors, and cell lines Total RNA from tissues and cell lines was prepared as described above. Two micrograms of total RNA from various tissues, tumors, and cell lines were used to synthesize first strand cDNA in a 20~1 reaction volume as described above. A 5.0~,ul aliquot of these solutions was then used in the PCR as described above. The primers used were sense 5’-GCTTGAAGCTCTGTCCTGGGA-3’ (-25 to -5) and antisense 5’-CCTAGGACATAGTAGGG-3’ (844-860) (Fig. 1). Twenty microliters of the lOO@ reaction mixture from each sample was then electrophoresed through a 1.O% agarose gel and stained with ethidium bromide. The identity of the DNA generated by PCR was confirmed by Southern blot analysis using 32P-labeled GnRH receptor cDNA as a probe (Fig. 1). To rule out contamination of the RNA samples with genomic DNA, we subjected RNA from each sample directly to PCR, omitting the reverse transcriptase step. 3. Results The nucleotide sequence and corresponding predicted amino acid sequence of the GnRH receptor cDNA from MCF-7 cells and the ovarian tumor are shown in Fig. 1. The cDNA is composed of 1170 nucleotides and encodes a 328 amino acid protein. The nucleotide sequences of all three clones from MCF-7 cells and the two clones from the ovarian tumor were identical with each other and with the human pituitary GnRH receptor cDNA sequence (Kakar et
S.S. Kukar et al. I Molecular and Cellular Endocrinology 106 (1994) 145-149
147
-1 ATGGCAAACAGTGCCTCTCCTGM~GMTCACTC MANSASPEQNQNHC
60 SAINNS
ATCCCACTGATGCAGGOCMCCTCCCCACTCTCTGACCTTGTCTGGAAAOATCCGAGTGACG PTLTLSGKIRVT IPLMQGNL I GTTACTTTCTTCCTTTTTCTGCTCTCTGCOACCTTTTMTGCTTCTTTCTTGTTG~CTT VTFFLFLLSATFNASFLLKL
120
CAGAAGTGGACACAGMGAAAGAGAGWGGGUGCTCTCMGMTGMGCTGCTCTTA QKWTQKKEKGKKLSRMKLLL ._ ._ II AAACATCTGACCTTAGCCMCCTGTTGGAGACTCTGATTGTCATGCCACTGGATGOGATG KHLTLANLLETLIVMPLDGM
240
TGGMCATTACAGTCCMTGGTATGCTGGAGAGTTACTCTGC~GTTCTCAGTTATCTA WNITVQWYAGELLCKVLSYL III MGCTTTTCTCCATGTATGCCCCAGCCTTCATGAT~T~TGATCAGCCTGGACCGCTCC KLFSMYAPAFMMVVISLDRS
360
CTCGCTATCACGAGGCCCCTAGCTTTGAAAAOCAACAGCAG~GTCGGACAGTCCATGGTT LAITRPLALKSNSKVGQSMV IV GGCCTGGCCTGGATCCTCAGTAGTGTCTTTGCAGGACCACAGTTATACATCTTCAGGATG GLAWILSSVFAGPQLYI F
180
300
420 480
R
M
540
ATTCATCTAGCAGACAGCTCTGGACAGAC~GTTTTCTCTCMTGTGTMCACACTGC IHLADS SGQTKVFSQCVTHC
600
AGTTTTTCACMTGGTGGCATCMGCATTTTATMCTTTTTCACCTTCAGCTGCCTCTTC SFSQWWHQAFYNFFTFSCLF V ATCATCCCTCTTTTCATCATGCTGATCTGCAATG CAAAAATCATCTTCACCCTGACACGG I I PLFIMLICNAKIIFTLTR
660 720
GTCCTTCATCAGGACCCCCACGMCTACMCTGMTCAGTCCMGMCMTATACCMGA VLHQDPHELQLNQSKNNIPR ._ VI GCACGGCTGMGACTCTAAAAATOACGGTTGACGGTTGCATTTGCCACTTCATTTACTGTCTGCT~ ARLKTLKMTVAFATSFTVCW
780
ACTCCCT~~~A~;~~~~TAOOAATTTTGGTATTGGTTTGATCCTG~TGTT~CAGGTTG TP'YYViyLGIWYWFDPEMLNRL VII TCAGACCCAGTAAATCACTTCTTCTTTCTCTTTGCCTTTTT~CCCATGCTTTGATCCA SDPVNHFFFLFAFLNPCFDP
900
840
960
CTTATCTATGGATATTTTTCTCTGTGAttgatagactacacaagaagtcatatgaagaag LIYGYFSL#
1020
ggtaaggtaatgaatctctccatctgggaatgattaacacaaatgttggagcatgtttac
1080
atacaaacaaagtaggatttacacttaagttatcattcttttagaaactcagtcttcaga
1140
gcctc
1145
Fig. 1. Nucleotide and deduced amino acid sequence found in MCF-7 cell and ovarian tumor GnRH receptor cDNAs. The shaded nucleotides designate the oligonucleotide primers used for PCR. The overlines (I-VII) represent the seven tmnsmembnne domains. The nucleotides in the open reading frame (ORF) are capitalized whereas those outside the ORF are shown as lower case letters.
148
S.S. Kakar et al. I Molecular and Cellular Endocrinology 106 (1994) 145-149
Fig. 2. PCR amplification of the first strand cDNA from various tissues and tumor cell lines, followed by Southern blotting. The cDNAs were 885 bp in length; the PCR primers used were nt -25 to -5 (sense) and nt 844-860 (antisense) (see Fig. 1). N, normal; T, tumor. MCF-7 and MDA-MB 468 are breast turner cell lines and PC-3 and LNCaP are prostate tumor cell lines.
al., 1992a). No PCR product was obtained when RNA from MCF-7 cells or the ovarian tumor was subjected to PCR without including the reverse transcriptase step, suggesting the absence of genomic DNA as a contaminant in these samples. Also, our recent studies of the human GnRH receptor gene has revealed introns in the coding sequence (unpublished results); therefore, the GnRH receptor cDNA obtained using RT/PCR is of a size appropriate to the cDNA but not the gene. These results clearly demonstrate the presence of a GnRH receptor mRNA in MCF-7 cells and the ovarian tumor that is identical with the pituitary GnRH receptor. GnRH receptor mRNA expression in various normal and malignant tissues and tumor cell lines was analyzed by RT/PCR using a different antisense primer (nt 844-860) from that used for cloning of the cDNA (see Fig. 1 and Section 2). As shown in Fig. 2, the PCR product identified by Southern blotting corresponded to the expected size of the GnRH receptor (885 bp) in human breast, breast tumor, ovary, ovarian tumor, prostate, prostate tumor and in breast (MCF-7 and MDA-MB 468) and prostate (PC-3 and LNCaP) tumor cell lines. Human pituitary tissue was used as a positive control (Kakar et al., 1992a) and gave a large amount of the appropriately sized product (Fig. 2). GnRH receptor mRNA was lower in all of the extra-pituitary tissues, tumors, and tumor cell lines compared with the pituitary. The RT/PCR assays as performed in these studies are only semi-quantitative and thus, the significance of these apparent differences in the levels of GnRH receptor mRNA expression in various tissues and cell lines cannot be assessed until a more quantitative analysis is performed. 4. Discussion The normal human anterior pituitary gland expresses a GnRH receptor that binds GnRH with high affinity (Kd -5 x 10e9 M) (Wormald et al., 1985). A cDNA representing this receptor has been cloned and sequenced from the human pituitary and shown to be a seven transmembrane,
G-protein coupled receptor; heterologous expression of this cDNA resulted in a binding affinity almost identical to that of the endogenous receptor (Kakar et al., 1992a). Whether this receptor is expressed in extra-pituitary tissues (and in tumors or tumor cell lines derived from them), as it is in the rat (see Clayton and Catt, 1981; Klijn and Foekens, 1989), is controversial since results reported from radioreceptor assays have ranged from no specific binding (Clayton and Huhtaniemi, 1982; Mullen et al., 1992) to low or intermediate binding (Kd of lO-5-1O-8 M) (see Eidne et al., 1985, 1987; Bramley et al., 1986, 1992; Emons et al., 1989; Klijn and Foekens, 1989; Qayum et al., 1990; Vincze et al., 1991), to high affinity binding by Schally and his collaborators ((l-5) x low9 M) (Fekete et al., 1989a-c; SegalAbramson et al., 1992; Emons et al., 1993a,b; Yano et al., 1994). The results presented in this paper (Fig. 1) unequivocally demonstrate that a GnRH receptor mRNA is expressed in a human ovarian tumor and a breast tumor cell line (MCF-7) which has a nucleotide sequence identical to the GnRH receptor mRNA of the human pituitary gland (Kakar et al., 1992a) which is expressed as a receptor having high GnRH binding affinity. The generation by RT/PCR of cDNAs from pituitary, breast, breast tumor, ovary, ovarian tumor, prostate, prostate tumor, two breast tumor cell lines (MCF-7 and MDA-MB 468), and two prostatic cell lines (PC-3 and LNCaP) having the appropriate size and hybridizing with GnRH receptor cDNA (Fig. 2) is strong evidence for the existence in the tissues of GnRH receptor mRNA identical to that of the pituitary. Thus, these findings are strongly suggestive of a high affinity GnRH receptor existing in these tissues and in the tumors and tumor cell lines derived from them. However, a caveat to this conclusion is that post-translational modifications could alter the protein structure of the GnRH receptor in these tissues even though their RNA nucleotide sequences are or may be identical to that in the pituitary gland. Thus, our results are consistent with the reports of Schally and his collaborators (supra vide) that GnRH recep-
S.S. Kakur et al. I Molecular and Cellular Endocrinology 106 (1994) 145-149
tors in human extra-hypophysial tissues and tumors or cell lines derived from them have the high GnRH binding affinities commonly associated with the GnRH receptor of the pituitary gland. The identity and role of the low affinity, high capacity GnRH receptors reported to exist in extrahypophysial tissues and their tumors (supra vide) are not known. Finally, it now seems reasonable to assume that the numerous reports of GnRH agonists and antagonists acting directly on breast, ovarian, endometrial, and prostate cell lines to inhibit their growth (Miller et al., 1985; Eidne et al., 1987; Limonta et al., 1992, 1993; Segal-Abramson et al., 1992; Emons et al., 1993a,b; Yano et al., 1994) do so through GnRH receptors that have similar if not identical properties to those of the pituitary gland. Acknowledgements We wish to thank Jeffrey C. Sellers and Lois C. Musgrove for excellent technical assistance, Dr. Jeffrey E. Kudlow for providing the MDA-MB 468 cell line, and Cindy Urthaler for preparing the manuscript. This study was supported by NIH grant CA 60871. References Bramley. T.A., McPhie, CA. and Menzies, G.S. (1992) Placenta 13, 555-581. Bramley, T.A., Menzies, G.S. and Baird, D.-T. (1986) I. Endocrinol. 108, 323-328. Clayton, R.N. and Catt, K.J. (1981) Endocr. Rev. 2, 186-209. Clayton, R.N. and Huhtauiemi, LT. (1982) Nature 299,56-59. Eidne, K.A., Flanagan, C.A. and Millar R.P. (1985) Science 229, 989991. Eidne, K.A., Flanagan, CA. Harris, N.S. and Millar, R.P. (1987) J. Clin. Endocrinol. Metab. 64,425-432. Emons, G., Ortmann, O., Becker, M., Irmer, G., Springer, B., Laun, R., Holzel, F., Schulz, K.-D. and Schally, A.V. (1993a) Cancer Res. 53, 5439-5446. Emons, G., Pahwa, G.S., Brack, C., Sturm, R., Oberheuser, F., and Knuppen, R. (1989) Eur. J. Cancer Clin. Oncol. 25.215-221.
149
Emons, G., Schroder, B., Ortmann, 0.. Westphalen, S., Schulz, K.-D. and Schally, A.V. (1993b) J. Clin. Endocrinol. Metab. 77, 1458-1464. Fekete, M., Bajusz, S., Groot, K., Csemus, V.J. and Schally A.V. (1989a) Endocrinology 124,946-955. Fekete, M., Redding, T.W., Comaru-Schally, A.M., Pontes, J.E., Connelly, R.W., Srkalovic, G. and Schally, A.V. (1989b) Prostate 14, 191-208. Fekete, M., Witthff, J.L. and Schally, A.V. (1989~) J. Clin. Lab. Anal. 3, 137-147. Kaiser, U.B., Zhao, D., Cardona, G.R. and Chin, W.W. (1992) Biochem. Biophys. Res. Commun. 189, 1645-1652. Kakar, S.S., Musgrove, L.C., Devor, DC., Sellers, J.C. and Neill, J.D. (1992a) Biochem. Biophys. Res. Commun. 189.289-295. Kakar, S.S., Sellers, J.C., Devor, DC., Musgrove, L.C. and Neill, J.D. (1992b) Biochem. Biophys. Res. Commun. 183. 1090-1096. Kakar, S.S., Grantham, K., Musgrove, L.C., Devor, D., Sellers, J.C. and Neil& J.D. (1994) Mol. Cell. Endocrinol. 101, 151-157. Klijn, J.G.M. and Foekens, J.A. (1989) in GnRH Analogues in Cancer and Human Reproduction, Vol. 1, Basic Aspects (Vickery, B.H. and Lunenfeld, B. eds.), pp. 71-84, Kluwer, Dordrecht. Limonta, P., Dondi, D., Moretti, R.M., Fermo, F., Garattini, E. and Motta, M. (1993) J. Clin. Endocrinol. Metab. 76.797-800. Limonta, P., Dondi, D., Moretti, R.M., Maggi, R. and Motta, M. (1992) J. Clin. Endocrinol. Metab. 75, 207-212. Miller, W.R., Scott, W.N., Morris, R., Fraser, H.M. and Sharpc, R.M. (1985) Nature 313.231-233. Moumni, M., Kottler, M.L. and Counis, R. (1994). Biochem. Biophys. Res. Commun. 200.1359-1366. Mullen, P., Bramley T., Menzies, G. and Miller, B. (1993) Eur. J. Cancer 29A, 248-252. Perrin, M.H., Bilezikjian, L.M., Hoeger, K., Donaldson, C.J., Rivier, J., Haas, Y. and Vale, W.W. (1993). Biochem. Biophys. Res. Commun. 191, 1139-I 144. Qayum, A., Gullick, W., Clayton, R.N., Sikora, K. and Waxman, J. (1990). Br. 1. Cancer 62.96-99. Segal-Abramson, T., Kitroser, H., Levy, 1.. Schally, A.V and Sharoni, Y. (1992) Proc. Nan. Acad. Sci. USA 89.23362339. Vincze, B., Palyi, I., Daubner, D., Kmmmer, T., Szamel, I., Bodrogi, I., Seegar, J., Seprodi, J., Mezo, I., Teplan, 1. and Eckhardt, S. (1991) J. Steroid Biochem. Mol. Biol. 38, 119-126. Wormald, P.J., Eidne, K.A. and Millar, R.B. (1985) J. Clin. Endocrinol. Metab. 61, 119&l 194. Yano, T., Pinski, J., Radulovic, S. and Schally, A.V. (1994) Proc. Natl. Acad. Sci. USA 91, 1701-1705.
Molecular and Cellular Endocrinology 106 (1994) 145-149
The nucleotide sequences of human GnRH receptors in breast and ovarian tumors are identical with that found in pituita~ Sham S. Kakara, William E. Grizzleb, Jimmy D. NeilI”** aDepartmen? of Physiology and Biophysics and bDepartment
ofPathology, University of Alabama a? Birmingham, Birmingham, AL 35294, USA
Received 22 August 1994; accepted I7 September 1994
Abstract inhibition of the growth of hormone related human tumor cells in vitro by GnRH agonists and antagonists suggests a direct effect on cell growth and proliferation, and this effect may be achieved through its receptors present in tumor cells. However, the nature of the GnRH receptors present in these tumors is controversiah To determine the molecular characteristics of GnRH receptors in such tumors, we used the reverse transc~ptas~~lymerase chain reaction (RT/PCR) technique to clone these receptors. Primers were selected from the human pituitary GnRH receptor cDNA sequence to amplify the open reading frame and parts of its 5’ and 3’-untranslated sequences. Nucleotide sequencing of the GnRH receptor cDNAs from a breast tumor cell line (MCF-7) and from an ovarian tumor showed identity with that of the human pituitary GnRH receptor which binds GnRH with high afftnity. GnRH receptor mRNA was found to be expressed in human pituitary, breast, breast tumor, ovary, ovarian tumor, prostate, prostate tumor and in breast tumor cell lines (MCF-7 and MDA-Mu 468) and prostate tumor cell lines (PC-3 and LNCaP). These findings demonstrate that a mRNA representing the pituitary form of the GnRH receptor (which shows high affinity binding with GnRH) is also expressed in certain normal tissues and in hormone related human tumors and tumor cell lines derived from them. Keywords:
Gonadotropin releasing hormone receptor; Molecular cloning; Breast tumor; Ovarian tumor; Prostate tumor
1. Introduction The gonadotropin releasing hormone (GnRH) receptor of the rat as measured by radioreceptor assay has high GnRH binding affinity (low nanomolar range) and is expressed primarily in the anterior pituitary gland (Clayton and Catt, 1981). However, a similar high affinity receptor is also expressed in the ovary, testis, adrenal, and mammary gland (see Klijn and Foekens, 1989). The recent molecular cloning, nucleotide sequencing, and heterologous expression of cDNAs representing the rat pituitary GnRH receptor have confirmed this high af~nity and this tissue distribution ( Kaiser et al., 1992; Perrin et al., 1993; Kakar et al., 1994). Moreover, the nucleotide sequences of ovarian and testicular GnRH-receptor cDNAs have just been reported to be identical with that of the pituitary gland (Moumni et al., 1994).
* Corresponding author. Tel. (205) 934 2499. Fax (205) 934 1445. Email: [email protected].
The human anterior pituitary gland expresses a GnRH receptor clearly having the same high affinity binding characteristics as reported for the rat (Wormald et al., 1985). Indeed, a cDNA representing the human pituitary GnRH receptor has been cloned and sequenced and, after heterologous expression, showed a high binding affinity (Kd -5 nM) (Kakar et al., 1992a). The question of GnRH receptor expression in ex~a-pitui~ry tissues, however, has remained unresolved. Most investigators have reported binding affinities that are 10-10 000-fold lower than that of the pituitary using radioreceptor assays on human ovaries and ovarian tumors, adrenals, placenta, breast cancers and breast cancer cell lines, and prostate tumor cell lines (see Eidne et al., 1985, 1987; Bramley et al., 1986, 1992; Emons et al., 1989; Klijn and Foekens, 1989; Qayum et al., 1990; Vincze et al., 1991). In contrast, there arc reports that no GnRH binding occurs in human gonadal tissues (Clayton and Huhtaniemi, 1982) or in human breast tissues and breast tumor cell lines (Mullen et al., 1992). On the other hand, Schally and his collaborators have reported binding affinities for human breast tumors and tumor cell
0303-7207/94/$07.00 0 1994Elsevier Science Ireland Ltd. All rights reserved SSDf 0303-7207(94)03407-K
146
S.S. Kahr
et al. I Molecular and Cellular Endocrinology 106 (1994) 145-149
lines (Fekete et al., 1989a,c; Segal-Abramson et al., 1992), prostate tumors (Fekete et al., 1989b), endometrial cancer cell lines (Emons et al., 1993b), and ovarian cancer cell lines (Emons et al., 1993a; Yano et al., 1994) that equal those found in human pituitary tissue (Wormald et al., 1985). Answering the question of extra-pituitary expression of GnRH receptors in humans is not only of academic interest but is also related to the numerous reports that GnRH agonists and antagonists act directly on breast, ovarian, endometrial, and prostate tumor cell lines to inhibit their growth (Miller et al., 1985; Eidne et al., 1987; Limonta et al., 1992, 1993; Segal-Abramson et al., 1992; Emons et al., 1993a,b; Yano et al., 1994). Thus, in the present studies, we have undertaken the molecular cloning and nucleotide sequencing of cDNAs representing the GnRH receptor from a breast tumor cell line and an ovarian tumor. Also, we have used the reverse transcriptase/polymerase chain reaction (RT/PCR) technique to investigate the expression of GnRH receptor mRNA in several other human tissues and tumor cell lines. 2. Materials and methods 2.1. Tissue and cell lines Various human tissues were obtained from The Tissue Procurement Facility, Comprehensive Cancer Center, University of Alabama at Birmingham. These tissues were collected at the time of autopsy (3-12 h after death) or biopsy, and were immediately frozen in liquid nitrogen and then stored at -70°C until RNA isolation. An ovarian tumor sample was collected from a 51-year-old Caucasian female by biopsy and stored in liquid nitrogen. Pathological analysis of the sample showed it to be composed of malignant cells and desmoplastic fibrous tissue which was primarily acellular; normal ovarian tissue was not identified. The breast tumor cell line (MCF-7) and prostate tumor cell lines (PC-3 and LNCaP) were obtained from the American Type Culture Collection (ATCC). Another breast tumor cell line (MDA-MB 468) was obtained from Dr. Jeffrey E. Kudlow, University of Alabama at Birmingham. The cell lines were cultured and maintained according to the recommendations of ATCC. 2.2. RNA isolation Total RNA from tissues and cell lines was prepared using the Ultraspec RNA Isolation System from Biotecx (Kakar et al., 1994). 2.3. Cloning of the GnRH receptor To clone GnRH receptors from breast and ovarian tumors, we used the reverse transcriptase/polymerase chain reaction (RT/PCR) technique. Oligonucleotide primers [sense 5’-AGCTGAATTCGCTTGAAGCTCTGTCCTGGGA-3’ (nt -25 to -5) and antisense 5’-CTACGA-
A’ITCGAGGCTCTGAAGACTGAGTT-3’ (nt 1126 to 1145)] were selected, respectively, from the 5’ and 3’ nontranslated regions of the human pituitary GnRH receptor cDNA sequence (Fig. 1) (Kakar et al., 1992a). The primer sequences contained an EcoRI restriction enzyme sequence at their 5’ ends. RNA samples from the MCF-7 cells and the ovarian tumor were subjected to first strand cDNA synthesis using an oligo(dT) primer and AMV reverse transcriptase @omega). The first strand cDNAs were then used in PCR. The PCR reaction conditions were 1.5 min at 95”C, 1.5 min at 52°C and 4 min at 72°C for 30 cycles in a Perkin-Elmer Cetus thermal cycler. The reaction mixtures were then electrophoresed through a 1.0% agarose gel and stained with ethidium bromide. The cDNAs were eluted from the gel and subcloned into the AZAPII vector at its EcoRI site. Recombinant clones were screened using 32Plabeled human GnRH receptor cDNA (comprised of its open reading frame) as a probe according to the procedure described previously (Kakar et al., 1992a). A large number of positive clones were obtained. Several of the positive clones were purified to homogeneity. Three clones from MCF-7 cells and two clones from the ovarian tumor were completely sequenced (Kakar et al., 1992b). Sequence comparisons were performed using the Wisconsin GCG program on a VAX computer. 2.4. GnRH receptor expression in tissues, tumors, and cell lines Total RNA from tissues and cell lines was prepared as described above. Two micrograms of total RNA from various tissues, tumors, and cell lines were used to synthesize first strand cDNA in a 20~1 reaction volume as described above. A 5.0~,ul aliquot of these solutions was then used in the PCR as described above. The primers used were sense 5’-GCTTGAAGCTCTGTCCTGGGA-3’ (-25 to -5) and antisense 5’-CCTAGGACATAGTAGGG-3’ (844-860) (Fig. 1). Twenty microliters of the lOO@ reaction mixture from each sample was then electrophoresed through a 1.O% agarose gel and stained with ethidium bromide. The identity of the DNA generated by PCR was confirmed by Southern blot analysis using 32P-labeled GnRH receptor cDNA as a probe (Fig. 1). To rule out contamination of the RNA samples with genomic DNA, we subjected RNA from each sample directly to PCR, omitting the reverse transcriptase step. 3. Results The nucleotide sequence and corresponding predicted amino acid sequence of the GnRH receptor cDNA from MCF-7 cells and the ovarian tumor are shown in Fig. 1. The cDNA is composed of 1170 nucleotides and encodes a 328 amino acid protein. The nucleotide sequences of all three clones from MCF-7 cells and the two clones from the ovarian tumor were identical with each other and with the human pituitary GnRH receptor cDNA sequence (Kakar et
S.S. Kukar et al. I Molecular and Cellular Endocrinology 106 (1994) 145-149
147
-1 ATGGCAAACAGTGCCTCTCCTGM~GMTCACTC MANSASPEQNQNHC
60 SAINNS
ATCCCACTGATGCAGGOCMCCTCCCCACTCTCTGACCTTGTCTGGAAAOATCCGAGTGACG PTLTLSGKIRVT IPLMQGNL I GTTACTTTCTTCCTTTTTCTGCTCTCTGCOACCTTTTMTGCTTCTTTCTTGTTG~CTT VTFFLFLLSATFNASFLLKL
120
CAGAAGTGGACACAGMGAAAGAGAGWGGGUGCTCTCMGMTGMGCTGCTCTTA QKWTQKKEKGKKLSRMKLLL ._ ._ II AAACATCTGACCTTAGCCMCCTGTTGGAGACTCTGATTGTCATGCCACTGGATGOGATG KHLTLANLLETLIVMPLDGM
240
TGGMCATTACAGTCCMTGGTATGCTGGAGAGTTACTCTGC~GTTCTCAGTTATCTA WNITVQWYAGELLCKVLSYL III MGCTTTTCTCCATGTATGCCCCAGCCTTCATGAT~T~TGATCAGCCTGGACCGCTCC KLFSMYAPAFMMVVISLDRS
360
CTCGCTATCACGAGGCCCCTAGCTTTGAAAAOCAACAGCAG~GTCGGACAGTCCATGGTT LAITRPLALKSNSKVGQSMV IV GGCCTGGCCTGGATCCTCAGTAGTGTCTTTGCAGGACCACAGTTATACATCTTCAGGATG GLAWILSSVFAGPQLYI F
180
300
420 480
R
M
540
ATTCATCTAGCAGACAGCTCTGGACAGAC~GTTTTCTCTCMTGTGTMCACACTGC IHLADS SGQTKVFSQCVTHC
600
AGTTTTTCACMTGGTGGCATCMGCATTTTATMCTTTTTCACCTTCAGCTGCCTCTTC SFSQWWHQAFYNFFTFSCLF V ATCATCCCTCTTTTCATCATGCTGATCTGCAATG CAAAAATCATCTTCACCCTGACACGG I I PLFIMLICNAKIIFTLTR
660 720
GTCCTTCATCAGGACCCCCACGMCTACMCTGMTCAGTCCMGMCMTATACCMGA VLHQDPHELQLNQSKNNIPR ._ VI GCACGGCTGMGACTCTAAAAATOACGGTTGACGGTTGCATTTGCCACTTCATTTACTGTCTGCT~ ARLKTLKMTVAFATSFTVCW
780
ACTCCCT~~~A~;~~~~TAOOAATTTTGGTATTGGTTTGATCCTG~TGTT~CAGGTTG TP'YYViyLGIWYWFDPEMLNRL VII TCAGACCCAGTAAATCACTTCTTCTTTCTCTTTGCCTTTTT~CCCATGCTTTGATCCA SDPVNHFFFLFAFLNPCFDP
900
840
960
CTTATCTATGGATATTTTTCTCTGTGAttgatagactacacaagaagtcatatgaagaag LIYGYFSL#
1020
ggtaaggtaatgaatctctccatctgggaatgattaacacaaatgttggagcatgtttac
1080
atacaaacaaagtaggatttacacttaagttatcattcttttagaaactcagtcttcaga
1140
gcctc
1145
Fig. 1. Nucleotide and deduced amino acid sequence found in MCF-7 cell and ovarian tumor GnRH receptor cDNAs. The shaded nucleotides designate the oligonucleotide primers used for PCR. The overlines (I-VII) represent the seven tmnsmembnne domains. The nucleotides in the open reading frame (ORF) are capitalized whereas those outside the ORF are shown as lower case letters.
148
S.S. Kakar et al. I Molecular and Cellular Endocrinology 106 (1994) 145-149
Fig. 2. PCR amplification of the first strand cDNA from various tissues and tumor cell lines, followed by Southern blotting. The cDNAs were 885 bp in length; the PCR primers used were nt -25 to -5 (sense) and nt 844-860 (antisense) (see Fig. 1). N, normal; T, tumor. MCF-7 and MDA-MB 468 are breast turner cell lines and PC-3 and LNCaP are prostate tumor cell lines.
al., 1992a). No PCR product was obtained when RNA from MCF-7 cells or the ovarian tumor was subjected to PCR without including the reverse transcriptase step, suggesting the absence of genomic DNA as a contaminant in these samples. Also, our recent studies of the human GnRH receptor gene has revealed introns in the coding sequence (unpublished results); therefore, the GnRH receptor cDNA obtained using RT/PCR is of a size appropriate to the cDNA but not the gene. These results clearly demonstrate the presence of a GnRH receptor mRNA in MCF-7 cells and the ovarian tumor that is identical with the pituitary GnRH receptor. GnRH receptor mRNA expression in various normal and malignant tissues and tumor cell lines was analyzed by RT/PCR using a different antisense primer (nt 844-860) from that used for cloning of the cDNA (see Fig. 1 and Section 2). As shown in Fig. 2, the PCR product identified by Southern blotting corresponded to the expected size of the GnRH receptor (885 bp) in human breast, breast tumor, ovary, ovarian tumor, prostate, prostate tumor and in breast (MCF-7 and MDA-MB 468) and prostate (PC-3 and LNCaP) tumor cell lines. Human pituitary tissue was used as a positive control (Kakar et al., 1992a) and gave a large amount of the appropriately sized product (Fig. 2). GnRH receptor mRNA was lower in all of the extra-pituitary tissues, tumors, and tumor cell lines compared with the pituitary. The RT/PCR assays as performed in these studies are only semi-quantitative and thus, the significance of these apparent differences in the levels of GnRH receptor mRNA expression in various tissues and cell lines cannot be assessed until a more quantitative analysis is performed. 4. Discussion The normal human anterior pituitary gland expresses a GnRH receptor that binds GnRH with high affinity (Kd -5 x 10e9 M) (Wormald et al., 1985). A cDNA representing this receptor has been cloned and sequenced from the human pituitary and shown to be a seven transmembrane,
G-protein coupled receptor; heterologous expression of this cDNA resulted in a binding affinity almost identical to that of the endogenous receptor (Kakar et al., 1992a). Whether this receptor is expressed in extra-pituitary tissues (and in tumors or tumor cell lines derived from them), as it is in the rat (see Clayton and Catt, 1981; Klijn and Foekens, 1989), is controversial since results reported from radioreceptor assays have ranged from no specific binding (Clayton and Huhtaniemi, 1982; Mullen et al., 1992) to low or intermediate binding (Kd of lO-5-1O-8 M) (see Eidne et al., 1985, 1987; Bramley et al., 1986, 1992; Emons et al., 1989; Klijn and Foekens, 1989; Qayum et al., 1990; Vincze et al., 1991), to high affinity binding by Schally and his collaborators ((l-5) x low9 M) (Fekete et al., 1989a-c; SegalAbramson et al., 1992; Emons et al., 1993a,b; Yano et al., 1994). The results presented in this paper (Fig. 1) unequivocally demonstrate that a GnRH receptor mRNA is expressed in a human ovarian tumor and a breast tumor cell line (MCF-7) which has a nucleotide sequence identical to the GnRH receptor mRNA of the human pituitary gland (Kakar et al., 1992a) which is expressed as a receptor having high GnRH binding affinity. The generation by RT/PCR of cDNAs from pituitary, breast, breast tumor, ovary, ovarian tumor, prostate, prostate tumor, two breast tumor cell lines (MCF-7 and MDA-MB 468), and two prostatic cell lines (PC-3 and LNCaP) having the appropriate size and hybridizing with GnRH receptor cDNA (Fig. 2) is strong evidence for the existence in the tissues of GnRH receptor mRNA identical to that of the pituitary. Thus, these findings are strongly suggestive of a high affinity GnRH receptor existing in these tissues and in the tumors and tumor cell lines derived from them. However, a caveat to this conclusion is that post-translational modifications could alter the protein structure of the GnRH receptor in these tissues even though their RNA nucleotide sequences are or may be identical to that in the pituitary gland. Thus, our results are consistent with the reports of Schally and his collaborators (supra vide) that GnRH recep-
S.S. Kakur et al. I Molecular and Cellular Endocrinology 106 (1994) 145-149
tors in human extra-hypophysial tissues and tumors or cell lines derived from them have the high GnRH binding affinities commonly associated with the GnRH receptor of the pituitary gland. The identity and role of the low affinity, high capacity GnRH receptors reported to exist in extrahypophysial tissues and their tumors (supra vide) are not known. Finally, it now seems reasonable to assume that the numerous reports of GnRH agonists and antagonists acting directly on breast, ovarian, endometrial, and prostate cell lines to inhibit their growth (Miller et al., 1985; Eidne et al., 1987; Limonta et al., 1992, 1993; Segal-Abramson et al., 1992; Emons et al., 1993a,b; Yano et al., 1994) do so through GnRH receptors that have similar if not identical properties to those of the pituitary gland. Acknowledgements We wish to thank Jeffrey C. Sellers and Lois C. Musgrove for excellent technical assistance, Dr. Jeffrey E. Kudlow for providing the MDA-MB 468 cell line, and Cindy Urthaler for preparing the manuscript. This study was supported by NIH grant CA 60871. References Bramley. T.A., McPhie, CA. and Menzies, G.S. (1992) Placenta 13, 555-581. Bramley, T.A., Menzies, G.S. and Baird, D.-T. (1986) I. Endocrinol. 108, 323-328. Clayton, R.N. and Catt, K.J. (1981) Endocr. Rev. 2, 186-209. Clayton, R.N. and Huhtauiemi, LT. (1982) Nature 299,56-59. Eidne, K.A., Flanagan, C.A. and Millar R.P. (1985) Science 229, 989991. Eidne, K.A., Flanagan, CA. Harris, N.S. and Millar, R.P. (1987) J. Clin. Endocrinol. Metab. 64,425-432. Emons, G., Ortmann, O., Becker, M., Irmer, G., Springer, B., Laun, R., Holzel, F., Schulz, K.-D. and Schally, A.V. (1993a) Cancer Res. 53, 5439-5446. Emons, G., Pahwa, G.S., Brack, C., Sturm, R., Oberheuser, F., and Knuppen, R. (1989) Eur. J. Cancer Clin. Oncol. 25.215-221.
149
Emons, G., Schroder, B., Ortmann, 0.. Westphalen, S., Schulz, K.-D. and Schally, A.V. (1993b) J. Clin. Endocrinol. Metab. 77, 1458-1464. Fekete, M., Bajusz, S., Groot, K., Csemus, V.J. and Schally A.V. (1989a) Endocrinology 124,946-955. Fekete, M., Redding, T.W., Comaru-Schally, A.M., Pontes, J.E., Connelly, R.W., Srkalovic, G. and Schally, A.V. (1989b) Prostate 14, 191-208. Fekete, M., Witthff, J.L. and Schally, A.V. (1989~) J. Clin. Lab. Anal. 3, 137-147. Kaiser, U.B., Zhao, D., Cardona, G.R. and Chin, W.W. (1992) Biochem. Biophys. Res. Commun. 189, 1645-1652. Kakar, S.S., Musgrove, L.C., Devor, DC., Sellers, J.C. and Neill, J.D. (1992a) Biochem. Biophys. Res. Commun. 189.289-295. Kakar, S.S., Sellers, J.C., Devor, DC., Musgrove, L.C. and Neill, J.D. (1992b) Biochem. Biophys. Res. Commun. 183. 1090-1096. Kakar, S.S., Grantham, K., Musgrove, L.C., Devor, D., Sellers, J.C. and Neil& J.D. (1994) Mol. Cell. Endocrinol. 101, 151-157. Klijn, J.G.M. and Foekens, J.A. (1989) in GnRH Analogues in Cancer and Human Reproduction, Vol. 1, Basic Aspects (Vickery, B.H. and Lunenfeld, B. eds.), pp. 71-84, Kluwer, Dordrecht. Limonta, P., Dondi, D., Moretti, R.M., Fermo, F., Garattini, E. and Motta, M. (1993) J. Clin. Endocrinol. Metab. 76.797-800. Limonta, P., Dondi, D., Moretti, R.M., Maggi, R. and Motta, M. (1992) J. Clin. Endocrinol. Metab. 75, 207-212. Miller, W.R., Scott, W.N., Morris, R., Fraser, H.M. and Sharpc, R.M. (1985) Nature 313.231-233. Moumni, M., Kottler, M.L. and Counis, R. (1994). Biochem. Biophys. Res. Commun. 200.1359-1366. Mullen, P., Bramley T., Menzies, G. and Miller, B. (1993) Eur. J. Cancer 29A, 248-252. Perrin, M.H., Bilezikjian, L.M., Hoeger, K., Donaldson, C.J., Rivier, J., Haas, Y. and Vale, W.W. (1993). Biochem. Biophys. Res. Commun. 191, 1139-I 144. Qayum, A., Gullick, W., Clayton, R.N., Sikora, K. and Waxman, J. (1990). Br. 1. Cancer 62.96-99. Segal-Abramson, T., Kitroser, H., Levy, 1.. Schally, A.V and Sharoni, Y. (1992) Proc. Nan. Acad. Sci. USA 89.23362339. Vincze, B., Palyi, I., Daubner, D., Kmmmer, T., Szamel, I., Bodrogi, I., Seegar, J., Seprodi, J., Mezo, I., Teplan, 1. and Eckhardt, S. (1991) J. Steroid Biochem. Mol. Biol. 38, 119-126. Wormald, P.J., Eidne, K.A. and Millar, R.B. (1985) J. Clin. Endocrinol. Metab. 61, 119&l 194. Yano, T., Pinski, J., Radulovic, S. and Schally, A.V. (1994) Proc. Natl. Acad. Sci. USA 91, 1701-1705.