The osteogenic activity of human mandibular fracture haematoma-derived cells is stimulated by low-intensity pulsed ultrasound in vitro

Int. J. Oral Maxillofac. Surg. 2014; 43: 367–372 http://dx.doi.org/10.1016/j.ijom.2013.07.746, available online at http://www.sciencedirect.com

Research Paper Trauma

The osteogenic activity of human mandibular fracture haematoma-derived cells is stimulated by low-intensity pulsed ultrasound in vitro

Y. Imai1, T. Hasegawa1, D. Takeda1, M. Akashi1, S. Y. Lee2, T. Niikura2, Y. Shibuya1, M. Kurosaka2, T. Komori1 1

Department of Oral and Maxillofacial Surgery, Kobe University Graduate School of Medicine, Kobe, Japan; 2Department of Orthopedic Surgery, Kobe University Graduate School of Medicine, Kobe, Japan

Y. Imai, T. Hasegawa, D. Takeda, M. Akashi, S. Y. Lee, T. Niikura, Y. Shibuya, M. Kurosaka, T. Komori: The osteogenic activity of human mandibular fracture haematoma-derived cells is stimulated by low-intensity pulsed ultrasound in vitro. Int. J. Oral Maxillofac. Surg. 2014; 43: 367–372. # 2013 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved. Abstract. Low intensity pulsed ultrasound (LIPUS) stimulation is a clinically established treatment method used to accelerate long bone fracture healing; however, this method is currently not applied to mandibular fractures. In this study, we investigated the effects of LIPUS on human mandibular fracture haematomaderived cells (MHCs) in order to explore the possibility of applying LIPUS treatment to mandibular fractures. MHCs were isolated from five patients. The cells were divided into two groups: (1) LIPUS (+) group: MHCs cultured in osteogenic medium with LIPUS treatment; and (2) LIPUS () group: MHCs cultured in osteogenic medium without LIPUS treatment. The osteogenic differentiation potential and proliferation of the MHCs were compared between the two groups. The waveform used was equal to the wave conditions of a clinical fracture healing system. The gene expression levels of ALP, OC, Runx2, OSX, OPN, and PTH-R1 and mineralization were increased in the LIPUS (+) group compared to the LIPUS () group. There were no significant differences in cell proliferation between the two groups. These findings demonstrate the significant effects of LIPUS on the osteogenic differentiation of MHCs. This study provides significant evidence for the potential usefulness of the clinical application of LIPUS to accelerate mandibular fracture healing.

Mandibular fractures are the second most common fracture of the facial bones. Thousands of mandibular fractures occur annually in the USA.1 It is well known that 0901-5027/030367 + 06 $36.00/0

the mandible is an intramembranous bone in embryology, and that the mandibular fracture healing process involves intramembranous ossification without cartilage

Key words: mandibular fracture; haematoma; low intensity pulsed ultrasound (LIPUS); osteogenic activity. Accepted for publication 18 July 2013 Available online 20 August 2013

formation.2–4 Following intramembranous bone fractures, mesenchymal cells from the periosteum differentiate directly into osteoblasts; these form osteoid tissue,

# 2013 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

368

Imai et al.

which is subsequently mineralized.5 Of interest, several investigators have reported the presence of cartilage formation, namely endochondral ossification, during the healing of mandibular fractures.5,6 Though it is not clear whether or not cartilage formation occurs, mandibular healing is mainly intramembranous ossification. It is known that the fracture haematoma plays an important role in fracture healing. Mizuno et al. have reported that the fracture haematoma has inherent osteogenic potential, which contributes significantly to the healing of long bone fractures.7 Grundnes and Reikeras have reported that the removal of an organized haematoma some days after fracture impairs bone healing.8 In our previous study, we demonstrated that hematomas found at a long bone fracture site contain multi-lineage mesenchymal progenitor cells (long bone fracture haematoma-derived cells; LBHCs), and suggested that the haematoma could be involved in both endochondral and intramembranous ossification.9,10 Recently, we reported that cells isolated from a mandibular fracture haematoma (mandibular fracture haematoma-derived cells; MHCs) have osteogenic differentiation capacity, and suggested the contribution to intramembranous bone healing. We also demonstrated that the chondrogenic potential of MHCs is inferior to that of long bone bone-marrow stromal cells (BMSCs). These findings indicate that MHCs could be a local reservoir and source of osteogenic progenitors involved in the intramembranous ossification process of mandibular fractures.11 Low intensity pulsed ultrasound (LIPUS) is mechanical stimulation that can be transmitted into biological tissues as high-frequency acoustic pressure waves. It has generally been recognized that the micromechanical strains generated by these pressure waves evoke biochemical events that can regulate fracture healing.12,13 LIPUS stimulation is a clinically established, widely used, and US Food and Drug Administration (FDA) approved intervention for accelerating bone formation during the healing of long bone fractures and non-unions.13–15 Although there have been many animal studies investigating the effects of LIPUS on mandibular fractures, as well as on distraction osteogenesis, there is currently no clinical adaptation of the use of LIPUS for mandibular fractures.16–18 LIPUS has been shown to stimulate the osteogenic differentiation of a variety of cells including BMSCs, periosteal cells, and osteoblasts in vitro.19–21 In

our previous study, the osteogenic differentiation capacity was increased when LBHCs were exposed to LIPUS.22,23 It is known that the fracture healing process differs between long bones (endochondral and intramembranous ossification) and mandibular bones (mainly intramembranous ossification). To date, there have been no studies investigating the effect of LIPUS on MHCs. We report herein our investigation of the effect of LIPUS on MHCs in order to explore the possibility of applying LIPUS treatment to mandibular fractures, based on our hypothesis that the osteogenic activity of MHCs would be increased by LIPUS. Methods

Specimens of mandibular fracture hematomas were obtained from five patients with a mean age of 26.4 years (range 15–65 years) during osteosynthesis, at a mean of 4 days (range 1–7 days) after injury. In the delayed case, we spent time scrutinizing the patient’s general condition prior to treatment. This delay was not due to the study. The fracture involved the median mandible in three patients and the mandibular body in the other two. Patients taking anticoagulants, steroids, or nonsteroidal anti-inflammatory drugs within 3 months before the injury were excluded. This study had ethics committee approval, and informed consent was obtained from all of the patients. Isolation and culture of MHCs

MHCs were isolated and cultured as described previously.11 Briefly, the fracture haematoma that had formed fibrin clots was removed manually before any manipulation or irrigation, and was placed in a sterile polypropylene container in order to avoid contamination during the operation. The mean wet weight of the hematomas obtained was 1.03 g (range 0.30–1.94 g). Specimens were cut into small pieces with a scalpel in growth medium, a-modified minimum essential medium (Sigma, St. Louis, MO, USA), containing 10% heat-inactivated foetal bovine serum (Sigma), 2 mmol/l L-glutamine (Gibco BRL, Grand Island, NY, USA), and antibiotics. The cultures were incubated in growth medium at 37 8C with 5% humidified carbon dioxide. Approximately 2–3 weeks later, the adherent cells were harvested with 0.05% trypsin containing 0.02% ethylenediaminetetraacetic acid (EDTA; Wako, Osaka, Japan) and were passaged into flasks. Cells that had

undergone one to three passages were used in the subsequent assays. LIPUS treatment

We used a LIPUS exposure device (Teijin Pharma Ltd, Tokyo, Japan) that was adapted for a six-well tissue – cell culture plate in the in vitro experiments.22–24 This was set at a 1.5 MHz wave with a pulse duration of 200 ms, a repeating pulse at 1 kHz, and an intensity of 30 mW/cm.2 This waveform is equal to the wave conditions of a sonic-accelerated fracture healing system (SAFHS; Teijin Pharma Ltd). Briefly, 5  104 MHCs per well were seeded into a six-well plate until they reached subconfluence. The medium was replaced with fresh osteogenic medium consisting of the growth medium, 10 mM b-glycerophosphate (Sigma), and 50 mg/ml of ascorbic acid. The culture plate was then placed on the ultrasound transducer with a thin layer of water to maintain contact. In the LIPUS treatment group (LIPUS (+) group), LIPUS was applied through the bottom of the culture plates for 20 min daily at 37 8C. Cells without LIPUS stimulation served as a control group (LIPUS () group). Cell proliferation

A total of 5  104 MHCs per well was seeded into a six-well plate and stationary cultured for 3 days. LIPUS stimulation was applied according to the protocol described, for 4 or 8 days. The growth medium was used for both groups. MHCs were detached using 0.05% trypsin with 0.02% EDTA. The number of MHCs was counted twice using a hemocytometer (Bio-Rad Laboratories Japan, Tokyo, Japan) and the mean number was calculated. The cell viability was found to be >99% by Trypan Blue dye (Gibco BRL) exclusion technique. The results are presented as the relative percentages of the total number of viable cells compared with day 0 (considered to be 100%). Total RNA extraction and real-time polymerase chain reaction (PCR) analysis

Total RNA was extracted from the harvested cells on days 0, 4, 8, 14, and 20 at 1 h after the LIPUS or sham treatment, using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer’s instructions. Total RNA was reverse-transcribed into single-stranded cDNA using a high-capacity cDNA reverse transcription kit (Applied

LIPUS and osteogenic activity of MHCs Table 1. Details of the primers used for amplification. Forward: 50 CCCAAAGGCTTCTTCTTG 30 Alkaline phosphatase Reverse: 50 CTGGTAGTTGTTGTGAGC 30

Results Proliferation

Osteocalcin

Forward: 50 TCACACTCCTCGCCCTATTGG 30 Reverse: 50 GGGCAAGGGGAAGAGGAAAGA 30

Runt-related gene 2

Forward: 50 TCCACACCATTAGGGACCATC 30 Reverse: 50 TGCTAATGCTTCGTGTTTCCA 30

Osterix

Forward: 50 GTCAAGAGTCTTAGCCAAACTC 30 Reverse: 50 AAATGATGTGAGGCCAGATGG 30 0

0

Parathyroid hormone receptor 1

Forward: 5 CTCCCGTTCACGAGTCTCAT 3 Reverse: 50 AGGCCAGCCAGCATAATGGAA 30

Osteopontin

Forward: 50 GGCTAAACCCTGACCCATCTC 30 Reverse: 50 TCATTGCTCTCATCATTGGCT 30

Glyceraldehyde-3-phosphate dehydrogenase

Forward: 50 CCACCCATGGCAAATTCCATGG 30 Reverse: 50 TCTAGACGGCAGGTCAGGTCCA 30

Biosystems, Foster City, CA, USA). The expression levels of the osteoblast-related genes alkaline phosphatase (ALP), osteocalcin (OC), runt-related gene 2 (Runx2), osterix (OSX), osteopontin (OPN), and parathyroid hormone receptor 1 (PTHR1) were measured by real-time PCR. The real-time PCR was performed in duplicate using an ABI PRISM 7700 Sequence Detection System and SYBR Green reagents (Applied Biosystems, Foster City, CA, USA) following the recommended protocols. In all of the real-time PCR analyses, the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was used to monitor RNA loading. The primers used for amplification are shown in Table 1. Expression levels of all genes were normalized to GAPDH levels and expressed relative to the day 0 control culture levels (DDCT method; Applied Biosystems).25 Then, the levels of mRNA expression were compared between the LIPUS (+) and LIPUS () groups. The expression levels were expressed as the relative fold increase compared to the day 0 control levels.

369

Mineralization assay

On day 20, cells were fixed for 1 h at room temperature in 95% ethanol. The plates were then stained with 1% Alizarin Red S (Hartman-Leddon, Philadelphia, PA, USA) at pH 4.0 for 5 min, washed with water, and dried. The Alizarin Red S stain was released from the cell matrix by incubation in 10% ethylpyridinium chloride for 15 min, with the development of red staining indicating a positive result. The amount of dye released was quantified by spectrophotometry at 562 nm.22,24 The intensity of staining was expressed relative to the intensity levels in the LIPUS () group on day 20.

There was no significant difference in the total number of cells in the LIPUS (+) and LIPUS () groups after 4 or 8 days of treatment (Fig. 1). Gene expression

The expression level of ALP mRNA in LIPUS (+) cells was significantly upregulated compared to the LIPUS () group on days 14 (P < 0.01) and 20 (P < 0.01). The level of OC mRNA in the LIPUS (+) group was significantly upregulated compared to the LIPUS () group on days 14 (P < 0.05) and 20 (P < 0.01). The levels of Runx2 and OSX mRNA in the LIPUS (+) group were significantly higher than those in the LIPUS () group on day 4 (P < 0.05). The OPN mRNA level in the LIPUS (+) group was significantly higher compared to the LIPUS () group on day 20 (P < 0.01). The level of PTH-R1 mRNA in the LIPUS (+) cells was significantly upregulated compared to the LIPUS () group on days 14 (P < 0.05) and 20 (P < 0.01) (Fig. 2). Mineralization

The intensity of the Alizarin Red S staining of MHCs in the LIPUS (+) group was significantly higher than that in the LIPUS () group on day 20 (P < 0.05) (Fig. 3).

Statistical analysis

Discussion

The data are presented as the means and standard errors (SE). The Mann–Whitney U-test was used to assess the differences in the means between the LIPUS () and LIPUS (+) groups at each time point. A P-value of <0.05 was considered to be statistically significant.

This is the first study to demonstrate that the osteogenic activity of MHCs is increased by LIPUS treatment in vitro. We found that the expression levels of osteoblast-related genes were significantly upregulated and that mineralization was increased by LIPUS treatment, while the cell proliferation was unaffected by LIPUS treatment. These findings are consistent with those for LBHCs reported in our previous study.22 There have been numerous reports about the effects of LIPUS in vitro. For example, LIPUS has been shown to increase the mRNA levels of OPN and Runx2 in CD1 mouse osteoblasts.26 LIPUS stimulation directly affects osteogenic cells, leading to enhanced mineralization, collagen production, and ALP activity in osteoblastic cells.27,28 Other experiments have shown the upregulation of osteogenic activity in animal and human cells.16,17 LIPUS can increase the osteogenic differentiation of human mesenchymal stem cells (hMSCs), and the expression levels of osteogenic

Fig. 1. Bar chart showing the proliferation of MHCs on days 4 and 8, relative to the day 0 group. The results are presented as the relative percentages of the total number of viable cells compared with the day 0 group (NS, not significant).

370

Imai et al.

Fig. 2. Bar charts showing the results of the real-time PCR analysis of gene expression in the LIPUS (+) and LIPUS () groups from five patients on days 4, 8, 14, and 20. The results shown are for (a) alkaline phosphatase (ALP), (b) osteocalcin (OC), (c) runt-related gene 2 (Runx2), (d) osterix (OSX), (e) osteopontin (OPN), and (f) parathyroid hormone receptor 1 (PTH-R1). *P < 0.05, **P < 0.01.

markers, Runx2 and ALP.29 In agreement with these publications, we have previously reported that the osteogenic activity of LBHCs is increased by LIPUS treatment.22 There was no significant difference in the total number of cells in the LIPUS (+) group compared with the LIPUS () group, indicating that LIPUS did not affect cell proliferation. Some reports have indicated that LIPUS affects the proliferation of osteoblasts.20,30 By contrast, others have indicated that LIPUS affects mainly cell differentiation rather than cell proliferation in human progenitor cells.22–24,31 In our study, we demonstrated that LIPUS affects differentiation more than proliferation in MHCs. Although the mechanism is still under investigation, there have been several reports about the mechanisms underlying the positive effects of LIPUS on osteogenic differentiation. Parvizi et al. showed

that the stimulation of bone healing was a result of an increase in LIPUS-induced intracellular Ca2+ that occurs within seconds after LIPUS stimulation.32 Wang et al. reported that BMSCs responded to pulsed acoustic energy by increasing the extracellular signal-regulated kinase phosphorylation and enhancing osteogenic activity.33 Bandow et al. reported that the expression of osteogenic markers is increased through the angiotensin 1 receptor, known as a cardiomyocyte mechanoreceptor in osteoblasts.34 In our previous study, we demonstrated that osteogenic differentiation of MHCs is promoted by the upregulation of Runx2 and OSX after LIPUS treatment. There have been some in vivo studies using LIPUS in mandibular fractures in animals.16–18,35 LIPUS has been reported to improve mandibular fracture healing and distraction osteogenesis. Erdogan

et al. showed that LIPUS improves the bone healing after mandibular fracture in rabbits.16 The three-point bending test, digital radiodensitometric analysis, and histological and histomorphometric examinations were performed on harvested hemimandibles, which confirmed the positive effect of LIPUS treatment. Although the setting of ultrasound treatment is different from that of LIPUS, Fedotov et al. reported that ultrasound treatment (0.2– 0.6 W/cm2, 5 min per day for 8 days) improves the healing of rabbit mandibular fractures.18 El-Bialy et al. applied LIPUS to the distracted mandible of rabbits and reported that LIPUS has a significantly positive effect on bone regeneration in distraction osteogenesis.17,35 Ding et al. and Xie et al. reported that LIPUS could accelerate bone formation during mandibular distraction osteogenesis and increase the bone mineral density.36,37 Wu et al.

LIPUS and osteogenic activity of MHCs

371

Patient consent

Informed consent was obtained from all the patients. Acknowledgement. The authors wish to thank Ms M. Nagata (Department of Orthopaedic Surgery, Kobe University Graduate School of Medicine) for excellent technical assistance.

References

Fig. 3. Upper panel: bar chart showing the intensity of Alizarin Red S staining of cells in LIPUS (+) and LIPUS () from five patients at day 20; *P < 0.05. Lower panel: representative photographs of the Alizarin Red S staining at day 20. The intensity of staining in the samples was expressed relative to the intensity levels in the LIPUS () group at day 20.

reported that the LIPUS irradiation of acute horizontal alveolar bone defects in the mandibular pre-molar areas of Beagle dogs has the potential to improve their recovery.38 Jiang et al. reported that LIPUS also has the potential to promote the repair of periodontal bone defects.39 These reports may support our in vitro results. The expression levels of osteogenic markers, such as ALP and fibroblast growth factor 23, have recently been shown to be upregulated by LIPUS treatment in mouse mandibular osteoblasts in vitro.40 However, the cells used in this previous report were not derived from a human mandibular fracture site. On the other hand, our present results reveal that the osteogenic differentiation of cells actually isolated from a human mandibular fracture site is promoted by LIPUS treatment. Mathog et al. reported the rate of nonunion after the treatment of a mandibular fracture to be 2.8%.41 This overall rate is similar to that reported in similar studies by Haug and Schwimmer (3.2%) and Bochlogyros (3.9%).42,43 The patients who developed non-union were almost always retreated with fixation by surgery.41 Haug and Schwimmer reported

that this secondary treatment of non-union cases was generally performed using reconstruction plates and external pin fixation or other modalities.42 The surgical approach may lead to morbidity for the patients. This study suggests that LIPUS might accelerate mandibular fracture healing, and might help patients avoid surgery. This study provides significant evidence for the potential usefulness of the clinical application of LIPUS to accelerate mandibular fracture healing. The use of LIPUS should be encouraged to improve clinical outcomes in the treatment of mandibular fractures. Funding

This work was supported by a grant from Daiwa Securities Co. Ltd (No. 2318 to TH). Competing interests

None declared. Ethical approval

The Ethics Committee of Kobe University Hospital approved this study.

1. Nalliah RP, Allareddy V, Kim MK, Venugopalan SR, Gajendrareddy P, Allareddy V. Economics of facial fracture reductions in the United States over 12 months. Dent Traumatol 2012;10:1111. 2. Heptenstall RB. Fracture treatment and healing. Philadelphia: WB Saunders; 1982: 35. 3. Alberius P, Johnell O. Repair of intra-membranous bone fractures and defects in rats. Immunolocalization of bone and cartilage proteins and proteoglycans. J Craniomaxillofac Surg 1991;19:15. 4. Radden BG, Fullmer HM. Morphological and histochemical studies of bone repair in the rat. Arch Oral Biol 1969;14:1243. 5. Craft PD, Mani MM, Pazel J, Masters FW. Experimental study of healing in fractures of the membranous bone. Plast Reconstr Surg 1974;53:321. 6. Granstro¨m G, Nilsson LP. Experimental mandibular fracture: studies on bone repair and remodellation. Scand J Plast Reconstr Surg Hand Surg 1987;21:159. 7. Mizuno K, Mineo K, Tachibana T, Sumi M, Matsubara T, Hirohata K. The osteogenic potential of fracture haematoma: subperiosteal and intramuscular transplantation of the haematoma. J Bone Joint Surg Br 1990;72: 822. 8. Grundnes O, Reikeras O. The importance of the haematoma for fracture healing in rats. Acta Orthop Scand 1993;64:340. 9. Oe K, Miwa M, Sakai Y, Lee SY, Kuroda R, Kurosaka M. An in vitro study demonstrating that haematomas found at the site of human fractures contain progenitor cells with multilineage capacity. J Bone Joint Surg Br 2007;89:133. 10. Koga T, Niikura T, Lee SY, Dogaki Y, Okumachi E, Nishida K, et al. In vitro hypertrophy and calcification of human fracture hematoma-derived cells in chondrogenic differentiation. Int Orthop 2013;37:961–7. 11. Hasegawa T, Miwa M, Sakai Y, Niikura T, Lee SY, Oe K, et al. Mandibular hematoma cells as a potential reservoir for osteoprogenitor cells in fractures. J Oral Maxillofac Surg 2012;70:599. 12. Rubin C, Bolander M, Ryaby JP, Hadjiargyrou M. The use of low-intensity ultrasound to accelerate the healing of fractures. J Bone Joint Surg Am 2001;83:259.

372

Imai et al.

13. Claes L, Willie B. The enhancement of bone regeneration by ultrasound. Prog Biophys Mol Biol 2007;93:384–98. 14. Kristiansen TK, Ryaby JP, McCabe J, Frey JJ, Roe LR. Accelerated healing of distal radial fractures with the use of specific, low-intensity ultrasound. A multicenter, prospective, randomized, double-blind, placebo-controlled study. J Bone Joint Surg 1997; 79:961–73. 15. Watanabe Y, Matsushita T, Bhandari M, Zdero R, Schemitsch EH. Ultrasound for fracture healing: current evidence. J Orthop Trauma 2010;24:56–61. 16. Erdogan O, Esen E, Ustu¨n Y, Ku¨rkc¸u¨ M, Akova T, Go¨nlu¨s¸en G, et al. Effects of lowintensity pulsed ultrasound on healing of mandibular fractures: an experimental study in rabbits. J Oral Maxillofac Surg 2006;64: 180–8. 17. El-Bialy T, Uludag H, Jomha N, Badylak SF. In vivo ultrasound-assisted tissue-engineered mandibular condyle: a pilot study in rabbits. Tissue Eng Part C Methods 2010;16: 1315–23. 18. Fedotov SN, Minin EA, Borisov IN. Effect of local cooling and ultrasound on the reparative processes following mandibular fracture. Stomatologiia (Mosk) 1986;65:4. 19. Kokubu T, Matsui N, Fujioka H, Tsunoda M, Mizuno K. Low intensity pulsed ultrasound exposure increases prostaglandin E2 production via the induction of cyclooxygenase-2 mRNA in mouse osteoblasts. Biochem Biophys Res Commun 1999;256:284–7. 20. Leung KS, Cheung WH, Zhang C, Lee KM, Lo HK. Low intensity pulsed ultrasound stimulates osteogenic activity of human periosteal cells. Clin Orthop Relat Res 2004; 418:253–9. 21. Sena K, Angle SR, Kanaji A, Aher C, Karwo DG, Sumner DR, et al. Low-intensity pulsed ultrasound (LIPUS) and cell-to-cell communication in bone marrow stromal cells. Ultrasonics 2011;51:639–44. 22. Hasegawa T, Miwa M, Sakai Y, Niikura T, Kurosaka M, Komori T. Osteogenic activity of human fracture haematoma-derived progenitor cells is stimulated by low-intensity pulsed ultrasound in vitro. J Bone Joint Surg Br 2009;91:264–70. 23. Lee SY, Koh A, Niikura T, Oe K, Koga T, Dogaki Y, et al. Low-intensity pulsed ultrasound enhances BMP-7-induced osteogenic differentiation of human fracture hematomaderived progenitor cells in vitro. J Orthop Trauma 2013;27:29–33.

24. Koga T, Lee SY, Niikura T, Koh A, Dogaki Y, Okumachi E, et al. Effect of low-intensity pulsed ultrasound on BMP-7-induced osteogenic differentiation of human nonunion tissue-derived cells in vitro. J Ultrasound Med 2013;32:915–22. 25. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001;25:402–8. 26. Gleizal A, Li S, Pialat JB, Beziat JL. Transcriptional expression of calvarial bone after treatment with low-intensity ultrasound: an in vitro study. Ultrasound Med Biol 2006; 32:1569–74. 27. Leskinen JJ, Karjalainen HM, Olkku A, Hynynen K, Mahonen A, Lammi MJ. Genome-wide microarray analysis of MG-63 osteoblastic cells exposed to ultrasound. Bone 2008;43:348–54. 28. Takayama T, Suzuki N, Ikeda K, Shimada T, Suzuki A, Maeno M, et al. Low-intensity pulsed ultrasound stimulates osteogenic differentiation in ROS 17/2.8 cells. Life Sci 2007;80:965–7. 29. Lai CH, Chen SC, Chiu LH, Yang CB, Tsai YH, Zuo CS, et al. Effects of low-intensity pulsed ultrasound, dexamethasone/TGFbeta1 and/or BMP-2 on the transcriptional expression of genes in human mesenchymal stem cells: chondrogenic vs. osteogenic differentiation. Ultrasound Med Biol 2010;36:1022–33. 30. Sun JS, Hong RC, Chang WH, Chen LT, Lin FH, Liu HC. In vitro effects of low-intensity ultrasound stimulation on the bone cells. J Biomed Mater Res 2001;57:449–56. 31. Schumann D, Kujat R, Zellner J, Angele MK, Nerlich M, Mayr E, et al. Treatment of human mesenchymal stem cells with pulsed low intensity ultrasound enhances the chondrogenic phenotype in vitro. Biorheology 2006; 43:431–43. 32. Parvizi J, Parpura V, Greenleaf JF, Bolander ME. Calcium signaling is required for ultrasound-stimulated aggrecan synthesis by rat chondrocytes. J Orthop Res 2002;20: 51–7. 33. Wang FS, Kuo YR, Wang CJ, Yanga KD, Chang PR, Huang YT, et al. Nitric oxide mediates ultrasound-induced hypoxia-inducible factor-1a activation and vascular endothelial growth factor-A expression in human osteoblasts. Bone 2004;35:114–23. 34. Bandow K, Nishikawa Y, Ohnishi T, Kakimoto K, Soejima K, Iwabuchi S, et al. Lowintensity pulsed ultrasound (LIPUS) induces RANKL, MCP-1, and MIP-1beta expression

35.

36.

37.

38.

39.

40.

41.

42.

43.

in osteoblasts through the angiotensin II type 1 receptor. J Cell Physiol 2007;211: 392–8. El-Bialy TH, Royston TJ, Magin RL, Evans CA, Zaki Ael-M. Frizzell LA. The effect of pulsed ultrasound on mandibular distraction. Ann Biomed Eng 2002;30:1251–61. Ding Y, Li G, Zhang X, Ao J, Liu W, Ma Q, et al. Effect of low-intensity pulsed ultrasound on bone formation during mandible distraction osteogenesis in a canine model— a preliminary study. J Oral Maxillofac Surg 2009;67:2431–9. Xie LK, Wangrangsimakul K, Suttapreyasri S, Cheung LK, Nuntanaranont T. A preliminary study of the effect of low intensity pulsed ultrasound on new bone formation during mandibular distraction osteogenesis in rabbits. Int J Oral Maxillofac Surg 2011;40:730–6. Wu P, Song JL, Feng G, Dong N, Zhao CL, Wang ZB. Repairing effects of low-intensity pulsed ultrasound on alveolar bone defects in Beagle dogs. Hua Xi Kou Qiang Yi Xue Za Zhi 2010;28:522–5. Jiang X, Yang J, Chai Z, Song J, Deng F, Wang Z. Low intensity pulsed ultrasound irradiating combined with guided bone regeneration for promoting the repair effect of periodontal bone defect. Hua Xi Kou Qiang Yi Xue Za Zhi 2012;30:487–92. Watabe H, Furuhama T, Tani-Ishii N, Mikuni-Takagaki Y. Mechanotransduction activates a5b1 integrin and PI3K/Akt signaling pathways in mandibular osteoblasts. Exp Cell Res 2011;317:2642–9. Mathog RH, Toma V, Clayman L, Wolf S. Nonunion of the mandible: an analysis of contributing factors. J Oral Maxillofac Surg 2000;58:746–53. Haug RH, Schwimmer A. Fibrous union of the mandible: a review of 27 patients. J Oral Maxillofac Surg 1994;52:832–9. Bochlogyros PN. Non union of fractures of the mandible. J Maxillofac Surg 1985;13:189.

Address: Takumi Hasegawa Department of Oral and Maxillofacial Surgery Kobe University Graduate School of Medicine 7-5-1 Kusunoki-cho Chuo-ku Kobe 650-0017 Japan Tel: +81 78 382 6213; Fax: +81 78 351 6229 E-mail: [email protected]