The ovine somatostatin receptor subtype 1 (osst1): partial cloning and tissue distribution

Domestic Animal Endocrinology 21 (2001) 73– 84

The ovine somatostatin receptor subtype 1 (osst1): partial cloning and tissue distribution N. Debusa,1, A. Dutoura,*, V. Vuaroqueauxa,2, C. Olivera, L’H. Ouafikb a

Laboratoire de Neuroendocrinologie Expe´rimentale, INSERM U501, IFR Jean Roche, Bvd P. Dramard 13916 Marseille Cedex 20 France b Cance´rologie Expe´rimentale, IFR Jean Roche, Bvd P. Dramard 13916 Marseille Cedex 20 France Received 4 March 2001; accepted 22 May 2001

Abstract The sheep is a valuable model to study GH neuroregulation since its GH secretion pattern is close to that in human. Somatostatin receptor subtype 1 (sst1) appears to be important in central regulation of GH but ovine sst1 (osst1) has not yet been cloned. We report here the cloning of the major part of sst1 in that species. Using human primers from transmembrane domain 2 and 7, we amplified from sheep tissue by RT-PCR a 700 bp fragment. By screening a cDNA sheep library with this fragment, we isolated a 1.4 kb cDNA which contained the major part of the coding cDNA of osst1. The partial predicted protein consists of 347 amino acids exhibiting a putative seven transmembrane domain topology typical of G protein-coupled receptors. Nucleotide sequence comparisons with that of other species showed that osst1 displays 88% homology with human sst1, 84% with rat sst1 and 87% with mouse sst1. Southern blot analysis of ovine cortex DNA demonstrated that osst1 is encoded by a single gene. Northern blot studies evidenced a 3.9 kb transcript highly expressed in the cortex and the hippocampus. This transcript was also present in hypothalamus, striatum, cerebellum, olfactory bulb, spinal cord, brain stem, the lung, kidney, liver, adrenal glands and at a low level in the pituitary gland. No signal was noticeable in the pineal gland. The sequence homology, the tissue distribution, the length of the transcript link this cDNA to the somatostatin receptor family and particularly to sst1. © 2001 Elsevier Science Inc. All rights reserved.

* Corresponding author. Tel.: ⫹33-4-91-65-43-11; fax: ⫹33-4-91-69-87-12. 1 Present address: UMR 868 Elevage des Ruminants en Re´gions Chaudes, ENSA. M-INRA, 2 place P. Viala, 34060 Montpellier Cedex 1 France. 2 Present address: Cance´rologie Expe´rimentale, IFR Jean Roche, Bvd P. Dramard 13916 Marseille Cedex 20 France. 0739-7240/01/$ – see front matter © 2001 Elsevier Science Inc. All rights reserved. PII: S 0 7 3 9 - 7 2 4 0 ( 0 1 ) 0 0 1 0 9 - 6

74

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

1. Introduction Somatostatin (SRIH) is a cyclic tetradecapeptide that was originally isolated from an ovine hypothalamic extract [1] and shown to inhibit the secretion of a number of pancreatic, pituitary, and gastrointestinal hormones. SRIH is known to be an important multifunctional peptide regulating neurotransmission and inducing inhibition of various secretions and cell proliferation [2]. SRIH exerts its biologic effects by binding to high-affinity receptors [3]. Five distinct somatostatin receptor (sst1–5) subtypes have been identified in humans and rodents, encoding for a family of G protein coupled receptors [4 –16]. The structure, molecular pharmacology and distribution of human and murine sst have been extremely studied. Sst mRNAs present a spatially and temporally different localization in brain and peripheral tissues [17–18]. When expressed individually in mammalian cells, the five receptor subtypes exhibit distinct pharmacological properties [2]. This reflects a complex regulation of SRIH action and suggests subtype-specific SRIH receptor activities. Sst represents a major class of inhibitory receptors but the function of individual subtypes is not yet well characterized, specially for sst1. Indeed, the efforts to identify biologic actions of sst1 have been hindered by the late development of selective sst1 agonists [2,19]. Sheep is a very interesting model and is closer to human than rat in regulation of GH secretion in terms of pulsatility, response to stress and various secretagogues, action of SRIH analogs [20 –22]. In rats sst1 mRNAs are expressed in SRIH and/or GHRH hypothalamic neurons suggesting a role for sst1 in neuroendocrine regulation of growth hormone secretion [23,24]. Intracerebroventricular injection of sst1 antisense diminished the amplitude of GH pulses suggesting a major role of sst1 receptors in the intrahypothalamic regulation of GH pulsatility [25]. Furthermore a marked sex-related difference in sst1 expression in the arcuate nucleus of the hypothalamus was evidenced suggesting an implication of hypothalamic sst1 in the sexual dimorphism of GH pattern [26]. Human and murine sst1 cDNA have been identified, but the ovine sst1 (osst1) cDNA has not been cloned. To better characterize the sheep model, we cloned and sequenced the major part of osst1 cDNA from a sheep pituitary cDNA library and studied its distribution.

2. Materials and methods 2.1. General method Standard methods were carried out as described in Sambrook et al. [27]. DNA sequencing was determined using the dideoxy chain termination method of Sanger et al. [28], with a T7 Pharmacia sequencing kit. Sequence analysis and comparison were performed using MacVector and Bizance. 2.2. Isolation and sequencing of the osst1 cDNA Five micrograms of total ovine pituitary RNA were reverse transcribed into cDNA. Using human primers from transmembrane domain (TM) 2 (SR1: TACATCCTCAACCTGGC-

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

75

CATCGCAGATGA) and 7 (SR2: CATATAGGATAGGGTTGGCACAGCTGTT) of sst1 and 2, we amplified a 700 bp cDNA fragment by using polymerase chain reaction (PCR) from sheep pituitary corresponding to a portion of the coding osst1 cDNA. PCR were performed in a 50 ␮l volume, with 20 mM Tris-HCl (pH 7.4, 25°C), 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton X-100, 200 ␮M each of four dNTPs, 1 ␮␮M each primer, cDNA derived from the equivalent of 300 ng total RNA, and 2.5 U Extrapol I DNA polymerase (Eurobio, Les Ulis, Paris). The PCR thermal program used was an initial denaturation step at 94°C for 5 min followed by denaturation at 94°C for 1 min, annealing at 60°C for 1 min 30 s, and extension at 72°C for 2 min for a total of 40 cycles followed by a last extension time of 10 min. The PCR product was separated on a 1% low-melting-temperature agarose gel and the 700 bp cDNA fragment was eluted from the agarose, ligated into the pBluescript, and sequenced. This 700 bp cDNA fragment of osst1 was radiolabeled with [␣-32P]dCTP by random priming using a Quick Prime kit (Pharmacia) and used as a probe to screen a commercial sheep pituitary cDNA library in the ␭ZAP vector (Stratagene). 1 ⫻ 106 plaque forming units were lifted on Protran BA85 membranes (Schleicher and Schuell) and hybridized at 42°C for 24h in hybridization solution (50% formamide, 5⫻ SSC, 4⫻ Denhardt’s, 25 mM NaH2PO4 pH 6.5, 0.1% SDS, 0.1 mg/ml ssDNA). The membranes were washed with 2⫻ SSC, 0.1% SDS at room temperature for 2 ⫻ 25 min and with 0.2⫻ SSC, 0.1% SDS at 55°C for 2 ⫻ 25 min. The filters were then exposed to Kodak biomax film at ⫺80°C for 2 d. A single positive clone was plaque purified, rescued as pBluescript by automatic excision using R408 helper plage, and sequenced. 2.3. Southern analysis Genomic DNA from ovine cortex was isolated by standard techniques [27]. The DNA (10 ␮g/reaction) was restriction cut with BamHI, EcoRI, HindIII, XbaI, and SalI (Gibco-BRL) and fractionated on a 0.7% agarose gel along with mol wt markers (1-Kb ladder, GibcoBRL). Alkali denaturation was preceded by a 15 min acid wash in order to obtain a good transfer of high mol wt DNAs. After neutralization, the DNAs were transferred to Hybond-N⫹ membranes (Amersham Corp, Les Ulis, Paris) by capillarity action in 0.4 M NaOH. The membrane was hybridized with the osst1 probe described above at 65°C to 24 hr in hybridization solution (6⫻ SSC, 5⫻ Denhardt’s, 0.5% SDS, 1 mg/ml ssDNA). The membrane was washed in 2⫻ SSC, 0.1% SDS for 2 ⫻ 10 min at room temperature, in 1⫻ SSC, 0.1% SDS for 2 ⫻ 10 min at 65°C, and in 0.1⫻ SSC, 0.1% SDS for 2 ⫻ 10 min at 65°C and exposed to biomax film as described previously. The southern blot analysis has been performed on 3 different ovine genomic DNA samples. 2.4. Analysis of osst1 mRNA by Northern blot Total RNA was isolated by the acid guanidinium/thiocyanate phenol/chloroforme extraction method from normal sheep and rat tissues [29]. Poly(A)⫹ RNA was isolated from ovine pituitary using the Poly A tract mRNA isolation system (Promega). RNA (30 ␮g) was denatured in formamide/formaldehyde, fractionated on a 1% agarose-formaldehyde gel, and transferred to Hybond-N membranes (Amersham Corp, Les Ulis, Paris) by capillarity action

76

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

in 20⫻ SSC, cross linked by UV irradiation and hybridized to 32P-labeled osst1 coding cDNA (1.4 Kb). Filters were prehybridized, hybridized and washed as described above. To correct for the actual amount of RNA in each lane, blots were stripped and hybridized to cDNA probes derived from frog ribosomal RNA (18S rRNA). The autoradiograms were analyzed by measurement of optic density by scanner-densitometer using NIH image 1.54 Software (National Institute of Health). The results are expressed as optic density (OD) of osst1 mRNA/OD 18S rRNA. The bar chart shows results expressed as the mean ⫾ SEM of data obtained from tissues, which were collected from 3 different animals.

3. Results and discussion To clone sst1 in sheep, we performed RT-PCR, from mRNA of sheep anterior pituitary, with oligonucleotide primer corresponding to conserved sequences present in the transmembrane domain 2 and 7 of hsst1 and 2. A single product (700 bp) was identified, its sequence presented high homology with rat sst1 (rsst1) and human sst1 (hsst1) [6,9]. This PCR product was used as a probe to screen a sheep pituitary cDNA library, and a clone of 1400 bp designated as MRS1 was isolated and sequenced. The cloned DNA contained the major part of the coding cDNA of osst1. By computer analysis of this partial nucleotide sequence we obtained a deduced partial amino acid sequence of 347 amino acids, designated partial osst1 (Fig. 1). Computer analysis of the hydropathic profile of this amino acid sequence displayed seven hydrophobic domains separated by stretches of hydrophilic amino acids, which are characteristic of G protein-coupled receptors [30]. The sequence showed 88% nucleotide sequence identity to the hsst1 sequence and 84%, 87%, 51%, 50%, 58%, 63%, and 59% with rsst1, mouse sst1 (msst1), hsst2A, hsst2B, hsst3, hsst4 and hsst5 respectively. Comparison of the amino acid sequence revealed great similarity with human, rat, and mouse sst1 with 99%, 95%, and 98% sequence identity respectively (Fig. 2). It confirms the important degree of structural conservation of sst1 across species. Comparison of the amino acid sequence with those of the other members of the hsst family revealed 45%, 45%, 45%, 60%, and 43% sequence identity to sst2A, sst2B, sst3, sst4, and sst5, respectively (Fig. 3). The sequence of the different proteins showed greatest similarity in the putative membrane-spanning domains and diverged most at their amino and carboxyl termini as observed in the previously cloned ssts. Osst1 presents two potential N-glycosylation sites (Asn48 in the amino-terminal segment and at Asn380 in the carboxyl-terminal segment), two consensus sequences for phosphorylation by cAMP-dependant protein kinase A (at Thr172 in the second intracellular loop (IC2) and at Ser264 in IC3), and two sites for protein kinase C phosphorylation (in IC3: Ser264, and in the carboxyl-terminal segment: Ser384). Intracellular COOH-terminal domain is serine-threonine-rich and could serve as a substrate for serine/threonine protein kinase. In addition, several amino acids that are conserved within the superfamily of G protein-coupled receptors are also conserved in osst1: the DRY sequence in IC2, an aspartic acid residue (Asp137) in TM3, and cysteine residues in the first (EX1) (Cys130) and second (EX2) (Cys208) extracellular loop, which are likely to form a disulfide bridge [30 –32]. We didn’t observe a putative consensus sequence for G protein coupling in IC3 as previously reported by Li et al. [6] for rsst1 and Yamada et al. [9] for hsst1 [33]. On an other hand, osst1 displays the

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

77

Fig. 1. Nucleotide and deduced amino acid sequence of partial osst1 cDNA and protein. Amino acids are annoted by the single letter amino acid code. The putative transmembrane domains are underlined.

78

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

Fig. 2. Alignment of osst1 with hsst1, rsst1 and msst1 the five hsst subtypes. The different amino acid sequences are alignated using the single-letter amino acid code. Amino acid residues identical or similar within the seven sequences are indicated by asterisks (*) or points (:) respectively. Gaps (indicated by dashes) in the sequences have been introduced to maximize alignment.

glutamate residue adjacent LAXAD motif in TM2 which is common to sst1-sst4. Within TM7 was found the motif YANSCANPILY conserved in all ssts. This sequence is not present in other seven transmembrane domain receptors, suggesting tat this motif serve as a signature sequence for the sst receptor family [15,34]. Liapakis et al. [35] have found that EX2 is important for the selectivity of CH-275 for binding to sst1. Furthermore, using chimeric mouse sst1/sst2 receptor, these workers demonstrated that swapping the EX3 and upper segments of the adjacent TM7 (FDFV: residues 294 –297) in sst2 receptor with the comparable domains of sst1 (SQLS: resides 305–308)

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

79

Fig. 3. Alignment of osst1 with the five human somatostatin receptor subtypes. The different amino acid sequences are alignated using the single-letter amino acid code. Amino acid residues identical or similar within the seven sequences are indicated by asterisks (*) or points (:) respectively. Gaps (indicated by dashes) in the sequences have been introduced to maximize alignment.

80

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

Fig. 4. Southern analysis of sst1 in the ovine genome. Ten micrograms of genomic DNA isolated from ovine cortex were restriction cut with HindIII, BamHI, XbaI, SalI or EcoRI and fractionated on an 0.7% agarose-TBE gel before transfer onto a nitrocellulose membrane. The membrane was subsequently probed with nick-translated probe to the 1400 bp fragment of osst1. The autoradiograph showed only one band per lane.

resulted in a loss of affinity for the hexapeptide MK678 [35]. Likewise, in hsst1, the ligand binding pocket is lined by residues Phe287, Gln291, and Ser305 which make lipophilic interactions with the Phe6-Phe [11] assembly of SRIH-14. Substitution of Gln291 and Ser305 to the corresponding residues Asn276 and Phe294 in hsst2 increased the affinity of hsst1 for SMS and other octapeptide analogs 1000 fold [36]. Finally Fitzpatrick et al. [37] observed that sst1–5 can be divided into two groups based on their EX3 length, with sst1 and 4 having EX3 regions that are 4 amino acids shorter than those seen in sst2, 3, and 5 and the different EX3 lengths have a strong correlation with MK678 affinities. The amino acid sequence of EX2 and EX3, the length of EX3 (4 amino acids shorter), the SQLS motif, and the three amino acids Phe287, Gln291, and Ser305 described above are totally conserved in osst1, hsst1, msst1 and rsst1. So we can speculate that osst1 will display the same binding selectivity as hsst1 and rsst1. The number of copy of osst1 gene was investigated by Southern analysis: a probe directed against a portion of coding cDNA of osst1 (1.4 Kb) hybridized to a single band in restriction endonuclease treated size-fractionated ovine genomic DNA (Fig. 4). These data are consistent with there being only one gene for ovine sst1. 3.1. osst1 tissue distribution We examined the tissue distribution of osst1 mRNA by RNA blotting and we found a single transcript of 3.9 kb, which is highly expressed in the cerebral cortex and the hippocampus. In order to better define the size of osst1 mRNA and to compare it to rsst1, we fractionated ovine and rat cortex mRNAs on a 250 ml agarose (1%) gel and ran it during 12h. A 3.7 Kb band was observed for rsst1 and a 3.95 Kb for osst1 (Fig. 5B). These results are similar though not identical to previously reported size [5]. A widespread distribution of sst1

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

81

Fig. 5. Northern blot analysis of sst1 mRNA expression in ovine tissues from one representative animal (A) and comparison by Northern blot of the size of ovine and rat sst1 mRNA (B). Thirty micrograms of total RNA was denatured, electrophoresed in a 1% agarose gel, blotted onto a Hybond-N membrane, and hybridized with 32 P-labeled ovine or rat sst1 probe. Exposure time was 7 d. Quantitative analysis of the blots is shown in C. The bar chart shows results expressed as the mean ⫾ SEM of data obtained from tissues, which were collected from 3 different animals. 1: cerebral cortex, 2: pituitary, 3: cerebellum, 4: hippocampus, 5: pineal gland, 6: hypothalamus, 7: brain stem, 8: olfactory bulb, 9: striatum, 10: spinal cord, 11: corpus jenicule, 12: colon, 13: lung, 14: kidney, 15: liver, 16: adrenal gland.

was found: osst1 mRNA was detected in hypothalamus, striatum, cerebellum, brain stem, olfactory bulb, corpus jenicule and spinal cord and at a very low level in the pituitary gland (a higher signal was obtained with poly(A)⫹ RNA (data not shown)). No hybridization signal was noticeable in the pineal gland. At the peripheral level it was also readily detected in lung,

82

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

kidney, liver, adrenal gland and to a lesser level in the colon (Fig. 5A and C). This widespread distribution of osst1 is highly similar to that observed in rats [6,17,18,21,38,39]. Tissue distribution of hsst1 was studied to a lesser extent since obtaining human normal tissue is difficult. Hsst1 was shown to be expressed in the brain with highest levels in the cortex and the hippocampus and to lesser levels in hypothalamus, striatum, cerebellum, and brain stem [40,41]. Sst1 receptor was shown to be an autoreceptor on somatostatinergic neurons located in the hypothalamus [42]. At the peripheral level it is expressed in the lung and the stomach and to a lesser level in colon, kidney and brain [9,13]. This is in accordance with results obtained in sheep. In summary, the high nucleotide sequence homology of the transcript with other sst1 receptors, its tissue-distribution, its size, and a variety of sequence motifs, such as the YANSCANPILY sequence in TM7 and the cluster of phosphorylation sites in the third intracellular loop clearly link this cDNA to the somatostatin receptor family and particularly to the sst1 subtype. The important similarity in structure and distribution of sst1 in various mammals confirm its strong evolutionary conservation.

Acknowledgments The scientific interest and continuous support of B. Tissier (Ipsen, Signes, France) are gratefully acknowledged. N. Debus is supported by a fellowship from IPSEN France and by Regional Council Provence Alpes Coˆ te d’Azur.

References [1] Brazeau P, Vale WW, Burgus R, Ling N, Butcher M, Rivier J, Guillemin R. Hypothalamic polypeptide that inhibits the secretion of immunoreactive pituitary growth hormone. Science 1973;179:77–9. [2] Patel YC, Srikant CB. Somatostatin receptors. TEM 1997;8:398 – 405. [3] Srikant CB, Patel YC. Receptor binding of somatostatin-28 is tissu specific. Nature 1981;294:259 – 60. [4] Bruno J, Xu Y, Song J, Berelowitz M. Molecular cloning, and functional expression of a novel brain specific somatostatin receptor. Proc Natl Acad Sci USA 1992;89:11151–5. [5] Kluxen FW, Bruns C, Lubbert H. Expression cloning of a rat brain somatostatin receptor cDNA. Proc Natl Acad Sci USA 1992;89:4618 –22. [6] Li X, Forte M, North RA, Ross CA, Snyder SH. Cloning, and expression of a rat somatostatin receptor enriched in brain. J Biol Chem 1992;267:21307–12. [7] Meyerhof W, Wulfsen I, Schonrock C, Fehr S, Richter D. Molecular cloning of a somatostatin-28 receptor, and comparison of its expression pattern with that of a somatostatin-14 receptor in brain. Proc Natl Acad Sci USA 1992;89:10267–71. [8] O’Carroll AM, Lolait S, Konig M, Mahan L. Molecular cloning, and expression of a pituitary somatostatin receptor with preferential affinity for somatostatin-28. Mol Pharmacol 1992;42:939 – 46. [9] Yamada Y, Post SR, Wang K, Tager HS, Bell GI, Seino S. Cloning, and functional characterization of a family of human, and mouse somatostatin receptors expressed in brain, gastrointestinal tract, and kidney. Proc Natl Acad Sci USA 1992;89:251–5. [10] Yasuda K, Rens-Domiano S, Breder C, Law S, Saper C, Reisine T, Bell GI. Cloning of a novel somatostatin receptor, SSTR3, coupled to adenylyl cyclase. J Biol Chem 1992;267:20422– 8.

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

83

[11] Corness JP, Demchyskyn LL, Seeman P, Van Tol HHM, Srikant CB, Kent G, Patel YC, Niznik HB. A human somatostatin receptor (SSTR3), located on chromosome 22, displays preferential affinity for somatostatin-14 like peptides. FEBS Lett 1993;321:279 – 84. [12] Demchyshyn LL, Srikant CB, Sunahara RK, Kent G, Seeman P, Van Tol HHM, Panette R, Patel YC, Niznik HB. Cloning, and expression of a human somatostatin-14 selective receptor variant (SSTR4) located on chromosome 20. Mol Pharmacol 1993;43:894 –901. [13] Rohrer L, Raulf F, Bruns C, Buettner R, Hofstaedter F, Schu¨ le R. Cloning, and characterization of a fourth human somatostatin receptor. Proc Natl Acad Sci USA 1993;90:4196 – 4200. [14] Matsumoto K, Yokogoshi Y, Fujinaka Y, Zhang C, Saito S. Molecular cloning, and sequencing of porcine somatostatin receptor 2⫹. Biochem Biophys Res Commun 1994;199:298 –305. [15] Panetta R, Greenwood MT, Warswynska A, Demchyshyn LL, Day R, Niznik HB, Srikant CB, Patel YC. Molecular cloning, functional characterization, and chromosomal localization of a human somatostatin receptor (somatostatin receptor type 5) with preferential affinity for somatostatin-28. Mol Pharmacol 1994;45:417–27. [16] Baumeister H, Roosterman D, Scha¨ fer J, Kreuzer O, Meyerhof W. Cloning, expression, pharmacology, and tissye distribution of the mouse somatostatin receptor subtype 5. J Neuroendocrinol 1998;10:283–90. [17] Bruno JF, Xu Y, Song J, Berelowitz M. Tissue distribution of somatostatin receptor subtype messenger ribonucleic acid in the rat. Endocrinology 1993;133:2561–7. [18] Raulf F, Perez J, Hoyer D, Bruns C. Differential expression of five somatostatin receptors subtypes, SSTR1–5, in the CNS, and peripheral tissue. Digestion 1994;55:46 –53. [19] Liapakis G, Hoeger C, Rivier J, Reisine T. Development of a selective agonist at the somatostatin receptor subtype SSTR1. J Pharmacol Exp Ther 1996;276:1089 –94. [20] Briard N, Dutour A, Epelbaum J, Sauze N, Slama A, Oliver C. Species differences between male rat, and ram pituitary somatostatin receptors involved in the inhibition of GH secretion. Eur J Endocrinol 1997; 137:545–55. [21] Dutour A, Briard N, Guillaume V, Magnan E, Cataldi M, Oliver C. Another view of GH neuroregulation: lessons from the sheep. Eur J Endocrinol 1997;136:553– 65. [22] Shimon I, Taylor JE, Dong JK, Bitone RA, Kim S, Morgan B, Coy DH, Culler MD, Melmed S. Somatostatin receptor subtype specificity in human fetal pituitary cultures: differential role of SSTR2, and SSTR5 for growth hormone, thyroid-stimulating hormone, and prolactin regulation. J Clin Invest 1997;99: 789 –98. [23] Beaudet A, Greenspun D, Raelson J, Tannenbaum GS. Patterns of expression of SSTR1, and SSTR2 somatostatin receptor subtypes in the hypothalamus of the adult rat: relationship to neuroendocrine function. Neuroscience 1995;65:551– 61. [24] Tannenbaum GS, Zhang WH, Lapointe M, Zeitler P, Beaudet A. Growth hormone-releasing hormone neurons in the arcuate nucleus express both Ss1, and Ss2 somatostatin receptor genes. Endocrinology 1998;139:1450 –3. [25] Lanneau C, Peineau S. Petit F, Epelbaum J, Gardette R. Somatostatin modulation of excitatory synaptic transmission between periventricular, and arcuate hypothalamic nuclei in vitro. J. Neurophysiol 2000;84: 1464 –74. [26] Zhang WH, Beaudet A. Tannenbaum GS. Sexually dimorphism expression of sst1, and sst2 somatostatin receptor subtypes in the arcuate nucleus, and anterior pituitary of adult rats. J Neuroendocrinol 1999;11: 129 –36. [27] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, 1998. [28] Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 1977;74:5463–7. [29] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol chloroform extraction. Anal Biochem 1987;162:156 – 8. [30] Dohlman HG, Thorner J, Caron MG, Lefkowitz RJ. Model systems for the study of seven-transmembranesegment receptors. Annu Rev Biochem 1991;60:653– 88.

84

N. Debus et al. / Domestic Animal Endocrinology 21 (2001) 73– 84

[31] Findlay J, Eliopoulos E. Three-dimensional modelling of G protein-linked receptors. Trends Pharmacol Sci 1990;11:492–9. [32] Strader CD, Sigal IS, Candelore MR, Rands E, Hill WS, Dixon RAF. Conserved aspartic acid residues 79, and 113 of the ␤-adrenergic receptor have different roles in receptor function. J Biol Chem 1988;263: 10267–71. [33] Takashi O, Nishimoto I. Detection of G protein activator regions in M4 subunit muscarinic, choloinergic, and ␣2-adrenergic receptors based upon characteristics in primary structure. J Biol Chem 1992;267:8342– 6. [34] Probst WC, Snyder LA, Schuster DI, Brosius J, Sealfon SC. Sequence alignment of the G-protein coupled receptor superfamily. DNA Cell Biol 1992;11:1–20. [35] Liapakis G, Fitzpatrick D, Hoeger C, Rivier J, Vandlen R, Reisine T. Identification of ligand binding determinants in the somatostatin receptor subtypes 1, and 2. J Biol Chem 1996;271:20331–9. [36] Kaupmann K, Bruns C, Raulf F, Weber HP, Mattes H, Lu¨ bbert H. Two amino acids, located in transmembrane domains VI, and VII, determine the selectivity of the peptide agonist SMS 201–995 for the SSTR2 somatostatin receptor. EMBO J 1995;14:727–35. [37] Fitzpatrick D, Vandlen RL. Agonist selectivity determinants in somatostatin receptor subtypes I and II. J Biol Chem 1994;269:24621– 6. [38] Kong H, De Paoli AM, Breder CD, Yasuda K, Bell GI, Reisine T. Differential expression of messenger RNAs for somatostatin receptor SSTR1, SSTR2, and SSTR3 in adult brain: analysis by RNA blotting, and in situ hybridization histochemistry. Neuroscience 1994;59:175– 84. [39] Mitsuma T, Rhue N, Sobue G, Kayama M, Yokoi Y, Izumi M, Adachi K, Hirooka Y, Nogimori T, Sakai J, Sugie I. Distribution of somatostatin receptor type 1 in the rat. An immunohistochemical study. Endocrine Regulations 1995;29:189 –93. [40] Schindler M, Humphrey PPA, Emson PC. Somatostatin receptors in the central nervous system. Prog Neurobiol 1996;50:9 – 47. [41] Thoss VS, Perez J, Probst A, Hoyer D. Expression of five somatostatin receptor mRNAs in the human brain, and pituitary. Naunyn Schmiedebergs Arch Pharmacol 1996;354:411–9. [42] Helboe L, Moller M. Localization of somatostatin receptors at the light, and electron microscopial level by using antibodies raised against fusion proteins. Prog Histochem Cytochem 2000;35:3– 64.