The OsLti6 genes encoding low-molecular-weight membrane proteins are differentially expressed in rice cultivars with contrasting sensitivity to low temperature

Gene 344 (2005) 171 – 180 www.elsevier.com/locate/gene

The OsLti6 genes encoding low-molecular-weight membrane proteins are differentially expressed in rice cultivars with contrasting sensitivity to low temperatureB Mustafa R. Morsya, Abeer M. Almutairia, James Gibbonsa, Song Joon Yunb, Benildo G. de los Reyesa,c,* a

Department of Crop, Soil and Environmental Sciences, University of Arkansas, Fayetteville, AR 72701, USA b Faculty of Biological Resources Sciences, Chonbuk National University, Chonju 561-756, Korea c Department of Biological Sciences, University of Maine, Orono, 5735 Hitchner Hall, ME 04469, USA Received 13 May 2004; received in revised form 27 August 2004; accepted 23 September 2004 Received by G. Theissen

Abstract Rice (Oryza sativa L.) is sensitive to chilling particularly at early stages of seedling establishment. Two closely related genes (OsLti6a, OsLti6b), which are induced by low temperature during seedling emergence were isolated from a cold tolerant temperate japonica rice cultivar. These genes are closely related to the Arabidopsis rare cold-inducible (RCI2) and barley low-temperature-inducible (BLT101) genes. Based on direct biochemical and indirect physiological evidence and similarity with a conserved protein domain in the Cluster of Orthologous Groups (COG) database (e.g., yeast PMP3), the rice genes belong to a class of low-molecular-weight hydrophobic proteins involved in maintaining the integrity of the plasma membrane during cold, dehydration and salt stress conditions. Both genes exhibit a genotype-specific expression signature characterized by early and late stress-inducible expression in tolerant and intolerant genotypes, respectively. The differences in temporal expression profiles are consistent with cultivar differences in cold-induced membrane leakiness and seedling vigor. The presence of CRT/DRE promoter cis-elements is consistent with the synchronized expression of OsLti6 genes with the Crepeat binding factor/drought responsive element-binding protein (CBF/DREB) transcriptional activator. The present results indicate that the Oslti6 genes are part of a battery of cold stress defense-related genes regulated by a common switch. D 2004 Elsevier B.V. All rights reserved. Keywords: Cold-regulated genes; Membrane injury; Hydrophobic proteins; Cold tolerance; Genetic circuit

1. Introduction Abbreviations: OsLti6, Oryza sativa low-temperature-induced gene; EL, electrolyte leakage; CRT/DRE, C-repeat/drought responsive element; CBF/DREB, C-repeat binding factor/drought responsive element-binding protein; P5CS, D-pyrroline 5-carboxylase synthetase; COG, cluster of orthologous groups; EST, expressed sequence tags. B Accession Numbers: OsLti6a=AY607689, OSLti6b=AY607690, P5CS=CA998314, CBF/DREB=AY607691. * Corresponding author. Current Address: Department of Biological Sciences, University of Maine, Orono, 5735 Hitchner Hall, ME 04469, USA. Tel.: +1 207 581 2564; fax: +1 207 581 2537. E-mail address: [email protected] (B.G. de los Reyes). 0378-1119/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2004.09.033

The geographic distribution of plants is determined to a large extent by their sensitivity to low temperatures. Tropical species are chilling-sensitive, and thus they are easily damaged by low but nonfreezing temperatures. In contrast, most temperate species acquire the ability to withstand freezing during the process of cold acclimation (CA; Thomashow, 1999). The cell membrane is the most direct target of injury in both chilling-sensitive and -insensitive plants. In chillingsensitive species, a major effect is the physical transition of

172

M.R. Morsy et al. / Gene 344 (2005) 171–180

membrane from a flexible liquid-crystalline to a solid gel phase (Kratsch and Wise, 2000). The change in physical state of the membrane affects cellular function in a number of ways. The most immediate effect is increased permeability leading to cellular leakiness and ion imbalance. As a consequence of abnormal metabolism, injured cells accumulate toxic metabolites and active oxygen species (Nishida and Murata, 1996). The adaptive responses of less sensitive genotypes involve cellular defenses against membrane lipid peroxidation via antioxidants or active oxygen scavengers (Dipiero and Leonardis, 1997) and increased levels of unsaturated fatty acids in membrane lipids (Miquel et al., 1993). Chilling-insensitive species are not injured by abovefreezing temperatures. However, subzero temperatures often result in freeze-induced cellular dehydration (Uemura and Steponkus, 1997). The adaptive responses, which are initiated during CA, are often associated with various cellular defenses such as osmotic adjustment via synthesis of compatible osmolytes by enzymes such as D-pyrroline 5-carboxylase synthetase (P5CS; Gilmour et al., 2000), enhanced stability of cell membranes by increased desaturation of fatty acids in membrane lipids (Uemura and Steponkus, 1997), enhanced stability of proteins and other macromolecules by molecular chaperones (Thomashow, 1999), cryoprotection by thermal hysteresis proteins (Worral et al., 1998), and cellular detoxification by combating the harmful effects of oxygen radicals (Dipiero and Leonardis, 1997). CA also induces the expression of other novel stressrelated genes such as the cor, cold regulated; rd, responsive to desiccation; lti, low temperature induced; kin, cold-inducible and erd, early dehydration inducible (Shinozaki and Yamaguchi-Shinozaki, 2000; Thomashow, 1999). These genes are also activated by other environmental factors, such as dehydration and salinity and by chemical signal such as abscisic acid (ABA). The products of many of these genes are believed to be major components of cellular defenses that protect the cell against potential membrane damage. For instance, expression of the Arabidopsis COR15a gene precludes the occurrence of deleterious injury to the chloroplast membrane, which often occurs as a consequence of lamellar to hexagonal phase II transition during freezeinduced cellular dehydration (Steponkus et al., 1998). The expression of the cor/rd class of genes is regulated by the Crepeat Binding Factor/Drought Responsive Element-Binding protein (CBF/DREB), a group of transcription factors that contain the AP2/EREBP DNA-binding domain. These factors bind to the highly conserved cis-element C-repeat/ Drought Responsive Element (CRT/DRE) in the promoter of target cor/rd genes and activate their transcription in concert (Liu et al., 1998; Stockinger et al., 1997). Rice (Oryza sativa L.), a warm-season plant, is sensitive to chilling particularly at early stages of seedling establishment. In highly sensitive genotypes, cold stress injuries cause irreversible damage to cellular components and metabolism. Injury is often manifested by the failure of germination or

poor seedling vigor. Genetic studies showed that genotypic variation for seedling cold tolerance is controlled by many genes with cumulative effects (Redona and Mackill, 1996). Given the complexity of biochemical and molecular mechanisms in which these genes function, the central role of integrated developmental and stress-regulated gene expression is an emerging concept (De los Reyes et al., 2003; De los Reyes and McGrath, 2003). Based on the evolutionary conservation of the components of the CBF/DREB regulon among chilling-insensitive and -sensitive plants (Dubouzet et al., 2003; Jaglo et al., 2001) and our previous analysis of cold stress expressed sequence tags (ESTs), we proposed that the stress-related responses in rice are governed by genes that are regulated in a similar mechanism as the genes involved in the early stages of CA in temperate plants (De los Reyes et al., 2003). Here, we report the identification of two closely related plasma membrane protein genes, OsLti6a and OsLti6b, as downstream components of the cold stress regulatory circuit in developing rice seedlings.

2. Materials and methods 2.1. Treatments and phenotypic evaluation Rice cultivars representing a range of chilling sensitivity under field condition were selected from the cold tolerance breeding germplasm of the University of Arkansas. Each genotype was evaluated in the Conviron-E7 growth chambers at prophyll (S3) emergence stage under optimum (30 8C) and low temperature (10 8C) conditions with continuous light at 600 Amol photons m 2 s 1 and 70% RH. Evaluation of chilling sensitivity was based on germination of 100 seeds (coleoptile elongation to N0.5 cm in 1.5% agar) and seedling recovery measured as the percentage of seedlings that survived and grew to the three-leaf stage (V3) at optimum temperature following 12-day emergence under cold stress. Statistical analysis (t-test) was performed by SYSTAT10.2a. Physiological evaluation was based on membrane injury following stress treatments. Seedlings grown to S3 stage at control temperature were subjected to cold, osmotic (250 mM mannitol), salt (250 mM NaCl) and ABA (100 AM) stress treatments. Prophyll tissues were excised from 10 seedlings after 4 days of stress. Tissues were submerged in 40 ml deionized water for 6 h and electrical conductivity (EC) of the washings was measured. Total electrolyte from tissues was measured after overnight freezing at 80 8C. Percentage electrolyte leakage (EL) due to stress was expressed as EC before freezing divided by EC after freezing multiplied by 100. 2.2. Cloning of the OsLti genes The cDNA clones for OsLti6a and OsLti6b were derived from the cold stress EST library of cv. CT6748-8-CA-17 as

M.R. Morsy et al. / Gene 344 (2005) 171–180

described in De los Reyes et al. (2003). Full-length cDNA sequences were determined by bidirectional sequencing with T3 and T7 primers of the pBluescript SK vector (Stratagene). The full-length cDNA sequences were assembled from the 5V and 3V sequences and multiple sequence alignments were performed by ClustalX program of the Vector NTI-Advance Suite (Invitrogen). Analysis of amino acid sequences was performed by ExPasy Proteomics tools (http://us.expasy.org/tools/; Kyte and Doolittle, 1982). Genomic sequences were obtained by nucleotide blast alignment of the full-length cDNAs with the japonica genomic sequences in the GenBank. Genomic sequence was analyzed by GenScan (http:// genes.mit.edu/GENSCAN.html). 2.3. RNA gel blot analysis Total RNA was isolated from control and stress tissues by the RNEasy Plant kit (Qiagen) and poly-A+ RNA was purified using the PolyA-tract kit (Promega). Gene-specific probes were used to confirm the cold-induced expression of OsLti6a and Oslti6b by Northern blot analysis. Briefly, 500 ng of poly-A+ RNA samples from shoot and root tissues were blotted on Hybond N+ nylon membrane (Amersham). Gene-specific probes were labeled with 32P-dCTP by random priming with the RediPrime kit (Amersham). The RNA gel blots were hybridized overnight with the labeled probes at 42 8C in the NorthernMax hybridization buffer (Ambion). Hybridized filters were washed at 42 8C at medium (0.5 SSC, 0.1% SDS) and high (0.1 SSC, 0.1% SDS) stringencies and then autoradiographed for 48 h. 2.4. Semiquantitative reverse transcription-PCR (RT-PCR) The temporal changes in transcript abundance were analyzed by a two-step semiquantitative RT-PCR with the Retroscript kit (Ambion). The expression of actin and coldinducible P5CS genes were used as negative and positive controls, respectively. Briefly, 2 Ag of total RNA was reverse transcribed with oligo-dT primer and MMLV-RT (200 units) in the presence of placental RNase inhibitor (10 units). Equal amounts (1 Al) of the first strand cDNA were used as template for gene-specific PCR with the following primers: (a) OsLti6a: AATACTGCGAGAGAAATTAATCA (F), TAAGAGGGGAGCTTATTCACAC (R); (b) OsLti6b: GCCTTAAATTGGAGCTCAGTC (F), GTGCAGAAGATAAACTGGAGAA (R); (c) CBF/DREB: GAGACGAGGC A C C T A G T G T T C ( F ) , C AT G G T T A C T A G CAGAAAGACTTG (R); (d) P5CS: AAGATGGAAGATTGGCTTTGGGCAG (F), TCTCGTGTAGGTAGAGG A G G C AT G A ( R ) ; a n d ( e ) A c t i n : C A A G G C CAATCGTGAGAAG (F), AGCAATGCCAGGGAACATAGT (R). Amplification of gene-specific fragments was performed with 2 units of SuperTaq Plus (Ambion) for 24 cycles under the following conditions: Initial denaturation at 94 8C for 3 min, cycle denaturation at 94 8C for 30 s,

173

annealing at 53 8C for 30 s, extension at 72 8C for 30 s, and final extension at 72 8C for 5 min. The RT-PCR products were analyzed in a 1.1% agarose gel. 2.5. Protein fractionation and Western blot analysis Cytoplasmic and membrane-bound protein fractions were isolated from S3 seedlings of the tolerant line CT6748-8-CA17 with the ProteoPrep Universal Extraction kit (Sigma) with slight modification. Briefly, 5 g of shoots from control (30 8C) and cold stressed (10 8C) seedlings were pulverized in liquid nitrogen. The powder was suspended in 10 ml of plant cell lysis and extraction buffer (Sigma) containing protease inhibitor cocktail (Roche). The slurry was mixed thoroughly by grinding in 10 ml of the soluble cytoplasmic extraction buffer (5 mM Tris). The cytoplasmic fraction (supernate) was separated from the membrane-bound fraction (pellet) by two sequential centrifugations at 14,000g for 45 min at 4 8C and resuspension in 10 ml soluble cytoplasmic extraction buffer. The pellet and supernate resulting from the two rounds of solubilization and centrifugation were processed according to the manufacturer’s protocol to harvest the membrane protein fraction and total soluble cytoplasmic protein fraction. The membrane fraction was further purified by mixing with 2 ml of the cellular and organelle membrane solubilizing reagent (7 M Urea, 2 M Thiourea, 1% C7BzO detergent, 40 mM Tris, pH 10.4; Sigma) followed by centrifugation at 14,000g for 45 min at 15 8C. Residual insoluble materials were removed by centrifugation at 20,000g for 5 min at room temperature. Contaminating salts were removed from the protein preparations by 30 min dialysis in nylon membrane at 4 8C. Protein samples were mixed with Tricine denaturing sample buffer (Biorad) in a 1:1 ratio and boiled for 10 min. Electrophoresis was performed in duplicate at 200 V in Criterion XT mini-gel and XT MES running buffer (Biorad). One of the duplicate gels was stained with coomassie brilliant blue and the other was electroblotted on Hybond-PVDF membrane (Amersham) by standard procedures. Based on the predicted amino acid sequence of OSLTI6a, an antigenic peptide, TATCIDIILAIIL, was commercially synthesized and used to prepare polyclonal antibody in rabbit (Q-Biogene/Merlin Custom Services). Immunodetection of the OSLTI proteins on Western blot was performed with the ECL Plus Western blotting reagent and detection system (Amersham) according to the manufacturer’s protocol.

3. Results 3.1. Cultivar variation in seedling cold tolerance Rice is a chilling-sensitive species with optimum temperature for germination and early seedling growth within the range of 25 to 35 8C. To provide a more quantitative measure

174

M.R. Morsy et al. / Gene 344 (2005) 171–180

of the variation in early seedling stage sensitivity to low temperature, 12 rice cultivars that differ in relative sensitivity under field conditions (University of Arkansas Rice Breeding Program, unpublished data) were examined for three different parameters. The observed total variation in cold sensitivity is represented in this study by five cultivars: Temperate japonica: CT6748-8-CA-17 and Quilla 66304; Tropical japonica: Lemont; Indica: INIAP12 and IR72. Genetic differences among the five representative cultivars are shown by total germination at 10 8C, rate of seedling survival to three-leaf (V3) stage following exposure to 10 8C, and severity of membrane damage after exposure to 10 8C as measured by EL. Based on total germination, the five rice lines can be ranked by increasing sensitivity as follows: CT6748-8-CA-17=Quilla 66304bLemontbINIAP12=IR72 (Fig. 1A). Additionally, the rice lines that exhibited the highest germination at 10 8C (CT6748-8CA-17 and Quilla 66304) also germinated faster, reaching 50% germination after 9 days compared to 11 and 12 days for the moderately tolerant Lemont and intolerant INIAP12 and IR72, respectively (data not shown). When seedlings that had been germinated at 10 8C were transferred to 30 8C and allowed to grow to the three-leaf stage (V3), the same general trend was observed with CT6748-8-CA-17 and Quilla 66304 having the highest and INIAP12 and IR72 the lowest recovery rates. Lemont consistently showed an intermediate tolerance in all tests (Fig. 1A).

Since the plasma membrane is a known direct site of cold-induced cellular injury, we further examined the extent of cellular leakiness in S3 seedlings after 4-day exposure to 10 8C in order to assess the possible relationship between seedling survival and cold-induced physiological perturbations. The percentage EL values showed a cultivar ranking that was consistent with the ranking based on germination and seedling recovery (Fig. 1B). Analysis of the coldinduced EL of seedlings at three-leaf stage (V3) also showed identical cultivar ranking (data not shown). These results indicate that membrane injury is a critical factor that contributes to poor seedling growth and survival, and that it can be used as a means to assess differential cultivar responses at least during the early stages of seedling establishment. The cultivar ranking based on salt and osmotic-induced membrane leakiness is not consistent with the ranking based on cold-induced membrane leakiness, germination, and seedling survival tests, suggesting that the mechanisms causing membrane injury and the corresponding cellular defenses are not identical for each of the three types of treatments. 3.2. OsLti6a and OsLti6b are cold-regulated membrane protein genes In our previous analysis of 3084 ESTs from cold stressed seedlings of the tolerant line CT6748-8-CA-17, we identi-

Fig. 1. Differential responses of rice cultivars to cold stress. (A) Percentage germination (coleoptile elongation to z0.5 cm) after 12 days (G) and seedling recovery at optimum temperature (R) as measured by the percentage of stressed seedlings that survived and grew to the V3 stage. (B) Membrane injury as a function of electrolyte leakage (EL) before and after stress treatments. In both A and B, the differences in the treatment means (3 replicates) between tolerant and intolerant cultivars are significant (t-test, pV0.05).

M.R. Morsy et al. / Gene 344 (2005) 171–180

fied a number of highly expressed genes (based on relative EST abundance) with similarities to the class of cor/rd genes, which are associated with CA in Arabidopsis and other temperate plants (De los Reyes et al., 2003). Among the cor/rd-related ESTs that we examined, two closely related cDNA classes were confirmed by Northern blot to be highly upregulated at least after 24 h of seedling exposure to 10 8C (Fig. 2). The two cDNAs, OsLti6a and OsLti6b, exhibited tissue-specific differential expression with the former showing high expression only in shoots and the latter in both shoots and roots of cold stressed S3 seedlings. The occurrence of at least two copies of the gene in the rice genome was also indicated by Southern blot analysis of genomic DNA, which had been restricted with enzymes that do not cut internally within the cDNA sequences (data not shown). In order to understand the biochemical function and possible roles of OsLti6a and OsLti6b with respect to the early seedling stage cold tolerance mechanism, their fulllength sequences were characterized. OsLti6a and OsLti6b encode small molecular weight polypeptides of 6.2 and 6.0 kDa, respectively, and which are 85% identical and 92% similar to each other. The genes are highly conserved across evolutionary kingdoms with orthologous copies in a number of plant species (monocots and dicots) as well as lower forms of eukaryotes. The OsLti6a and OsLti6b are most closely related to the Rare Cold Inducible genes, RCI2B and RCI2A, respectively, two Arabidopsis genes that had been previously reported to be developmentally regulated and induced by ABA, cold, osmotic and salt stresses in shoot meristems (Medina et al., 2001). The rice genes also exhibit high similarity with other reported stress-related genes such as the low temperature, dehydration and salt stress-inducible BLT101 from barley (Goddard et al., 1993). A search for conserved sequence motifs in the Cluster of Orthologous Groups (COG) and Conserved Domain Database (CDD; Marchler-Bauer et al., 2003) also showed that both OSLTI6a and OSLTI6b polypeptides have significant similarities with a signature domain of KOG1773.1, UPF0057 and COG0401. This domain is annotated in the

Fig. 2. Organ-specific expression of OsLti6a and OsLti6b as shown by Northern blot analysis on seedlings (S3 stage) after 24 h exposure of the tolerant cultivar CT6748-8-CA-17 to cold stress. C=control (30 8C), Co=cold (10 8C).

175

Fig. 3. (A) Hydropathy plots of the predicted amino acid sequences of OsLTI6a and OSLTI6b polypeptides based on the method of Kyte and Doolittle (1982). Positive plots indicate hybrophobicity. (B) SDS-PAGE profile showing the accumulation of a ~6.0-kDa polypeptide in the membrane protein fraction of shoots from cold stressed seedlings of CT6748-8-CA-17. (C) Western blot showing the ~6.0-kDa polypeptide detected by the OSLTI6a antibody in the membrane protein fraction of cold stressed seedlings. Mem=membrane fraction, Sol=soluble fraction.

CDD database as a common feature among a group of stress-related proteins, with orthologs from S. cerevisiae, Nostoc, Synechocystis and wheat (GenBank accession nos. AY558162,NP442657,AY131234, and AP003594, respectively). Hydropathy analysis of the 56 and 55 amino acid residues of the OSLTI6a and OSLTI6b polypeptides showed calculated pI values of 4.56 and 6.49, respectively. Both polypeptides are highly hydrophobic based on grand average hydropathicity values of 1.51 and 1.42, respectively. Both have two potential transmembrane helices covering most of the polypeptide length without organellar localization signals, indicating that they are localized in the plasma membrane (Fig. 3A). The phenotypic data based on membrane leakiness (Fig. 1B) indicated that the resistance of the plasma membrane to cold-induced destabilization is an important contributing factor to the low temperature tolerance of developing rice seedlings. Given such a relationship, we hypothesized that the products of the cold-inducible OsLti6a and OsLti6b genes may be involved in a mechanism that prevent extensive membrane destabilization during cold stress. To further substantiate the in silico characterization of the polypeptides with experimental evidence, and to demonstrate that the products of these genes are indeed associated with the cell membrane, soluble and membrane protein fractions were isolated

176

M.R. Morsy et al. / Gene 344 (2005) 171–180

from control and cold-germinated seedlings of the tolerant line CT6748-8-CA-17. The protein profile on denaturing SDS-PAGE showed a ~6.0-kDa polypeptide that was relatively more abundant in the membrane fraction of cold stressed seedlings than in the soluble fraction of cold stressed seedlings and absent in both soluble and membrane fractions of control seedlings (Fig. 3B). Immunodetection with polyclonal antibody raised against an antigenic peptide from OSLTI6a showed a ~6.0-kDa band that was detectable only in the membrane fraction of tissues from cold stressed seedlings (Fig. 3C). These results indicate that the product of OsLti6a is an integral membrane protein produced when the seedlings are subjected to suboptimal temperatures. 3.3. Genotype-specific expression and regulation of OsLti6a and OsLti6b Many of the cor/rd genes identified in Arabidopsis are transcriptionally regulated via the CRT/DRE cis-elements, which are recognized by the AP2/EREBP-type of transcription factors known as CBF/DREB (Liu et al., 1998; Stockinger et al., 1997). Because of high similarity of OsLti6a and OsLti6b with Arabidopsis RCI2A and RCI2B, we explored the possibility that their cold-responsive transcription is also regulated via the CBF/DREB pathway. To address this hypothesis, two basic assumptions were considered. First, if both genes are indeed regulated by CBF/DREB-like transcription factors, then their promoters should contain copies of the CBF/DREB target cis-element. Second, given the presence of the CBF/DREB target ciselement in the promoters of OsLti6a and OsLti6b, their cold-induced expression must be temporally synchronized with the expression of their transcriptional activator(s). To obtain information about their genomic sequences, the most current japonica rice genomic sequences in the GenBank were searched for homology with OsLti6a and Oslti6b full-length cDNAs. OsLti6a had perfect matches (evalue=0) with BAC/PAC clones, OJ1136 _ D11 and P0487A05, both located on chromosome-7, while OsLti6b did not yield any hits with perfectly matching sequences. Genomic sequence analysis by GenScan showed that OsLti6a is encoded in identical sequences within nucleotides 2881 to 5160 of OJ1136_D11 and within nucleotides

137,927 to 137,594 of P0487A05. Its open-reading frame is interrupted by a 115-bp intron. The defined regions include at least 1450 bp of upstream regulatory sequences based on the assumed location of the transcription start site (i.e., 5V end of OsLti6a full-length cDNA). The sequence upstream to the TATA box (position 29) of OsLti6a was searched for motifs corresponding to known cis-elements involved in developmental and stress-related responses in plants. Five putative cis-elements were found within the defined regions (Table 1), which include two copies of CRT/DRE and one copy each of ABA-Responsive Element (ABRE) and G-box (Shinozaki and YamaguchiShinozaki, 2000), as-1/ocs-like (Schindler et al., 1992), AtMyb2-like (Martin and Paz-Ares, 1997) and pollenspecific (Weterings et al., 1995) motifs. The CRT/DRE and ABRE are commonly found among cor/rd genes that are regulated either through an ABA-independent (CBF/ DREB) or ABA-dependent pathway, respectively. These results support our hypothesis that the OsLti6 genes are regulated by a mechanism similar to the CBF/DREB regulon in Arabidopsis. The presence of AtMyb2-like and the pollen-specific AAATGA motifs suggest possible developmental regulation via these and perhaps other yet to be identified promoter elements. To address the second assumption about the regulation of OsLti6a and OsLti6b, their temporal expression patterns were investigated in parallel to the rice homologs of Arabidopsis CBF1 and P5CS genes (Fig. 4). The P5CS gene, which encodes an enzyme involved in proline biosynthesis, contains the CRT/DRE cis-element in its promoter and is activated by CBF/DREB transcription factors (Gilmour et al., 2000). Thus, it is a good indicator of the activity of the CBF/DREB genetic circuit. Based on the results of semiquantitative RT-PCR, the cold-induced expression of CBF gene in the tolerant line CT6748-8-CA17 exhibited an early induction (at least 2 h after the imposition of cold stress), followed by a swift decline until it reached a moderately elevated level, which remained steady at least up to 24 h. As expected, the induction of the P5CS gene(s) did not reach its peak until after the maximum expression of CBF was reached 2 h after the imposition of cold stress. As predicted based on the presence of CRT/DRE cis-elements in the promoter of OsLti6a, both OsLti6a and OsLti6b also did not exhibit significant increases in

Table 1 Potential cis-elements in the promoter of OsLti6a encoded by O. sativa ssp. japonica chromosome-7 BAC clone OJ1136_D11 cis-element TATA-box CRT/DRE

Location in promotera

28 to 23 (nt 4303 to 4308) 85 to 77 (nt 4246 to 4254) 1299 to 1291 (nt 3042 to 3050) ABRE 105 to 99 (nt 4226 to 4232) as-1/ocs-like 50 to 46 (nt 4281 to 4285) G-box 54 to 50 (nt 4277 to 4281) AtMyb2-like 256 to 249 (nt 3985 to 3992) Pollen-specific 576 to 571 (nt 3665 to 3670) a Exact nucleotide positions in BAC OJ1136_D11 are given in parenthesis.

Consensus sequence

Transcription factor

TATATA (A/G/T)(A/G)CCGACN(A/T)

RNA Pol II AP2/EREBP (CBF/DREB)

(C/G/T)ACGTG(G/T)(A/C) TGACG CACGTG TAAC(G/C)GT AAATGA

bZIP bZIP, TGA-type bZIP, GBF-type Myb Unknown

M.R. Morsy et al. / Gene 344 (2005) 171–180

Fig. 4. Genotype-dependent temporal expression profiles of OsLti6a and OsLti6b in response to cold (10 8C) and exogenous application of ABA (100 AM). Temporal expression of the cold-regulated CBF/DREB transcription factor and its known downstream target gene (P5CS) are shown to demonstrate the possible dregulator-targetT relationship between the OsLti6 genes and CBF/DREB. Tolerant, CT6748-8-CA-17; Intolerant, INIAP12.

transcript levels until after the CBF gene had reached its highest expression. Although the induction of OsLti6a occurred at least 2 h before OsLti6b, the induction of both genes appeared to be synchronized with the timing of expression of the activator (CBF). Apparently, both OsLti6a and OsLti6b mimicked the general temporal pattern of

177

P5CS expression (relative to the timing of CBF expression), suggesting that they probably share some common pathway of regulation. These results as well as the results of in silico promoter analysis strongly suggest that OsLti6a and OsLti6b are potential components of a cold stress response genetic circuit mediated by CBF/DREB-like transcriptional activators. The gene expression profiles exhibited by the intolerant line INIAP12 are similar to the expression profiles of the tolerant line in the sense that the maximum induction of P5CS, OsLti6a and OsLti6b were all preceded by the induction of CBF expression. However, the intolerant line exhibited a much delayed activation of the gene regulatory circuit, which can be traced back to a much delayed induction of CBF (8 h after imposition of cold stress), resulting in a consequential delay (after 12 h) in the induction of the downstream targets (OsLti6a, OsLti6b, P5CS; Fig. 4). The OsLti6a and OsLti6b were also induced by exogenous application of ABA (100 AM). This result is consistent with the occurrence of a putative ABA-Responsive Element (ABRE) in the promoter of OsLti6a (Table 1). The ABA-induced temporal expression exhibited the same genotype-specific patterns observed during cold stress (Fig. 4), indicating that both ABA-dependent and independent regulatory pathways are involved in the control of OsLti6a and OsLti6b transcription. Because of the significant differences in membrane leakiness due to mannitol and salt treatments among the same group of cultivars examined for cold tolerance (Fig. 1B), the possibility that the osmotic and salt stress regulation of OsLti6a and OsLti6b are also genotype dependent was investigated. Gene expression profiles under these conditions exhibited similar genotype-dependent patterns (Fig. 5). However, the responsiveness of both genes to water deficit and high salt stresses appears to be

Fig. 5. Genotype-dependent temporal expression profiles of OsLti6a and OsLti6b in response to mannitol and salt (NaCl) treatments. Tolerant, CT6748-8-CA17; Intolerant, INIAP12.

178

M.R. Morsy et al. / Gene 344 (2005) 171–180

slower, reflecting a longer time for osmotic and salt stress to exert their effects relative to instantaneous cold exposure.

4. Discussion The low temperature tolerance of plants is governed by quantitative trait loci (QTL; Thomashow, 1999). Based on our previous analysis of rice cold stress ESTs from emerging rice seedlings, we proposed that adaptive responses depend on coordinated expression of many genes, which are probably regulated through a mechanism similar to the cold acclimation genetic circuit (De los Reyes et al., 2003). Given such complexity, future cultivar improvements will require modification of the biochemical repertoire of the cell via this highly coordinated circuit of gene expression. Some of the important prerequisites toward this goal are the identification of individual components of such a complicated circuit, a clear understanding of how each component functions within the circuit, and knowledge about the biochemical roles of each component in the context of cellular defenses against the injurious effects of stress. In our continued effort to address this hypothesis, we characterized a small family of low-temperature-inducible genes, OsLti6a and OsLti6b, which we identified as putative rice homologs of the cor/rd genes based on their homology with Arabidopsis RCI2A and RCI2B and barley BLT101, all of which have been associated with cold acclimation (Medina et al., 2001; Capel et al., 1997; Goddard et al., 1993). The 56 and 55 amino acid residue OSLTI6a and OSLTI6b hydrophobic polypeptides are also highly similar along their entire length to a 60 amino acid length protein domain defined by KOG1773.1, UPF0057, COG0401 (Marchler-Bauer et al., 2003). This domain is highly conserved among a group of stress-related proteins from a diverse group of organisms that include E. coli, S. cerevisiae and a few cyanobacteria. Genetic analysis showed that the S. cereviseae ortholog (PMP3) encodes a 55 amino acid plasma membrane protein, which when mutated by deletion resulted in hyperpolarization of the plasma membrane potential. The mutation led to increased membrane permeability and sensitivity of mutant cell lines to cytotoxic cations, such as Na+ and Hygromycin-B (Navarre and Goffeau, 2000). These results indicate that OSLTI6a and OSLTI6b belong to an evolutionarily conserved class of low-molecular-weight stress proteins. The two paralogous copies diverged from each other through the acquisition of organ-specific regulation. Kratsch and Wise (2000) established that low temperatures trigger abnormal function of the cell membrane by causing various forms of conformational changes to the lipid bilayer, from flexible liquid-crystalline to solid gel phase. Depending on the degree of stress (chilling or freezing) and sensitivity of the plant, membrane lipid conformational changes often lead to increased permeability and leakage of intracellular solutes (Uemura and Steponkus,

1997), with consequential metabolic disorders leading to accumulation of toxic metabolites and reactive oxygen species (Nishida and Murata, 1996). The fact that RCI2A from Arabidopsis was able to complement the PMP3 mutation in yeast provides strong evidence that other plant orthologs, including OsLti6a and OsLti6b, probably share a common function through their ability to protect the plasma membrane during low temperature, dehydration and highsalt conditions (Navarre and Goffeau, 2000). Thus, OsLti6a and OsLti6b are components of a complex biochemical process that maintains membrane integrity under stress conditions. In this study, we further substantiated the previous bioinformatic characterization of the plant orthologs with actual biochemical evidence of the functional location of the rice proteins in the cell membrane. Based on protein profiles and immunoblot analyses, the ~6.2-kDa OSLTI6a protein was found to accumulate in the membrane fraction of the tolerant rice line during cold stress but not under optimum temperature. These confirmatory findings about the critical membrane-associated role of OSLTI6 established the basis for further investigation of the extent to which their expression contributes to genotypic variation in early seedling stage cold tolerance. One of the two important findings of this study is the cultivar-specific temporal expression profiles of OsLti6a and OsLti6b and their correspondence with the degree of plasma membrane leakiness under cold stress. This correlation might be extrapolated to a possible consequential increase in growth and development of seedlings that are otherwise stressed by suboptimal temperature conditions. In a similar study involving the responses of rice to salt stress, Kawasaki et al. (2001) proposed that the timing and duration of expression of critical genes differentiate tolerant from intolerant genotypes, and that any delay in the activation of early response genes have consequential negative effects on the plant’s ability to recover from the stress. Given the membrane-stabilizing function of the OsLti6a and OsLti6b genes and their interesting correlation with membrane leakiness, it then becomes possible to make some inferences about their importance to seedling cold tolerance in terms of a possible dcause and effectT type of relationship. For instance, there is at least an 8-h difference in the timing of OsLti6a and OsLti6b induction between CT6748-8-CA-17 (tolerant) and INIAP12 (intolerant), with the tolerant line exhibiting a more rapid (earlier) induction than the intolerant line. Thus, the observed differences in cold sensitivity among the cultivars studied appear to be due at least in part to the fact that membrane leakiness occurs later in the tolerant line because of the more rapid synthesis of proteins with protective roles (including the OSLTI6 proteins among others). On the other hand, membrane leakiness is much more severe in the intolerant line because of the delayed synthesis of protective proteins, perhaps contributing to other events that lead to more irreversible forms of injury (Nishida and Murata, 1996). Interestingly,

M.R. Morsy et al. / Gene 344 (2005) 171–180

our analysis of BAC OJ1136_D11 indicated that OsLti6a is located on chromosome-7, where a QTL contributing to seedling cold tolerance and vigor has been identified previously (Redona and Mackill, 1996). The determination of the exact physical location of this QTL relative to the location of OSLti6a on chromosome-7 will determine if there is any link between this QTL and OsLti6a. The stress response mechanism involves a battery of genes with direct biochemical roles in cellular defenses under the control of stress-responsive transcriptional activators (Fowler and Thomashow, 2002; Thomashow, 1999). The second important finding of this study provides an insight into the possible mechanism by which the expression of OsLti6a and OsLti6b are integrated with the cold stress response genetic circuit. The OsLti6a promoter contains motifs that possibly function as CRT/DRE and ABRE ciselements, similar to those found in many cor/rd genes (Shinozaki and Yamaguchi-Shinozaki, 2000). The occurrence of these motifs is consistent with their cold, dehydration, salt and ABA-responsive expression. More importantly, the occurrence of the CRT/DRE suggests that, as in cold acclimating plants, many genes that function in preventing membrane injury in nonacclimating plants are regulated by a CBF/DREB-type transcription factor. Parallel analysis of the cold-induced temporal expression profiles of OsLti6a and OsLti6b with a putative ortholog of the Arabidopsis CBF/DREB and one of its known downstream targets, P5CS, is consistent with the occurrence of the CRT/DRE in OsLti6a promoter sequence (Gilmour et al., 2000). The temporal expression profiles showed that the activation of the targets (OsLti6a, OsLti6b, P5CS) was synchronized with the timing of expression of the regulator (CBF/DREB) in both the tolerant and intolerant genotypes. However, activation of the transcriptional cluster in the intolerant genotype exhibited a delayed response relative to the tolerant genotype, suggesting that timely activation of downstream defense genes, such as OsLti6a and OsLti6b, is contingent upon early activation of CBF/DREB. The induction of OsLti6a and OsLti6b within the first 24 h also suggests that they are part of the plant’s immediate defenses, which prevent or delay the progression of other more serious physiological perturbations that can lead to irreversible injuries (Kawasaki et al., 2001). In silico analysis of the OsLti6a promoter indicated the occurrence of three potential cis-elements, AtMyb2-like, as1/ocs-like and AAATGA (a.k.a. pollen specific element), that may be involved in developmental regulation (Martin and Paz-Ares, 1997; Weterings et al., 1995; Schindler et al., 1992). The role of these elements can be the subject of future investigation given the importance of the integrated stress and developmental responses in the expression of seedling vigor under suboptimal conditions (Medina et al., 2001). By integrating our current transcriptional, physiological and biochemical data with other available information about the OsLti/RCI2/BLT101/PMP3 group of orthologous genes, we can conclude that OsLti6a and OsLti6b contribute to

179

biochemical processes involved in preserving the integrity of the plasma membrane during cold stress. Direct biochemical evidence of such role can be established through the analysis of mutants or transgenic lines. Nevertheless, given the apparent dependence of Oslti6a and OsLti6b induction on CBF/DREB-related transcriptional activators and the genetic and biochemical complexity of cold stress response mechanism, this small gene family appears to be part of a battery of defense-related genes that are regulated in concert by a common switch. Identification of other functionally related genes will contribute to the understanding of the genetic circuit integrating cold stress and developmental processes.

Acknowledgements This project was supported by the Arkansas Rice Research and Promotion Board and University of Arkansas-Division of Agriculture. SJY was supported by the Ministry of Science and Technology and Rural Development Administration of the Republic of Korea (CG3214). We thank Drs. M. Rumpho and M. Davis for reading the manuscript.

References Capel, J., Jarillo, J.A., Salinas, J., Martinez-Zapater, J.M., 1997. Two homologous low temperature inducible genes from Arabidopsis encode highly hydrophobic proteins. Plant Physiol. 115, 569 – 576. De los Reyes, B.G., McGrath, J.M., 2003. Cultivar-specific seedling vigor and expression of a putative oxalate oxidase germin-like protein in sugar beet (Beta vulgaris L.). Theor. Appl. Genet. 107, 54 – 61. De los Reyes, B.G., Morsy, M., Gibbons, J., Varma, T.S.N., Antoine, W., McGrath, J.M., Halgren, R., Redus, M., 2003. A snapshot of the cold stress transcriptome of developing rice seedlings (Oryza sativa L.) via ESTs from subtracted cDNA library. Theor. Appl. Genet. 107, 1071 – 1082. Dipiero, S., Leonardis, S.D., 1997. The ascorbate system and lipid peroxidation in stored potato (Solanum tuberosum L.) tubers. J. Exp. Bot. 48, 779 – 783. Dubouzet, J.G., Sakuma, Y., Ito, Y., Kasuga, M., Dubouzet, E.G., Miura, S., Seki, M., Shinozaki, K., Yamaguchi-Shinozaki, Y., 2003. OsDREB genes in rice, Oryza sativa L., encode transcription activators that function in drought, salt, and cold-responsive gene expression. Plant J. 33, 751 – 763. Fowler, S., Thomashow, M.F., 2002. Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14, 1675 – 1690. Gilmour, S.J., Sebolt, A.M., Salazar, M.P., Everard, J.D., Thomashow, M.F., 2000. Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol. 124, 1854 – 1865. Goddard, N.J., Dunn, M.A., Zhang, L., White, A.J., Jack, P.L., Hughes, M.A., 1993. Molecular analysis and spatial expression pattern of a low temperature-specific barley gene, blt101. Plant Mol. Biol. 23, 871 – 879. Jaglo, K.R., Kleff, S., Amundsen, K.L., Zhang, X., Haake, V., Zhang, J.Z., Deits, T., Thomashow, M.F., 2001. Components of the Arabidopsis C-repeat/dehydration-responsive element binding factor

180

M.R. Morsy et al. / Gene 344 (2005) 171–180

cold-response pathway are conserved in Brassica napus and other plant species. Plant Physiol. 127, 910 – 917. Kawasaki, S., Borchert, C., Deyholos, M., Wang, H., Brazille, S., Kawai, K., Galbraith, D., Bohnert, H.J., 2001. Gene expression profiles during the initial phase of salt stress in rice. Plant Cell 13, 889 – 905. Kratsch, H.A., Wise, R.R., 2000. The ultrastructure of chilling stress. Plant Cell Environ. 23, 337 – 350. Kyte, J., Doolittle, R.F., 1982. A simple method for displaying hydrophatic character of a protein. J. Mol. Biol. 157, 105 – 132. Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., YamaguchiShinozaki, K., Shinozaki, K., 1998. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low temperatureresponsive gene expression, respectively in Arabidopsis. Plant Cell 10, 1391 – 1406. Marchler-Bauer, A., et al., 2003. CDD: a curated Entrez database of conserved domain alignments. Nucleic Acids Res. 31, 383 – 387. Martin, C., Paz-Ares, J., 1997. MYB transcription factors in plants. Trends Genet. 13, 67 – 73. Medina, J., Catala, R., Salinas, J., 2001. Developmental and stress regulation of RCI2A and RCI2B, two cold-inducible genes of Arabidopsis encoding highly conserved hydrophobic proteins. Plant Physiol. 125, 1655 – 1666. Miquel, M., James Jr., D., Dooner, H., Browse, J., 1993. Arabidopsis requires polyunsaturated lipids for low temperature survival. Proc. Natl. Acad. Sci. U. S. A. 90, 6208 – 6212. Navarre, C., Goffeau, A., 2000. Membrane hyperpolarization and salt sensitivity induced by deletion of PMP3, a highly conserved small protein of yeast plasma membrane. EMBO J. 19, 2515 – 2524. Nishida, I., Murata, N., 1996. Chilling sensitivity in plants and Cyanobacteria: the crucial contribution of membrane lipids. Annu. Rev. Plant Physiol. Plant Mol. Biol. 47, 541 – 568.

Redona, E.D., Mackill, D.J., 1996. Mapping quantitative trait loci for seedling vigor in rice using RFLPs. Theor. Appl. Genet. 92, 395 – 402. Schindler, U., Beckmann, H., Cashmore, A.R., 1992. TGA1 and G-box binding factors: two distinct classes of Arabidopsis leucine zipper proteins compete for the G-box like element TGACGTGG. Plant Cell 4, 1309 – 1319. Shinozaki, K., Yamaguchi-Shinozaki, K., 2000. Molecular responses to dehydration and low temperature: differences and cross-talk between two stress signaling pathways. Curr. Opin. Plant Biol. 3, 217 – 223. Steponkus, P.L., Uemura, M., Joseph, R.A., Gilmour, S.J., Thomashow, M.F., 1998. Mode of action of the COR15a gene on the freezing tolerance of Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 95, 14570 – 14575. Stockinger, E.J., Gilmour, S.J., Thomashow, M.F., 1997. Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcription activator element that binds to the C-repeat/DRE, a cis-acting regulatory element that stimulates transcription in response to low temperature and water deficit. Proc. Natl. Acad. Sci. U. S. A. 94, 1035 – 1040. Thomashow, M.F., 1999. Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 571 – 599. Uemura, M., Steponkus, P.L., 1997. A contrast of the plasma membrane lipid composition of oat and rye leaves in relation to freezing tolerance. Plant Physiol. 104, 479 – 496. Weterings, K., Schrauwen, J., Wullems, G., Twell, D., 1995. Functional dissection of the promoter of the pollen-specific gene NTP303 reveals a novel pollen-specific, and conserved cis-regulatory element. Plant J. 8, 55 – 63. Worral, D., Elias, L., Ashford, D., Smallwood, M.C.S., Lillfors, P., Telford, J., Holt, C., Bowles, D., 1998. A carrot leucine-rich-repeat protein in plants inhibits ice recrystallization. Science 282, 115 – 117.