- Email: [email protected]
The ovine urokinase plasminogen activator and its receptor cDNAs: Molecular cloning, characterization and expression in various tissues
Gene 443 (2009) 158–169
Contents lists available at ScienceDirect
Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e
The ovine urokinase plasminogen activator and its receptor cDNAs: Molecular cloning, characterization and expression in various tissues Giorgos Theodorou, Iosif Bizelis ⁎, Emmanuel Rogdakis, Ioannis Politis Department of Animal Science, Agricultural University of Athens, Iera Odos 75, 11855 Athens, Greece
a r t i c l e
i n f o
Article history: Received 30 March 2009 Accepted 13 April 2009 Available online 21 April 2009 Received by A.J. van Wijnen Keywords: Ovine u-PA u-PAR Mammary gland cDNA Homologue model
a b s t r a c t The activation of plasminogen plays a crucial role in a variety of extracellular proteolytic events such as, fibrinolysis, cell migration, ovulation, involution of the mammary gland and the activation of other protease classes and growth factors. In this paper we describe the isolation of the full-length cDNAs of ovine urokinase plasminogen activator (u-PA) and its receptor (u-PAR) using a polymerase chain reaction based strategy. The ovine u-PA cDNA comprised of 2350 bp and it is characterized by a coding region of 1302 bp, and 5′- and 3′UTR regions of 129 and 919 bp, respectively. The deduced amino acid sequence consists of 433 amino acids. The ovine u-PAR cDNA is comprised of 1247 bp and it is characterized by a coding region of 957 bp and 5′and 3′-UTR regions of 44 and 246 bp respectively. The deduced amino acid sequence consists of 318 amino acids. Three-dimensional models of the putative protein products of both cDNAs showed that the proteins bear a high similarity with their human counterparts. Real-time PCR revealed high levels of u-PA expression in the adipose tissue, followed by that in mammary gland and kidney. Lower levels of expression were detected in the adrenal glands, heart, ovaries, spleen, liver and cerebellum. A similar pattern was observed in u-PAR expression with noticeably lower levels of expression in heart, liver and cerebellum. To the best of our knowledge, this is the first paper reporting expression of u-PA and u-PAR in the adipose tissue. These data strengthen the suggestion that adipose tissue functions as an endocrine organ besides an energy storage organ. Furthermore, u-PA and u-PAR mRNA levels were 7 and 8.5 fold higher respectively in involuting mammary tissue obtained from non-lactating ewes compared to that detected in mammary tissue obtained from lactating ewes. These data are consistent with the notion that upregulation of u-PA and u-PAR expression may play a key role in the process of involution of the mammary gland. © 2009 Elsevier B.V. All rights reserved.
1. Introduction The process of plasminogen activation leads to the formation of a serine protease, plasmin, which in turn, is capable of degrading most extracellular proteins. This process is controlled by an interplay between plasminogen activators (PA) and PA inhibitors (PAI). There are two types of PA: urokinase-PA (u-PA) and tissue-PA (t-PA). These two enzymes catalyze the cleavage of the same peptide bond in plasminogen (Arg557–ILe558), but they are antigenically distinct and they are products of different genes (Dano et al. 2005). It is generally believed, even though certain exceptions do exist, that t-PA is involved in the maintenance of fluidity of the extracellular milieu
Abbreviations: u-PA, Urokinase Plasminogen Activator; t-PA, Tissue Plasminogen Activator; u-PAR, Urokinase Plasminogen Activator Receptor; PAI-1, Plasminogen Activator Inhibitor 1; PAI-2, Plasminogen Activator Inhibitor 2; UTR, Untranslated Region; PA, Plasminogen Activator; EGF, Epidermal Growth Factor; ATF, Amino Terminal Fragment; Ly-6, Lymphocyte antigen 6 complex; LU, Ly-6/u-PAR; GPI, Glycosyl, Phospatidyl,Inositol; RACE, Rapid Amplification of cDNA Ends. ⁎ Corresponding author. E-mail address: [email protected] (I. Bizelis). 0378-1119/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2009.04.008
(thrombolysis), while u-PA is involved in the proteolytic events that accompany various tissue remodeling events (i.e involution of the mammary gland). The activity of PA can be limited by the action of PAI. The most important, fast acting, PAI have been designated PAI-1 and PAI-2. Within the ruminant family of animals, only the sequence of the bovine u-PA has been determined. The bovine single-chain u-PA is a glycoprotein consisting of 413 amino acids. The molecule of u-PA has a number of structural and functional domains: 1) the epidermal growth factor (EGF)-like domain, which is structurally similar to the receptor-binding region of EGF, 2) one, so called, kringle domain, and 3) the carboxyl terminal region, which contains the active site of the enzyme. The EGF and the kringle structure make up the amino terminal fragment (ATF) of the u-PA molecule. The ATF is of great biological importance because it mediates binding of u-PA to a specific receptor (u-PAR) present in various cells (Politis 1996). Activation of plasminogen by PA plays a crucial role in various extracellular proteolytic events, such as fibrinolysis, cell migration (i.e. migration of neutrophils to the site of infection, angiogenesis, wound healing, tumour invasion, bacterial invasion), ovulation, mammary gland involution and the activation of other protease classes and
G. Theodorou et al. / Gene 443 (2009) 158–169
growth factors. Furthermore, O'Mullane and Baker (1999), reported that expression of PA is dramatically elevated in the degradative events of cellular apoptosis in U937 cells. The cellular receptor for u-PA (u-PAR) is a membrane protein that binds u-PA with high affinity (dissociation constant = 0.1 to 1 nmol/L). The primary function of u-PAR is to localize plasminogen activation catalyzed by u-PA at cell surface. The rate of plasminogen activation is enhanced when u-PA is bound to its receptor leading to accelerated production of plasmin. Plasmin, so produced, initiates a cascade of reactions, resulting in degradation of extracellular matrix proteins, characteristic of tissue remodeling events. The mature bovine u-PAR protein consists of 310 amino acids and is highly glycosylated with six N-linked glycosylation sites. It is composed of three structurally homologous Ly-6/u-PAR (LU) domains. These domains are characterized by a high cysteine content (9%). The repeats are distantly related since their amino acid homology is lower than 20%. The u-PAR is attached to the plasma membrane by an anchor of glycosol, phosphatidyl and inositol (GPI). The repeat nearest to the N-terminal region binds u-PA at the EGFlike domain of the protein (Kratzschmar et al., 1993; Reuning et al., 1993). The mammary gland is a prime example of tissue that undergoes extensive tissue remodeling throughout its growth and its development. At puberty, mammary development accelerates with ductal elongation and branching, followed by lobulo-alveolar development and maturation during pregnancy. The final result of this process is the development of the secretory epithelium during lactation. After weaning or following cessation of milking in ruminants, major wellcontrolled degenerative events occur as the mammary gland is remodeled in preparation for the next lactation. It is well known that u-PA expression is up-regulated during post-lactational involution in mice. Furthermore, mammary involution was severely compromised in plasmin deficient mice (Lund et al., 2000). Rabot et al. (2007) reported a reduction in the expression of u-PA and u-PAR in early, followed by an increase in expression during late involution in mammary tissue obtained from dairy cows. There is a complete lack of data concerning expression of u-PA and u-PAR in ovine mammary tissue. The objectives of the present study were: 1) isolate and characterize full-length cDNA clones encoding the ovine u-PA and uPAR proteins, 2) describe the major structural characteristics and compare them with those of the respective proteins in other species using bioinformatics and molecular modeling, 3) compare u-PA and uPAR mRNA levels in various tissues and 4) compare u-PA mRNA levels in mammary tissue obtained from lactating and non-lactating (involuting) ovine mammary tissue. 2. Materials and methods 2.1. Animals A total of 12 ewes were used in this study. The ewes were either of the Boutsiko breed or of a synthetic breed (50% Boutsiko, 25% Arta and 25% Chios). Animals were housed within the premises of the experimental farm of the Agricultural University of Athens. Six ewes were lactating (approximately 120 days of lactation) and the remaining were non-lactating (7–14 days following cessation of milk). All animals were slaughtered. The following tissues and organs were removed: udder, adrenal glands, kidney, adipose tissue, heart, lung, ovaries, liver, cerebellum and spleen. Tissues and organs were immediately frozen in liquid nitrogen and then transferred to a −80 °C freezer for storage. In addition to tissues and organs, blood samples were also obtained from all animals prior to slaughter. Blood neutrophils were isolated from all samples following the method described by Politis et al. (2002). Total RNA obtained from a ewe of the synthetic breed was utilized for all cloning procedures described below.
159
2.2. Total RNA purification and subsequent reverse transcription (RT) reactions Total RNA was isolated from ovine tissues and blood neutrophils using the “RNAqueous 4PCR” kit (Ambion, USA) following the manufacturer's protocol. RNA extracted from the various tissues and organs listed in section 2.1 was used for a real-time expression study, while RNA extracted from blood neutrophils was used for all cloning procedures. First-strand cDNA synthesis was carried out with Invitrogen “Thermoscript RT-PCR System”, using 1 μg of purified total RNA. Briefly, total RNA preparations together with 50 μM of oligo-[dT]20, 10 mM of dNTP mix and DEPC-treated water were denatured at 65 °C for 5 min. After adding cDNA synthesis buffer, 100 mM DTT, 40 U RNaseOUT and 15 U of reverse transcriptase up to 20 μl of total reaction volume, an annealing and polymerization step at 60 °C for 1 h was carried out. The reaction was terminated by incubating at 85 °C for 5 min. 2.3. Isolation of cDNA clones encoding the ovine homologues of u-PA and u-PAR using Polymerase Chain Reaction (PCR) (Semi-nested approach) Three primers for each cDNA (UPAf1, UPAr1, UPAr2 for u-PA and UPARf1, UPARf2, UPARr1for u-PAR), shown in Table 1, were designed from highly conserved regions among the published human, mouse, rat, pig and bovine sequences. PCR amplification reactions were carried out using deoxynucleotides, buffers and enzyme (Taq polymerase) concentrations as exactly recommended by the enzyme manufacturer (New England Biolabs, USA). Reactions were performed on a GeneAmp PCR System 2400 thermocycler with an initial denaturation step at 94 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, 62 °C for 30 s and 72 °C for 2 min. A polymerization step at 72 °C for 7 min was added after the completion of 35 cycles. The first step of the semi-nested approach was carried out using the presynthesized ovine cDNA as a template and UPAf1/UPAr1 for u-PA and UPARf1/UPARr1 for u-PAR as a set of primers. The second step was carried out using the first reaction as a template and UPAf1/UPAr2 for u-PA and UPARf2/UPARr1for u-PAR as a set of primers. 2.4. cDNA cloning of the 5′- and 3′-untranslated regions through RACE Reverse transcription procedure, 5′-RACE-PCR outer and 5′-RACEPCR inner reactions were carried out using 1 μg of total purified RNA according to the manufacturer's protocol (Ambion, USA). The amplification reactions were performed using as gene-specific primers UPAr1 (outer) and UPAr2 (inner) for u-PA and UPARr1 (outer) and UPARrRACE (inner) for u-PAR (Table 1; Fig. 1). Reactions were carried out on a GeneAmp PCR System 2400 thermocycler, with an initial denaturation step at 94 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, 62 °C for 30 s and 72 °C for 2 min. A polymerization step at 72 °C for 7 min was added after the completion of 35 cycles. Likewise reverse transcription procedure, 3′-RACE-PCR outer and 3′-RACE-PCR inner reactions were carried out using 1 μg of total Table 1 Nomenclature, nucleotide sequences and corresponding length of all the primers utilized for the molecular cloning and isolation of the u-PA and u-PAR cDNAs.
u-PA
u-PAR
Name
Oligonucleotide sequence (5′ → 3′)
Length
5′-RACE inner 3′-RACE inner UPAf1 UPAf3 UPAr1 UPAr2 UPARf1 UPARf2 UPARf3 UPARr1 UPARrRACE
CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG CGCGGATCCGAATTAATACGACTCACTATAGG GTGGCAGCCTCATCAGTCC AATGCTATGTGCGGCTGACC GAGACCCTTGTGTAGACTCCA TGGGTCAGCCGCACATAGC GGACCTCTGCAGGACCACG GAAACCGCTACCTCGAATGTG AGAAACTTTCCTCATTGACTGC CCTGTCGCTTCCAGACATTG CAGGTTTTGAATCTCCAGGACT
35 nt 32 nt 19 nt 20 nt 21 nt 19 nt 19 nt 21 nt 22 nt 20 nt 22 nt
160
G. Theodorou et al. / Gene 443 (2009) 158–169
Fig. 1. Graphical representation of the cloning strategy designed for the u-PA (A) and u-PAR (B) cDNA isolation. (A) UPAf1, UPAr1 and UPAr2 primers, synthesized according to a phylogenetically conserved region originated from the bovine u-PA cDNA sequence, were utilized in an RT-PCR semi-nested procedure resulting in the production of a 0.47 kb ovine cDNA homologous family member. Through 5′-RACE and 3′-RACE-PCR approaches, three additional cDNA fragments were cloned, with notated length 1.23 kb (5′-RACE inner/ UPAr2), 1.13 kb (UPAf3/3′-RACE inner) and 0.61 kb (UPAf1/UPAr1). (B) UPARf1, UPARf2 and UPARr1 primers, synthesized according to a phylogenetically conserved region originated from the bovine u-PAR cDNA sequence, were utilized in an RT-PCR semi-nested procedure resulting in the production of a 0.4 kb ovine cDNA homologous family member. Through 5′RACE and 3′-RACE-PCR approaches, three additional cDNA fragments were cloned, with notated length 0.66 kb (5′-RACE inner/UPARrRACE), 0.52 kb (UPARf3/3′-RACE inner) and 0.62 kb (UPARf1/UPARr1). Based on all possible partial overlaps among the four clones for each cDNA, two linearly contiguous assemblies of the obtained u-PA and u-PAR cDNAs were generated.
purified RNA according to the manufacturer's protocol (Ambion, USA). The amplification reactions were performed using UPAf1 (outer) and UPAf3 (inner) for u-PA and UPARf1 (outer) and UPARf3 (inner) for uPAR (Fig. 1) as gene-specific primers, according to the FirstChoice RLM-RACE Kit-Ambion (USA). Reactions were carried out on a GeneAmp PCR System 2400 thermocycler, following the same conditions described above. An additional clone was isolated for both u-PA and u-PAR using the respective 3′-RACE-PCR outer reaction as a template and the UPAf1/ UPAr1 set of primers for the first and the UPARf1/UPARr1 set of primers for the latter following the same PCR conditions (Fig. 1). 2.5. Molecular cloning and DNA sequencing analysis of the u-PA and u-PAR PCR fragments The obtained PCR fragments were gel purified using the Qiaquick Gel Extraction Kit (Qiagen, USA), ligated to vector pGEM-T-Easy (Promega, USA), transformed into Escherichia coli JM109 competent cells and plated on appropriate indicator LB-dishes containing ampicillin as a selection reagent. Plasmids carrying the various u-PA cDNA PCR fragments were isolated using the Qiaprep Miniprep Kit (Qiagen, USA) and three independent clones of each fragment were sequenced two times in both directions (Institute of Molecular Biology and Biotechnology, Foundation of Research and Technology, Heraklion, Crete, Greece). 2.6. In silico analysis and molecular modeling of u-PA and u-PAR proteins The primers design was carried out using the OligoAnalyser v.1.2 and OligoExplorer v.1.2 software system (http://molbiol-tools.ca/
molecular_biology_freeware.htm). The functional analysis of the sequenced clones was performed using a conventional BLAST search procedure (http://www.ncbi.nlm.nih.gov/BLAST/), with the support of online supplementary programs (http://biology.semo. edu/cgi-bin/dnatools.pl). The generation of a reliable phylogenetic tree of the u-PA and uPAR proteins was accomplished through the use of ClustalX and PHYLIP (Felsenstein, 1989) programs by comparison of the ovine proteins primary structures with orthologous amino acid sequences from other mammalian species. Sequence alignments for the detection of distinct structural domains and functional motifs throughout the putative proteins were implemented via the utilization of the multiple alignment software package Multalin (http://prodes.toulouse.inra.fr/multalin/ multalin.html). Protein domains were identified in the amino acid sequences through its comparison to related sequences in the Pfam database (http://www.sanger.ac.uk/Software/Pfam/). Secondary structure predictions of the u-PA putative protein were performed by the PSIPRED Protein Structure Prediction Server [http://bioinf.cs. ucl.ac.uk/psipred/], as previously described (Jones 1999). The proteins were modeled by means of the Swiss-Model and SwissPdbViewer molecular graphics modeling packages (http://swissmodel.expasy.org/), according to the similarities of the modeled sequence to known structures, publicly available in the Protein Data Bank (PDB). Residues 28 to 234 of the predicted u-PA polypeptide sequence were appropriately modeled using as a suitable template the 2vntA available structure of the, most highly homologous, Human Urokinase-Type Plasminogen Activator Inhibitor Complex With a 1-(7sulphoamidoisoquinolinyl) guanidine (Fish et al., 2007) and a three-
G. Theodorou et al. / Gene 443 (2009) 158–169
dimensional (3D) molecular model of the putative u-PA protein obtained. Residues 22 to 292 of the predicted UPAR polypeptide sequence were appropriately modeled using as a suitable template the 3bt1U available structure of the, most highly homologous, human u-PAR, u-PA and Vitronectin complex (Huai et al., 2006) and a threedimensional (3D) molecular model of the putative u-PAR protein obtained. 2.7. Real-time quantitative PCR for the expression of the u-PA and u-PAR genes in the mammary gland and the construction of an expression profile in other tissues Relative levels of mRNA were quantified with real-time, quantitative RT-PCR using fluorescent TaqMan technology. Two custom TaqMan® MGB™ Probes for u-PA and u-PAR using FAM as a reporter dye were used (Applied Biosystems). A TaqMan® MGB™ Probe using VIC as a reporter dye to quantify 18 s rRNA was used in multiplex reactions as an endogenous control to normalize the amount of sample RNA (Applied Biosystems). Equal amounts of total RNA were reverse transcribed with the Qiagen “Omniscript reverse transcription” kit (Qiagen, USA), according to the manufacturer's instructions using random hexamers (Applied Biosystems). The PCR was performed in the 7500 real-time PCR System (Applied Biosystems, Weiterstadt, Germany) using the TaqMan Universal PCR Master Mix (Applied Biosystems) according to the manufacturer's protocol. Each reaction (total volume 20 μl) for the quantification of either u-PA or u-PAR and 18 s contained 50 ng RNA equivalents as well as 700 nM forward u-PA or u-PAR primer, 700 nM reverse u-PA or u-PAR primer, 700 nM forward 18 s primer, 700 nM reverse 18 s primer, 200 nM u-PA or u-PAR TaqMan probe and 200 nM 18 s
161
TaqMan probe. The reactions were performed in MicroAmp 96-well plates capped with MicroAmp optical film (Applied Biosystems). The reactions were incubated at 95 °C for 10 min followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. Each sample was measured in triplicates. The comparative Ct method was used for relative quantification. The amount of target, normalized to 18S RNA and relative to a calibrator, is given by 2 − ΔΔCT. The ΔΔCT calculation for the relative quantification could be used without running standard curves. Relative expression levels of u-PA and uPAR were statistically analyzed using an unpaired t-test. 3. Results and discussion 3.1. Isolation of the ovine u-PA and u-PAR cDNAs In order to clone the ovine u-PA cDNA sequence, the strategy of joining overlapping PCR fragments was adopted. Three primers for PCR reactions were designed and synthesized for each cDNA according to the consensus conserved regions derived through the nucleotide alignment of known bovine, human, mouse, rat and pig cDNA sequences. With the use of suitable software programs for primer design, six novel cDNA primers were generated, UPAf1, UPAr1, UPAr2 for u-PA and UPARf1, UPARf2, UPARr1 for u-PAR (Table 1, Fig. 1). The produced fragments from the semi-nested PCR of approximately 0.47 kb in size for u-PA and 0.4 kb for u-PAR were resolved in a 1.5% agarose gel electrophoresis and subsequently purified (Fig. 2A, E respectively). The purified fragments were inserted into the pGEM-TEasy vector and three independent clones for each fragment were randomly selected. The clones were sequenced (both strands) twice, to increase the reliability of the obtained sequence information. Subsequent BLAST analysis of the obtained cDNA sequences revealed
Fig. 2. RT-PCR-mediated cloning and purification of the UPA (A–D) and u-PAR (E–H) cDNA fragments, whose contiguous assembly results in the generation of the full-length cDNA clones. (A) Amplification of a cDNA fragment of 0.47 kb using the flanking primers UPAf1/UPAr2. (B) Amplification of a cDNA fragment of 1.23 kb using the flanking primers 5′-RACE inner/UPAr2 containing the 5′-UTR, through a 5′-RACE-PCR approach. (C) Amplification of a cDNA fragment of 1.13 kb, using the flanking primers UPAf3/3′-RACE inner containing the 3′-UTR, through a 3′-RACE-PCR approach. (D) Amplification of a cDNA fragment of 0.4 kb using the flanking primers UPARf2/UPARr1. (E) Amplification of a cDNA fragment of 0.62 kb using the flanking primers UPARf1/UPARr1. (F) Amplification of a cDNA fragment of 0.66 kb using the flanking primers 5′-RACE inner/UPARrRACE containing the 5′-UTR, through a 5′-RACE-PCR approach. (G) Amplification of a cDNA fragment of 0.525 kb, using the flanking primers UPARf3/3′-RACE inner containing the 3′-UTR, through a 3′-RACE-PCR approach. (H) Amplification of a cDNA fragment of 0.61 kb using the flanking primers UPAf1/UPAr1. Numbers on the left indicate the molecular sizes of the marker bands lane (MW).
162
G. Theodorou et al. / Gene 443 (2009) 158–169
very high similarity with bovine u-PA (93%) and u-PAR (96%) cDNAs, as expected because both species are ruminants. The identity scores of the above-noted fragments with other non-ruminant mammals (pig, human rodents), ranged from, 80% to 86% for u-PA and 76% to 84% for u-PAR. The characterization of the ovine u-PA and u-PAR cDNA missing segments, including the 5′- and 3′-untranslated regions (UTRs) was
accomplished by a RACE-PCR approach, using as a primary template total RNA purified from ovine blood neutrophils. A 5′RACE-PCR reaction on the cDNA resulting from the reverse transcription of total RNA, with the use of the UPAr2 and 5′RACE inner for u-PA and UPARrRACE and 5′-RACE inner primers for u-PAR (Table 1; Fig. 1), resulted in the generation of a 5′-allocated 1.23 kb fragment for u-PA (Fig. 2B) and 0.66 kb fragment for u-PAR
Fig. 3. Nucleotide sequence of the u-PA full-length cDNA clone and its cognate putative protein of 433 amino acid residues. The u-PA cDNA sequence, comprised of 2.350 kb, contains the whole coding area, along with the flanking 5′-UTR and 3′-UTR. Note the Kozak-like sequence (indicated by a box) surrounding the ATG (highlighted) translation initiation codon and the stop codon TGA (highlighted). There is a poly-adenylation site (AATAAA, indicated by a box) despite the absence of a poly-A tail.
G. Theodorou et al. / Gene 443 (2009) 158–169
(Fig. 2F). In a similar manner, a 3′-RACE-PCR reaction yielded a 3′allocated 1.13 kb cDNA fragment for u-PA (Fig. 2C) and a 0.525 kb fragment for u-PAR (Fig. 2G) through the use of UPAf3 and 3′RACE inner and UPARf3 and 3′-RACE inner primers respectively for both u-PA and u-PAR (Table 1; Fig. 1). After the insertion of the purified 5′- and 3′-cDNA fragments into the pGEM-T-Easy host vector, three independent clones for each fragment were selected and sequenced from both strands twice. As expected, the 5′-RACEPCR products, exhibited 100% identity with the respective overlapping regions of the fragments obtained from the semi-nested approach. The last step of the characterization of the ovine u-PA cDNA was accomplished through the amplification of a fragment overlapping the area approximate to the UPAf3 and UPAr2 primer sites. For this reaction UPAf1 and UPAr1 primers (Table 1; Fig. 1) were used on a reversed transcribed RNA sample. The fragment resulting from this reaction was 0.61 kb in length (Fig. 2D). Similarly for u-PAR an additional fragment of 0.62 kb in length was amplified using the UPARf1 and UPARr1 primers. Both fragments were subsequently purified and inserted into the pGEM-T-Easy host vector and three independent clones were sequenced once again for both strands twice. 3.2. Nucleotide and amino acid sequence analysis 3.2.1. u-PA The re-constructed full-length nucleotide sequence (Fig. 3), containing the open reading frame (ORF), as well as the flanking
163
3′- and 5′-UTRs, of the ovine u-PA cDNA clone was appropriately deposited in the GenBank database (accession number FJ803199). The ovine u-PA full-length cDNA clone comprised of 2350 bp and it is characterized by a coding region of 1302 bp, and 5′- and 3′UTR regions 129 bp and 919 bp, respectively. The nucleotide sequence surrounding the translation initiation codon AUG corresponding position, 5′-ACCatgA-3′ is only partly similar to the Kozak vertebrate consensus sequence [A/G]XXaugG (Kozak 1981). The 3′-UTR seems to contain one canonical poly-adenylation signal (AAUAAA), located 27 bp upstream of the 3′ end, however no poly(A) tail is present. The deduced amino acid sequence of the putative ovine u-PA protein consists of 433 amino acids and it has a predicted MW of 48.5 kDa and a theoretical pI of 8.2. 3.2.2. u-PAR The re-constructed full-length nucleotide sequence (Fig. 4), containing the open reading frame (ORF), as well as the flanking 3′and 5′-UTRs, of the ovine u-PAR cDNA clone was appropriately deposited in the GenBank database (accession number FJ803200). The full-length ovine u-PAR cDNA is comprised of 1247 bp and it is characterized by a coding region of 957 bp and 5′- and 3′-UTR regions of 44 and 246 bp respectively. The 3′-UTR region contains one canonical poly-adenylation signal (AAAAAG), located 32 bp upstream of the poly(A) tail which has a length of 14 nucleotides. The deduced amino acid sequence of the putative ovine u-PAR protein consists of 318
Fig. 4. Nucleotide sequence of the u-PAR full-length cDNA clone and its cognate putative protein of 318 amino acid residues. The u-PAR cDNA sequence,comprised of 1.247 kb, contains the whole coding area, along with the flanking 5′-UTR and 3′-UTR. Note the ATG (highlighted) translation initiation codon and the stop codon TGA (highlighted). There is a poly-adenylation site (AAAAAG, indicated by a box) along with a poly-A tail (underlined) 14 bases long.
164
G. Theodorou et al. / Gene 443 (2009) 158–169
amino acids and it has a predicted MW of 34.6 kDa and a theoretical pI of 7.9. 3.3. Comparison of amino acid sequences and protein structural characteristics between different species The putative ovine u-PA and u-PAR amino acid sequences, as it is clearly demonstrated in Figs. 5 and 6, bear strong homologies with their counterparts in other organisms. BLAST analysis demonstrated that the ovine u-PA putative protein shared a high degree of amino acid identity with the respective proteins of Bos taurus (88%), Sus scrofa (82%), Homo sapiens (78%), Rattus norvegicus (71%) and Mus musculus (74%) (Fig. 5). Similarly, the ovine u-PAR putative protein exhibited a higher degree of amino acid identity with B.taurus (89%), but a significantly lower one with H. sapiens (60%), R. norvegicus (61%) and M. musculus (57%) (Fig. 6). As expected, the highest degree of identity for both u-PA and u-PAR was obtained with the other ruminant species (bovine). All other remaining monogastric species exhibited lower amino acid identity. The comparative multi-protein identity pattern for both protein products includes the starting methionine, thus confirming the functional role of its corresponding AUG as the initiation codon of the translation process. A phylogenetic tree was built for both proteins from the protein sequences of u-PA and u-PAR of several mammals (Fig. 7). In both cladograms clustering of the ruminant homologues, i.e. the ovine and the bovine proteins, is observed. Examination of the structural composition for both protein products was carried out through comparison to homologue
sequences from other species already submitted to protein databases. The ovine u-PA amino acid sequence, in regard to functionally important domains, revealed a high homology, among different species. A signal peptide of 20 amino acids in length is followed by the mature chain of u-PA of 411 amino acids. The EGF-like domain (29–65 aa) contains a possible binding site for the u-PAR (34–54 aa) (Quax et al., 1998) which is 95% identical to its bovine counterpart. The binding of u-PA to its receptor is species specific (Estreicher et al., 1989) though the very high homology between the ovine and the bovine u-PA proteins may point to a cross-reactivity between the two species. Moreover, an anticipated kringle domain (69–154 aa) which also displays a high identity score (92%) with the bovine equivalent. The kringle domain has been associated with binding of u-PA to lower affinity receptors (Kwak et al., 2005; Tarui et al., 2006). Residues 96, 106, 134, 136 and 144 are identified as ligand binding sites and are conserved among species with the exception of Phe144 which is substituted by Leu in human and porcine protein products. Towards the C-terminal of the ovine u-PA protein a serine protease domain is identified (181–424 aa) containing the active site of the protein (His226, Asp277 and Ser378) as well as three substrate binding sites (Gly372, Ser397 and Gly399). All six residues are conserved among species. A similar examination of ovine u-PAR reveals that it consists of three internally homologous LU (Ly-6 antigen/u-PA receptor) domains of approximately 90 amino acids each connected by linker regions of 14 amino acids each (Behrendt et al., 1991; Ploug et al., 1993). The N-terminal domain I (22–100 aa) is needed for the binding of u-PA, but the entire u-PAR is required for high affinity binding u-PA
Fig. 5. Multiple amino acid sequence alignment of ovine u-PA protein (Ovis aries) with representative u-PA protein family members. Bostaurus (accession number: NP_776572), Sus scrofa (P04185), Homo sapiens (CAI13969), Rattus norvegicus (P29598) and Mus musculus (NP_032899).
G. Theodorou et al. / Gene 443 (2009) 158–169
165
Fig. 6. Multiple amino acid sequence alignment of ovine u-PAR protein (Ovis aries) with representative u-PAR protein family members. Bostaurus (accession number: NP_776848), Homo sapiens (AAF71751), Rattus norvegicus (P49616) and Mus musculus (NP_035243).
(Ploug et al., 1994). u-PAR is linked to the cell membrane via a glycosylphosphatidylinositol anchor attached to the C-terminal hydrophobic domain III (210–292 aa) (Moller et al., 1992; Ploug et al., 1994). Domain III of the ovine u-PAR putative protein shows a higher (5–10%) score of identiy to protein sequences of other species compared to the other two LU domains.
3.4. Homologue modeling of ovine u-PA and u-PAR A molecular three-dimensional model of the ovine u-PA protein was generated, using the automated protein modeling server Swiss-Model (Guex and Peitsch 1997). Human u-PA protein complexed with guanidine (PDB code: 2vntA, Fish et al., 2007), was used as a template for building
Fig. 7. Phylogenetic trees, relating the u-PA (A) and u-PAR (B) putative protein sequences to the homologous members originated from other mammalian species, were constructed through the utilization of PHYLIP program (Number of successful bootstrap replications is indicated in parenthesis).
166
G. Theodorou et al. / Gene 443 (2009) 158–169
the ovine u-PA model as it possessed the highest degree of homology (80%) with the target sequence. A partial structural prediction of the u-PA protein was obtained from the primary structure of the putative polypeptide containing the amino acid residues 28–234. Fig. 8 [(A)–(C)] illustrates the six different views of the three-dimensional (3D) structural model of the u-PA, showing nine beta sheets and two alpha helices. The apparent structure is essentially identical with this previously described for the human u-PA. The u-PAR binding domain and the kringle domain are depicted in Fig. 7B and C respectively. Similarly, a molecular three-dimensional model of the ovine u-PAR protein was generated using as a template the human u-PAR, u-PA and Vitronectin complex (PDB code: 3bt1U, Huai et al., 2008), which possessed the highest degree of homology (80%) with the target
sequence. A partial structure prediction of the u-PAR protein was obtained from the primary structure of the putative polypeptide containing the amino acid residues 22–292. Fig. 9 [(A)–(C)] illustrates the six different views of the three-dimensional (3D) structural model of the u-PA, showing nineteen beta sheets and two alpha helices. Moreover in yellow backbone structure are depicted the three LU domains of the u-PAR protein. 3.5. Real-time analysis of mRNA expression for ovine u-PA and u-PAR in various tissues Fig. 10 presents a comparison of relative mRNA quantification for u-PA and u-PAR between various organ and tissues. Data indicated
Fig. 8. Molecular modeling of the u-PA putative protein. (A–C) Six different views of the three-dimensional (3D) theoretical model of the u-PA putative protein that contains the amino acid residues 28–234, showing nine beta sheets and two alpha helices. (B) The u-PAR binding site (a.a. 36–59) is depicted in yellow. (C) The kringle domain (a.a. 69–154) is depicted in yellow.
G. Theodorou et al. / Gene 443 (2009) 158–169
167
Fig. 9. Molecular modeling of the u-PAR putative catalytic domain. (A)–(C) Six different views of the three-dimensional (3D) theoretical model of the u-PAR putative protein that contains the amino acid residues 22–292, showing 19 beta sheets and two alpha helices. (A) LU domain I (a.a. 22–100) is depicted in yellow. (B) LU domain II (a.a. 114–197) is depicted in yellow. (C) LU domain III (a.a. 210–292) is depicted in yellow.
that the highest expression of u-PA was observed in the adipose tissue, the mammary tissue and the kidney, the lowest in the liver and the cerebellum and intermediate levels in the spleen, adrenal glands, heart and ovaries. The highest expression for u-PAR was also observed in adipose and mammary tissue. In contrast, the kidney along with liver, heart, cerebellum and ovaries displayed the lowest expression. Intermediate levels were observed in spleen and adrenal glands. The above data are consistent with previous studies that report expression of both u-PA and u-PAR in the mammary gland (Busso et
al., 1989; Rabot et al., 2007) and kidney (Bhuvarahamurthy et al., 2005; Ohba et al., 2005). On the other hand, adipose tissue, regarded exclusively as an energy storage organ until a decade ago, is known now as a major endocrine organ. In fact, fat either white or brown, the latter found principally in neonates, can be considered the biggest endocrine organ of the body (Bulcao et al., 2006). White fat comprises of adipocytes, pre-adipocytes, macrophages, endothelial cells, fibroblasts, and leukocytes (Wozniak et al., 2008). These cells produce a number of hormones, such as TNF-alpha, IL-6, IL-8, as well as plasminogen activator inhibitor-1(PAI-1), angiotensin-II, leptin, and
168
G. Theodorou et al. / Gene 443 (2009) 158–169
Fig. 10. u-PA and u-PAR mRNA expression in various tissues and organs. Relative quantities of mRNA were determined in each sample using the Comparative CT method of real-time PCR data analysis using 18 s rRNA as an endogenous control. Values are arithmetical means ± SD.
adiponectin (Hauner 2005). Thus, based on the information available today, the only component of the PA system produced locally in the adipose tissue is PAI-1. Therefore, the present paper is the first reporting expression of u-PA and u-PAR in the adipose tissue of any species. The nature of the cells within the adipose tissue expressing uPA and u-PAR are not known. However, several studies report expression of both genes in macrophages and neutrophils (Politis and Fragou, 2006), endothelial cells (Kliem et al., 2007) and fibroblasts (Iwamoto et al., 2003). Hence, we favour the hypothesis that one or more of these cell types may be responsible for the expression of u-PA and u-PAR in the adipose tissue.
3.7. Conclusions Full length cDNAs for ovine u-PA and u-PAR were characterized. Both sequences, as expected, bear the highest degree of homology with their bovine counterparts. The novel finding of this report is that high levels of expression for both genes were detected in the adipose tissue, strengthening the suggestion that adipose tissue should be considered as an endocrine organ in addition to its well known function as an energy store. Furthermore, higher levels of u-PA and uPAR expression were observed in the mammary gland of involuting compared to those observed in lactating animals, reinforcing the
3.6. Comparative real-time analysis of mRNA expression for ovine u-PA and u-PAR in the mammary gland between lactation and involution Fig. 11 presents a comparison of relative mRNA quantification in the mammary gland for u-PA and u-PAR between two different physiological states; lactation and involution. Data indicated a 7-fold increase of u-PA expression in non-lactating ewes compared to lactating. In a similar fashion, u-PAR expression was 8.5 times higher in non-lactating ewes compared to lactating. This indicates an activation of the u-PA system during the ovine involution (7–14 days following cessation of milk). These findings partially agree with previous studies. More specifically, Rabot et al. (2007) report higher levels of u-PA and u-PAR expression in bovine mammary gland tissue in late involution (14–28 days following cessation of milk) compared to those observed in late lactation (8–12 months of lactation). Moreover, Busso et al. (1989) also reported an increase in u-PA expression during involution of the murine mammary gland. However a direct comparison between our findings and those reported by Rabot et al. (2007) and Busso et al. (1989) is not possible as involution proceeds with different speed in different species. Our findings reinforce the theory that the activation of the u-PA system may play a prominent role in the process of involution of the mammary gland. However, a more extensive expression study needs to be performed in order to identify the exact period of time following cessation of milking when the u-PA system is activated.
Fig. 11. u-PA and u-PAR mRNA expression in the mammary gland in lactating and nonlactating ewes. Relative quantities of mRNA were determined in each sample using the Comparative CT method of real-time PCR data analysis with 18 s rRNA as an endogenous control. Values are arithmetical means ± SEM. (a,bMeans with different letters differ at P b 0.01).
G. Theodorou et al. / Gene 443 (2009) 158–169
theory that the activation of the u-PA system may play a prominent role in the process of involution of the mammary gland. References Behrendt, N., Ploug, M., Patthy, L., Houen, G., Blasi, F., Dano, K., 1991. The ligand-binding domain of the cell surface receptor for urokinase-type plasminogen activator. J. Biol. Chem. 266, 7842–7847. Bhuvarahamurthy, V., et al., 2005. Differential gene expression of urokinase-type plasminogen activator and its receptor in human renal cell carcinoma. Oncol. Rep. 14, 777–782. Bulcao, C., Ferreira, S.R., Giuffrida, F.M., Ribeiro-Filho, F.F., 2006. The new adipose tissue and adipocytokines. Current Diabetes Reviews 2, 19–28. Busso, N., Huarte, J., Vassalli, J.D., Sappino, A.P., Belin, D., 1989. Plasminogen activators in the mouse mammary gland. Decreased expression during lactation. J. Biol. Chem. 264, 7455–7457. Dano, K., et al., 2005. Plasminogen activation and cancer. Thromb. Haemost. 93, 676–681. Estreicher, A., Wohlwend, A., Belin, D., Schleuning, W.D., Vassalli, J.D., 1989. Characterization of the cellular binding site for the urokinase-type plasminogen activator. J. Biol. Chem. 264, 1180–1189. Felsenstein, J., 1989. PHYLIP — Phylogeny Inference Package (Version 3.2). Cladistics 5, 164–166. Fish, P.V., et al., 2007. Selective urokinase-type plasminogen activator inhibitors. 4. 1-(7sulfonamidoisoquinolinyl)guanidines. J. Med. Chem. 50, 2341–2351. Guex, N., Peitsch, M.C., 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18, 2714–2723. Hauner, H., 2005. Secretory factors from human adipose tissue and their functional role. Proc. Nutr. Soc. 64, 163–169. Huai, Q., et al., 2006. Structure of human urokinase plasminogen activator in complex with its receptor. Science 311, 656–659. Iwamoto, J., et al., 2003. Expression of urokinase-type plasminogen activator and its receptor in gastric fibroblasts and effects of nonsteroidal antiinflammatory drugs and prostaglandin. Dig. Dis. Sci. 48, 2247–2256. Jones, D.T., 1999. Protein secondary structure prediction based on position-specific scoring matrices. J. Mol. Biol. 292, 195–202. Kliem, H., et al., 2007. Expression and localisation of extracellular matrix degrading proteases and their inhibitors during the oestrous cycle and after induced luteolysis in the bovine corpus luteum. Reproduction 134, 535–547. Kozak, M., 1981. Mechanism of mRNA recognition by eukaryotic ribosomes during initiation of protein synthesis. Curr. Top. Microbiol. Immunol. 93, 81–123. Kratzschmar, J., Haendler, B., Kojima, S., Rifkin, D.B., Schleuning, W.D., 1993. Bovine urokinase-type plasminogen activator and its receptor: cloning and induction by retinoic acid. Gene 125, 177–183.
169
Kwak, S.H., et al., 2005. The kringle domain of urokinase-type plasminogen activator potentiates LPS-induced neutrophil activation through interaction with {alpha}V {beta}3 integrins. J. Leukocyte Biol. 78, 937–945. Lund, L.R., et al., 2000. Lactational competence and involution of the mouse mammary gland require plasminogen. Development 127, 4481–4492. Moller, L.B., Ploug, M., Blasi, F., 1992. Structural requirements for glycosyl-phosphatidylinositol-anchor attachment in the cellular receptor for urokinase plasminogen activator. Eur. J. Biochem. 208, 493–500. O'Mullane, M.J., Baker, M.S., 1999. Elevated plasminogen receptor expression occurs as a degradative phase event in cellular apoptosis. Immunol. Cell Biol. 77, 249–255. Ohba, K., Miyata, Y., Kanda, S., Koga, S., Hayashi, T., Kanetake, H., 2005. Expression of urokinase-type plasminogen activator, urokinase-type plasminogen activator receptor and plasminogen activator inhibitors in patients with renal cell carcinoma: correlation with tumor associated macrophage and prognosis. J. Urol. 174, 461–465. Ploug, M., Kjalke, M., Ronne, E., Weidle, U., Hoyer-Hansen, G., Dano, K., 1993. Localization of the disulfide bonds in the NH2-terminal domain of the cellular receptor for human urokinase-type plasminogen activator. A domain structure belonging to a novel superfamily of glycolipid-anchored membrane proteins. J. Biol. Chem. 268, 17539–17546. Ploug, M., Ellis, V., Dano, K., 1994. Ligand interaction between urokinase-type plasminogen activator and its receptor probed with 8-anilino-1-naphthalenesulfonate. Evidence for a hydrophobic binding site exposed only on the intact receptor. Biochemistry (Mosc). 33, 8991–8997. Politis, I., 1996. Plasminogen activator system: implications for mammary cell growth and involution. J. Dairy Sci. 79, 1097–1107. Politis, I., Fragou, S., 2006. Vitamin E and its effects on macrophages and neutrophils. In: Preedy, V.R., Watson, R. (Eds.), The Encyclopedia of Vitamin E. CABI Publishing, Oxfordshire, UK, pp. 819–825. Politis, I., Zavizjon, B., Cheli, F., Baldi, A., 2002. Expression of urokinase plasminogen activator receptor in resting and activated bovine neutrophils. J. Dairy Res. 69,195–204. Quax, P.H., et al., 1998. Binding of human urokinase-type plasminogen activator to its receptor: residues involved in species specificity and binding. Arterioscler. Thromb. Vasc. Biol. 18, 693–701. Rabot, A., Sinowatz, F., Berisha, B., Meyer, H.H., Schams, D., 2007. Expression and localization of extracellular matrix-degrading proteinases and their inhibitors in the bovine mammary gland during development, function, and involution. J. Dairy Sci. 90, 740–748. Reuning, U., Little, S.P., Dixon, E.P., Johnstone, E.M., Bang, N.U., 1993. Molecular cloning of cDNA for the bovine urokinase-type plasminogen activator receptor. Thromb. Res. 72, 59–70. Tarui, T., et al., 2006. Direct interaction of the kringle domain of urokinase-type plasminogen activator (uPA) and integrin alpha v beta 3 induces signal transduction and enhances plasminogen activation. Thromb. Haemost. 95, 524–534. Wozniak, S.E., Gee, L.L., Wachtel, M.S., Frezza, E.E., 2008. Adipose tissue: the new endocrine organ? A Review Article. Dig. Dis. Sci. Electronic publication.
Contents lists available at ScienceDirect
Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e
The ovine urokinase plasminogen activator and its receptor cDNAs: Molecular cloning, characterization and expression in various tissues Giorgos Theodorou, Iosif Bizelis ⁎, Emmanuel Rogdakis, Ioannis Politis Department of Animal Science, Agricultural University of Athens, Iera Odos 75, 11855 Athens, Greece
a r t i c l e
i n f o
Article history: Received 30 March 2009 Accepted 13 April 2009 Available online 21 April 2009 Received by A.J. van Wijnen Keywords: Ovine u-PA u-PAR Mammary gland cDNA Homologue model
a b s t r a c t The activation of plasminogen plays a crucial role in a variety of extracellular proteolytic events such as, fibrinolysis, cell migration, ovulation, involution of the mammary gland and the activation of other protease classes and growth factors. In this paper we describe the isolation of the full-length cDNAs of ovine urokinase plasminogen activator (u-PA) and its receptor (u-PAR) using a polymerase chain reaction based strategy. The ovine u-PA cDNA comprised of 2350 bp and it is characterized by a coding region of 1302 bp, and 5′- and 3′UTR regions of 129 and 919 bp, respectively. The deduced amino acid sequence consists of 433 amino acids. The ovine u-PAR cDNA is comprised of 1247 bp and it is characterized by a coding region of 957 bp and 5′and 3′-UTR regions of 44 and 246 bp respectively. The deduced amino acid sequence consists of 318 amino acids. Three-dimensional models of the putative protein products of both cDNAs showed that the proteins bear a high similarity with their human counterparts. Real-time PCR revealed high levels of u-PA expression in the adipose tissue, followed by that in mammary gland and kidney. Lower levels of expression were detected in the adrenal glands, heart, ovaries, spleen, liver and cerebellum. A similar pattern was observed in u-PAR expression with noticeably lower levels of expression in heart, liver and cerebellum. To the best of our knowledge, this is the first paper reporting expression of u-PA and u-PAR in the adipose tissue. These data strengthen the suggestion that adipose tissue functions as an endocrine organ besides an energy storage organ. Furthermore, u-PA and u-PAR mRNA levels were 7 and 8.5 fold higher respectively in involuting mammary tissue obtained from non-lactating ewes compared to that detected in mammary tissue obtained from lactating ewes. These data are consistent with the notion that upregulation of u-PA and u-PAR expression may play a key role in the process of involution of the mammary gland. © 2009 Elsevier B.V. All rights reserved.
1. Introduction The process of plasminogen activation leads to the formation of a serine protease, plasmin, which in turn, is capable of degrading most extracellular proteins. This process is controlled by an interplay between plasminogen activators (PA) and PA inhibitors (PAI). There are two types of PA: urokinase-PA (u-PA) and tissue-PA (t-PA). These two enzymes catalyze the cleavage of the same peptide bond in plasminogen (Arg557–ILe558), but they are antigenically distinct and they are products of different genes (Dano et al. 2005). It is generally believed, even though certain exceptions do exist, that t-PA is involved in the maintenance of fluidity of the extracellular milieu
Abbreviations: u-PA, Urokinase Plasminogen Activator; t-PA, Tissue Plasminogen Activator; u-PAR, Urokinase Plasminogen Activator Receptor; PAI-1, Plasminogen Activator Inhibitor 1; PAI-2, Plasminogen Activator Inhibitor 2; UTR, Untranslated Region; PA, Plasminogen Activator; EGF, Epidermal Growth Factor; ATF, Amino Terminal Fragment; Ly-6, Lymphocyte antigen 6 complex; LU, Ly-6/u-PAR; GPI, Glycosyl, Phospatidyl,Inositol; RACE, Rapid Amplification of cDNA Ends. ⁎ Corresponding author. E-mail address: [email protected] (I. Bizelis). 0378-1119/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2009.04.008
(thrombolysis), while u-PA is involved in the proteolytic events that accompany various tissue remodeling events (i.e involution of the mammary gland). The activity of PA can be limited by the action of PAI. The most important, fast acting, PAI have been designated PAI-1 and PAI-2. Within the ruminant family of animals, only the sequence of the bovine u-PA has been determined. The bovine single-chain u-PA is a glycoprotein consisting of 413 amino acids. The molecule of u-PA has a number of structural and functional domains: 1) the epidermal growth factor (EGF)-like domain, which is structurally similar to the receptor-binding region of EGF, 2) one, so called, kringle domain, and 3) the carboxyl terminal region, which contains the active site of the enzyme. The EGF and the kringle structure make up the amino terminal fragment (ATF) of the u-PA molecule. The ATF is of great biological importance because it mediates binding of u-PA to a specific receptor (u-PAR) present in various cells (Politis 1996). Activation of plasminogen by PA plays a crucial role in various extracellular proteolytic events, such as fibrinolysis, cell migration (i.e. migration of neutrophils to the site of infection, angiogenesis, wound healing, tumour invasion, bacterial invasion), ovulation, mammary gland involution and the activation of other protease classes and
G. Theodorou et al. / Gene 443 (2009) 158–169
growth factors. Furthermore, O'Mullane and Baker (1999), reported that expression of PA is dramatically elevated in the degradative events of cellular apoptosis in U937 cells. The cellular receptor for u-PA (u-PAR) is a membrane protein that binds u-PA with high affinity (dissociation constant = 0.1 to 1 nmol/L). The primary function of u-PAR is to localize plasminogen activation catalyzed by u-PA at cell surface. The rate of plasminogen activation is enhanced when u-PA is bound to its receptor leading to accelerated production of plasmin. Plasmin, so produced, initiates a cascade of reactions, resulting in degradation of extracellular matrix proteins, characteristic of tissue remodeling events. The mature bovine u-PAR protein consists of 310 amino acids and is highly glycosylated with six N-linked glycosylation sites. It is composed of three structurally homologous Ly-6/u-PAR (LU) domains. These domains are characterized by a high cysteine content (9%). The repeats are distantly related since their amino acid homology is lower than 20%. The u-PAR is attached to the plasma membrane by an anchor of glycosol, phosphatidyl and inositol (GPI). The repeat nearest to the N-terminal region binds u-PA at the EGFlike domain of the protein (Kratzschmar et al., 1993; Reuning et al., 1993). The mammary gland is a prime example of tissue that undergoes extensive tissue remodeling throughout its growth and its development. At puberty, mammary development accelerates with ductal elongation and branching, followed by lobulo-alveolar development and maturation during pregnancy. The final result of this process is the development of the secretory epithelium during lactation. After weaning or following cessation of milking in ruminants, major wellcontrolled degenerative events occur as the mammary gland is remodeled in preparation for the next lactation. It is well known that u-PA expression is up-regulated during post-lactational involution in mice. Furthermore, mammary involution was severely compromised in plasmin deficient mice (Lund et al., 2000). Rabot et al. (2007) reported a reduction in the expression of u-PA and u-PAR in early, followed by an increase in expression during late involution in mammary tissue obtained from dairy cows. There is a complete lack of data concerning expression of u-PA and u-PAR in ovine mammary tissue. The objectives of the present study were: 1) isolate and characterize full-length cDNA clones encoding the ovine u-PA and uPAR proteins, 2) describe the major structural characteristics and compare them with those of the respective proteins in other species using bioinformatics and molecular modeling, 3) compare u-PA and uPAR mRNA levels in various tissues and 4) compare u-PA mRNA levels in mammary tissue obtained from lactating and non-lactating (involuting) ovine mammary tissue. 2. Materials and methods 2.1. Animals A total of 12 ewes were used in this study. The ewes were either of the Boutsiko breed or of a synthetic breed (50% Boutsiko, 25% Arta and 25% Chios). Animals were housed within the premises of the experimental farm of the Agricultural University of Athens. Six ewes were lactating (approximately 120 days of lactation) and the remaining were non-lactating (7–14 days following cessation of milk). All animals were slaughtered. The following tissues and organs were removed: udder, adrenal glands, kidney, adipose tissue, heart, lung, ovaries, liver, cerebellum and spleen. Tissues and organs were immediately frozen in liquid nitrogen and then transferred to a −80 °C freezer for storage. In addition to tissues and organs, blood samples were also obtained from all animals prior to slaughter. Blood neutrophils were isolated from all samples following the method described by Politis et al. (2002). Total RNA obtained from a ewe of the synthetic breed was utilized for all cloning procedures described below.
159
2.2. Total RNA purification and subsequent reverse transcription (RT) reactions Total RNA was isolated from ovine tissues and blood neutrophils using the “RNAqueous 4PCR” kit (Ambion, USA) following the manufacturer's protocol. RNA extracted from the various tissues and organs listed in section 2.1 was used for a real-time expression study, while RNA extracted from blood neutrophils was used for all cloning procedures. First-strand cDNA synthesis was carried out with Invitrogen “Thermoscript RT-PCR System”, using 1 μg of purified total RNA. Briefly, total RNA preparations together with 50 μM of oligo-[dT]20, 10 mM of dNTP mix and DEPC-treated water were denatured at 65 °C for 5 min. After adding cDNA synthesis buffer, 100 mM DTT, 40 U RNaseOUT and 15 U of reverse transcriptase up to 20 μl of total reaction volume, an annealing and polymerization step at 60 °C for 1 h was carried out. The reaction was terminated by incubating at 85 °C for 5 min. 2.3. Isolation of cDNA clones encoding the ovine homologues of u-PA and u-PAR using Polymerase Chain Reaction (PCR) (Semi-nested approach) Three primers for each cDNA (UPAf1, UPAr1, UPAr2 for u-PA and UPARf1, UPARf2, UPARr1for u-PAR), shown in Table 1, were designed from highly conserved regions among the published human, mouse, rat, pig and bovine sequences. PCR amplification reactions were carried out using deoxynucleotides, buffers and enzyme (Taq polymerase) concentrations as exactly recommended by the enzyme manufacturer (New England Biolabs, USA). Reactions were performed on a GeneAmp PCR System 2400 thermocycler with an initial denaturation step at 94 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, 62 °C for 30 s and 72 °C for 2 min. A polymerization step at 72 °C for 7 min was added after the completion of 35 cycles. The first step of the semi-nested approach was carried out using the presynthesized ovine cDNA as a template and UPAf1/UPAr1 for u-PA and UPARf1/UPARr1 for u-PAR as a set of primers. The second step was carried out using the first reaction as a template and UPAf1/UPAr2 for u-PA and UPARf2/UPARr1for u-PAR as a set of primers. 2.4. cDNA cloning of the 5′- and 3′-untranslated regions through RACE Reverse transcription procedure, 5′-RACE-PCR outer and 5′-RACEPCR inner reactions were carried out using 1 μg of total purified RNA according to the manufacturer's protocol (Ambion, USA). The amplification reactions were performed using as gene-specific primers UPAr1 (outer) and UPAr2 (inner) for u-PA and UPARr1 (outer) and UPARrRACE (inner) for u-PAR (Table 1; Fig. 1). Reactions were carried out on a GeneAmp PCR System 2400 thermocycler, with an initial denaturation step at 94 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, 62 °C for 30 s and 72 °C for 2 min. A polymerization step at 72 °C for 7 min was added after the completion of 35 cycles. Likewise reverse transcription procedure, 3′-RACE-PCR outer and 3′-RACE-PCR inner reactions were carried out using 1 μg of total Table 1 Nomenclature, nucleotide sequences and corresponding length of all the primers utilized for the molecular cloning and isolation of the u-PA and u-PAR cDNAs.
u-PA
u-PAR
Name
Oligonucleotide sequence (5′ → 3′)
Length
5′-RACE inner 3′-RACE inner UPAf1 UPAf3 UPAr1 UPAr2 UPARf1 UPARf2 UPARf3 UPARr1 UPARrRACE
CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG CGCGGATCCGAATTAATACGACTCACTATAGG GTGGCAGCCTCATCAGTCC AATGCTATGTGCGGCTGACC GAGACCCTTGTGTAGACTCCA TGGGTCAGCCGCACATAGC GGACCTCTGCAGGACCACG GAAACCGCTACCTCGAATGTG AGAAACTTTCCTCATTGACTGC CCTGTCGCTTCCAGACATTG CAGGTTTTGAATCTCCAGGACT
35 nt 32 nt 19 nt 20 nt 21 nt 19 nt 19 nt 21 nt 22 nt 20 nt 22 nt
160
G. Theodorou et al. / Gene 443 (2009) 158–169
Fig. 1. Graphical representation of the cloning strategy designed for the u-PA (A) and u-PAR (B) cDNA isolation. (A) UPAf1, UPAr1 and UPAr2 primers, synthesized according to a phylogenetically conserved region originated from the bovine u-PA cDNA sequence, were utilized in an RT-PCR semi-nested procedure resulting in the production of a 0.47 kb ovine cDNA homologous family member. Through 5′-RACE and 3′-RACE-PCR approaches, three additional cDNA fragments were cloned, with notated length 1.23 kb (5′-RACE inner/ UPAr2), 1.13 kb (UPAf3/3′-RACE inner) and 0.61 kb (UPAf1/UPAr1). (B) UPARf1, UPARf2 and UPARr1 primers, synthesized according to a phylogenetically conserved region originated from the bovine u-PAR cDNA sequence, were utilized in an RT-PCR semi-nested procedure resulting in the production of a 0.4 kb ovine cDNA homologous family member. Through 5′RACE and 3′-RACE-PCR approaches, three additional cDNA fragments were cloned, with notated length 0.66 kb (5′-RACE inner/UPARrRACE), 0.52 kb (UPARf3/3′-RACE inner) and 0.62 kb (UPARf1/UPARr1). Based on all possible partial overlaps among the four clones for each cDNA, two linearly contiguous assemblies of the obtained u-PA and u-PAR cDNAs were generated.
purified RNA according to the manufacturer's protocol (Ambion, USA). The amplification reactions were performed using UPAf1 (outer) and UPAf3 (inner) for u-PA and UPARf1 (outer) and UPARf3 (inner) for uPAR (Fig. 1) as gene-specific primers, according to the FirstChoice RLM-RACE Kit-Ambion (USA). Reactions were carried out on a GeneAmp PCR System 2400 thermocycler, following the same conditions described above. An additional clone was isolated for both u-PA and u-PAR using the respective 3′-RACE-PCR outer reaction as a template and the UPAf1/ UPAr1 set of primers for the first and the UPARf1/UPARr1 set of primers for the latter following the same PCR conditions (Fig. 1). 2.5. Molecular cloning and DNA sequencing analysis of the u-PA and u-PAR PCR fragments The obtained PCR fragments were gel purified using the Qiaquick Gel Extraction Kit (Qiagen, USA), ligated to vector pGEM-T-Easy (Promega, USA), transformed into Escherichia coli JM109 competent cells and plated on appropriate indicator LB-dishes containing ampicillin as a selection reagent. Plasmids carrying the various u-PA cDNA PCR fragments were isolated using the Qiaprep Miniprep Kit (Qiagen, USA) and three independent clones of each fragment were sequenced two times in both directions (Institute of Molecular Biology and Biotechnology, Foundation of Research and Technology, Heraklion, Crete, Greece). 2.6. In silico analysis and molecular modeling of u-PA and u-PAR proteins The primers design was carried out using the OligoAnalyser v.1.2 and OligoExplorer v.1.2 software system (http://molbiol-tools.ca/
molecular_biology_freeware.htm). The functional analysis of the sequenced clones was performed using a conventional BLAST search procedure (http://www.ncbi.nlm.nih.gov/BLAST/), with the support of online supplementary programs (http://biology.semo. edu/cgi-bin/dnatools.pl). The generation of a reliable phylogenetic tree of the u-PA and uPAR proteins was accomplished through the use of ClustalX and PHYLIP (Felsenstein, 1989) programs by comparison of the ovine proteins primary structures with orthologous amino acid sequences from other mammalian species. Sequence alignments for the detection of distinct structural domains and functional motifs throughout the putative proteins were implemented via the utilization of the multiple alignment software package Multalin (http://prodes.toulouse.inra.fr/multalin/ multalin.html). Protein domains were identified in the amino acid sequences through its comparison to related sequences in the Pfam database (http://www.sanger.ac.uk/Software/Pfam/). Secondary structure predictions of the u-PA putative protein were performed by the PSIPRED Protein Structure Prediction Server [http://bioinf.cs. ucl.ac.uk/psipred/], as previously described (Jones 1999). The proteins were modeled by means of the Swiss-Model and SwissPdbViewer molecular graphics modeling packages (http://swissmodel.expasy.org/), according to the similarities of the modeled sequence to known structures, publicly available in the Protein Data Bank (PDB). Residues 28 to 234 of the predicted u-PA polypeptide sequence were appropriately modeled using as a suitable template the 2vntA available structure of the, most highly homologous, Human Urokinase-Type Plasminogen Activator Inhibitor Complex With a 1-(7sulphoamidoisoquinolinyl) guanidine (Fish et al., 2007) and a three-
G. Theodorou et al. / Gene 443 (2009) 158–169
dimensional (3D) molecular model of the putative u-PA protein obtained. Residues 22 to 292 of the predicted UPAR polypeptide sequence were appropriately modeled using as a suitable template the 3bt1U available structure of the, most highly homologous, human u-PAR, u-PA and Vitronectin complex (Huai et al., 2006) and a threedimensional (3D) molecular model of the putative u-PAR protein obtained. 2.7. Real-time quantitative PCR for the expression of the u-PA and u-PAR genes in the mammary gland and the construction of an expression profile in other tissues Relative levels of mRNA were quantified with real-time, quantitative RT-PCR using fluorescent TaqMan technology. Two custom TaqMan® MGB™ Probes for u-PA and u-PAR using FAM as a reporter dye were used (Applied Biosystems). A TaqMan® MGB™ Probe using VIC as a reporter dye to quantify 18 s rRNA was used in multiplex reactions as an endogenous control to normalize the amount of sample RNA (Applied Biosystems). Equal amounts of total RNA were reverse transcribed with the Qiagen “Omniscript reverse transcription” kit (Qiagen, USA), according to the manufacturer's instructions using random hexamers (Applied Biosystems). The PCR was performed in the 7500 real-time PCR System (Applied Biosystems, Weiterstadt, Germany) using the TaqMan Universal PCR Master Mix (Applied Biosystems) according to the manufacturer's protocol. Each reaction (total volume 20 μl) for the quantification of either u-PA or u-PAR and 18 s contained 50 ng RNA equivalents as well as 700 nM forward u-PA or u-PAR primer, 700 nM reverse u-PA or u-PAR primer, 700 nM forward 18 s primer, 700 nM reverse 18 s primer, 200 nM u-PA or u-PAR TaqMan probe and 200 nM 18 s
161
TaqMan probe. The reactions were performed in MicroAmp 96-well plates capped with MicroAmp optical film (Applied Biosystems). The reactions were incubated at 95 °C for 10 min followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. Each sample was measured in triplicates. The comparative Ct method was used for relative quantification. The amount of target, normalized to 18S RNA and relative to a calibrator, is given by 2 − ΔΔCT. The ΔΔCT calculation for the relative quantification could be used without running standard curves. Relative expression levels of u-PA and uPAR were statistically analyzed using an unpaired t-test. 3. Results and discussion 3.1. Isolation of the ovine u-PA and u-PAR cDNAs In order to clone the ovine u-PA cDNA sequence, the strategy of joining overlapping PCR fragments was adopted. Three primers for PCR reactions were designed and synthesized for each cDNA according to the consensus conserved regions derived through the nucleotide alignment of known bovine, human, mouse, rat and pig cDNA sequences. With the use of suitable software programs for primer design, six novel cDNA primers were generated, UPAf1, UPAr1, UPAr2 for u-PA and UPARf1, UPARf2, UPARr1 for u-PAR (Table 1, Fig. 1). The produced fragments from the semi-nested PCR of approximately 0.47 kb in size for u-PA and 0.4 kb for u-PAR were resolved in a 1.5% agarose gel electrophoresis and subsequently purified (Fig. 2A, E respectively). The purified fragments were inserted into the pGEM-TEasy vector and three independent clones for each fragment were randomly selected. The clones were sequenced (both strands) twice, to increase the reliability of the obtained sequence information. Subsequent BLAST analysis of the obtained cDNA sequences revealed
Fig. 2. RT-PCR-mediated cloning and purification of the UPA (A–D) and u-PAR (E–H) cDNA fragments, whose contiguous assembly results in the generation of the full-length cDNA clones. (A) Amplification of a cDNA fragment of 0.47 kb using the flanking primers UPAf1/UPAr2. (B) Amplification of a cDNA fragment of 1.23 kb using the flanking primers 5′-RACE inner/UPAr2 containing the 5′-UTR, through a 5′-RACE-PCR approach. (C) Amplification of a cDNA fragment of 1.13 kb, using the flanking primers UPAf3/3′-RACE inner containing the 3′-UTR, through a 3′-RACE-PCR approach. (D) Amplification of a cDNA fragment of 0.4 kb using the flanking primers UPARf2/UPARr1. (E) Amplification of a cDNA fragment of 0.62 kb using the flanking primers UPARf1/UPARr1. (F) Amplification of a cDNA fragment of 0.66 kb using the flanking primers 5′-RACE inner/UPARrRACE containing the 5′-UTR, through a 5′-RACE-PCR approach. (G) Amplification of a cDNA fragment of 0.525 kb, using the flanking primers UPARf3/3′-RACE inner containing the 3′-UTR, through a 3′-RACE-PCR approach. (H) Amplification of a cDNA fragment of 0.61 kb using the flanking primers UPAf1/UPAr1. Numbers on the left indicate the molecular sizes of the marker bands lane (MW).
162
G. Theodorou et al. / Gene 443 (2009) 158–169
very high similarity with bovine u-PA (93%) and u-PAR (96%) cDNAs, as expected because both species are ruminants. The identity scores of the above-noted fragments with other non-ruminant mammals (pig, human rodents), ranged from, 80% to 86% for u-PA and 76% to 84% for u-PAR. The characterization of the ovine u-PA and u-PAR cDNA missing segments, including the 5′- and 3′-untranslated regions (UTRs) was
accomplished by a RACE-PCR approach, using as a primary template total RNA purified from ovine blood neutrophils. A 5′RACE-PCR reaction on the cDNA resulting from the reverse transcription of total RNA, with the use of the UPAr2 and 5′RACE inner for u-PA and UPARrRACE and 5′-RACE inner primers for u-PAR (Table 1; Fig. 1), resulted in the generation of a 5′-allocated 1.23 kb fragment for u-PA (Fig. 2B) and 0.66 kb fragment for u-PAR
Fig. 3. Nucleotide sequence of the u-PA full-length cDNA clone and its cognate putative protein of 433 amino acid residues. The u-PA cDNA sequence, comprised of 2.350 kb, contains the whole coding area, along with the flanking 5′-UTR and 3′-UTR. Note the Kozak-like sequence (indicated by a box) surrounding the ATG (highlighted) translation initiation codon and the stop codon TGA (highlighted). There is a poly-adenylation site (AATAAA, indicated by a box) despite the absence of a poly-A tail.
G. Theodorou et al. / Gene 443 (2009) 158–169
(Fig. 2F). In a similar manner, a 3′-RACE-PCR reaction yielded a 3′allocated 1.13 kb cDNA fragment for u-PA (Fig. 2C) and a 0.525 kb fragment for u-PAR (Fig. 2G) through the use of UPAf3 and 3′RACE inner and UPARf3 and 3′-RACE inner primers respectively for both u-PA and u-PAR (Table 1; Fig. 1). After the insertion of the purified 5′- and 3′-cDNA fragments into the pGEM-T-Easy host vector, three independent clones for each fragment were selected and sequenced from both strands twice. As expected, the 5′-RACEPCR products, exhibited 100% identity with the respective overlapping regions of the fragments obtained from the semi-nested approach. The last step of the characterization of the ovine u-PA cDNA was accomplished through the amplification of a fragment overlapping the area approximate to the UPAf3 and UPAr2 primer sites. For this reaction UPAf1 and UPAr1 primers (Table 1; Fig. 1) were used on a reversed transcribed RNA sample. The fragment resulting from this reaction was 0.61 kb in length (Fig. 2D). Similarly for u-PAR an additional fragment of 0.62 kb in length was amplified using the UPARf1 and UPARr1 primers. Both fragments were subsequently purified and inserted into the pGEM-T-Easy host vector and three independent clones were sequenced once again for both strands twice. 3.2. Nucleotide and amino acid sequence analysis 3.2.1. u-PA The re-constructed full-length nucleotide sequence (Fig. 3), containing the open reading frame (ORF), as well as the flanking
163
3′- and 5′-UTRs, of the ovine u-PA cDNA clone was appropriately deposited in the GenBank database (accession number FJ803199). The ovine u-PA full-length cDNA clone comprised of 2350 bp and it is characterized by a coding region of 1302 bp, and 5′- and 3′UTR regions 129 bp and 919 bp, respectively. The nucleotide sequence surrounding the translation initiation codon AUG corresponding position, 5′-ACCatgA-3′ is only partly similar to the Kozak vertebrate consensus sequence [A/G]XXaugG (Kozak 1981). The 3′-UTR seems to contain one canonical poly-adenylation signal (AAUAAA), located 27 bp upstream of the 3′ end, however no poly(A) tail is present. The deduced amino acid sequence of the putative ovine u-PA protein consists of 433 amino acids and it has a predicted MW of 48.5 kDa and a theoretical pI of 8.2. 3.2.2. u-PAR The re-constructed full-length nucleotide sequence (Fig. 4), containing the open reading frame (ORF), as well as the flanking 3′and 5′-UTRs, of the ovine u-PAR cDNA clone was appropriately deposited in the GenBank database (accession number FJ803200). The full-length ovine u-PAR cDNA is comprised of 1247 bp and it is characterized by a coding region of 957 bp and 5′- and 3′-UTR regions of 44 and 246 bp respectively. The 3′-UTR region contains one canonical poly-adenylation signal (AAAAAG), located 32 bp upstream of the poly(A) tail which has a length of 14 nucleotides. The deduced amino acid sequence of the putative ovine u-PAR protein consists of 318
Fig. 4. Nucleotide sequence of the u-PAR full-length cDNA clone and its cognate putative protein of 318 amino acid residues. The u-PAR cDNA sequence,comprised of 1.247 kb, contains the whole coding area, along with the flanking 5′-UTR and 3′-UTR. Note the ATG (highlighted) translation initiation codon and the stop codon TGA (highlighted). There is a poly-adenylation site (AAAAAG, indicated by a box) along with a poly-A tail (underlined) 14 bases long.
164
G. Theodorou et al. / Gene 443 (2009) 158–169
amino acids and it has a predicted MW of 34.6 kDa and a theoretical pI of 7.9. 3.3. Comparison of amino acid sequences and protein structural characteristics between different species The putative ovine u-PA and u-PAR amino acid sequences, as it is clearly demonstrated in Figs. 5 and 6, bear strong homologies with their counterparts in other organisms. BLAST analysis demonstrated that the ovine u-PA putative protein shared a high degree of amino acid identity with the respective proteins of Bos taurus (88%), Sus scrofa (82%), Homo sapiens (78%), Rattus norvegicus (71%) and Mus musculus (74%) (Fig. 5). Similarly, the ovine u-PAR putative protein exhibited a higher degree of amino acid identity with B.taurus (89%), but a significantly lower one with H. sapiens (60%), R. norvegicus (61%) and M. musculus (57%) (Fig. 6). As expected, the highest degree of identity for both u-PA and u-PAR was obtained with the other ruminant species (bovine). All other remaining monogastric species exhibited lower amino acid identity. The comparative multi-protein identity pattern for both protein products includes the starting methionine, thus confirming the functional role of its corresponding AUG as the initiation codon of the translation process. A phylogenetic tree was built for both proteins from the protein sequences of u-PA and u-PAR of several mammals (Fig. 7). In both cladograms clustering of the ruminant homologues, i.e. the ovine and the bovine proteins, is observed. Examination of the structural composition for both protein products was carried out through comparison to homologue
sequences from other species already submitted to protein databases. The ovine u-PA amino acid sequence, in regard to functionally important domains, revealed a high homology, among different species. A signal peptide of 20 amino acids in length is followed by the mature chain of u-PA of 411 amino acids. The EGF-like domain (29–65 aa) contains a possible binding site for the u-PAR (34–54 aa) (Quax et al., 1998) which is 95% identical to its bovine counterpart. The binding of u-PA to its receptor is species specific (Estreicher et al., 1989) though the very high homology between the ovine and the bovine u-PA proteins may point to a cross-reactivity between the two species. Moreover, an anticipated kringle domain (69–154 aa) which also displays a high identity score (92%) with the bovine equivalent. The kringle domain has been associated with binding of u-PA to lower affinity receptors (Kwak et al., 2005; Tarui et al., 2006). Residues 96, 106, 134, 136 and 144 are identified as ligand binding sites and are conserved among species with the exception of Phe144 which is substituted by Leu in human and porcine protein products. Towards the C-terminal of the ovine u-PA protein a serine protease domain is identified (181–424 aa) containing the active site of the protein (His226, Asp277 and Ser378) as well as three substrate binding sites (Gly372, Ser397 and Gly399). All six residues are conserved among species. A similar examination of ovine u-PAR reveals that it consists of three internally homologous LU (Ly-6 antigen/u-PA receptor) domains of approximately 90 amino acids each connected by linker regions of 14 amino acids each (Behrendt et al., 1991; Ploug et al., 1993). The N-terminal domain I (22–100 aa) is needed for the binding of u-PA, but the entire u-PAR is required for high affinity binding u-PA
Fig. 5. Multiple amino acid sequence alignment of ovine u-PA protein (Ovis aries) with representative u-PA protein family members. Bostaurus (accession number: NP_776572), Sus scrofa (P04185), Homo sapiens (CAI13969), Rattus norvegicus (P29598) and Mus musculus (NP_032899).
G. Theodorou et al. / Gene 443 (2009) 158–169
165
Fig. 6. Multiple amino acid sequence alignment of ovine u-PAR protein (Ovis aries) with representative u-PAR protein family members. Bostaurus (accession number: NP_776848), Homo sapiens (AAF71751), Rattus norvegicus (P49616) and Mus musculus (NP_035243).
(Ploug et al., 1994). u-PAR is linked to the cell membrane via a glycosylphosphatidylinositol anchor attached to the C-terminal hydrophobic domain III (210–292 aa) (Moller et al., 1992; Ploug et al., 1994). Domain III of the ovine u-PAR putative protein shows a higher (5–10%) score of identiy to protein sequences of other species compared to the other two LU domains.
3.4. Homologue modeling of ovine u-PA and u-PAR A molecular three-dimensional model of the ovine u-PA protein was generated, using the automated protein modeling server Swiss-Model (Guex and Peitsch 1997). Human u-PA protein complexed with guanidine (PDB code: 2vntA, Fish et al., 2007), was used as a template for building
Fig. 7. Phylogenetic trees, relating the u-PA (A) and u-PAR (B) putative protein sequences to the homologous members originated from other mammalian species, were constructed through the utilization of PHYLIP program (Number of successful bootstrap replications is indicated in parenthesis).
166
G. Theodorou et al. / Gene 443 (2009) 158–169
the ovine u-PA model as it possessed the highest degree of homology (80%) with the target sequence. A partial structural prediction of the u-PA protein was obtained from the primary structure of the putative polypeptide containing the amino acid residues 28–234. Fig. 8 [(A)–(C)] illustrates the six different views of the three-dimensional (3D) structural model of the u-PA, showing nine beta sheets and two alpha helices. The apparent structure is essentially identical with this previously described for the human u-PA. The u-PAR binding domain and the kringle domain are depicted in Fig. 7B and C respectively. Similarly, a molecular three-dimensional model of the ovine u-PAR protein was generated using as a template the human u-PAR, u-PA and Vitronectin complex (PDB code: 3bt1U, Huai et al., 2008), which possessed the highest degree of homology (80%) with the target
sequence. A partial structure prediction of the u-PAR protein was obtained from the primary structure of the putative polypeptide containing the amino acid residues 22–292. Fig. 9 [(A)–(C)] illustrates the six different views of the three-dimensional (3D) structural model of the u-PA, showing nineteen beta sheets and two alpha helices. Moreover in yellow backbone structure are depicted the three LU domains of the u-PAR protein. 3.5. Real-time analysis of mRNA expression for ovine u-PA and u-PAR in various tissues Fig. 10 presents a comparison of relative mRNA quantification for u-PA and u-PAR between various organ and tissues. Data indicated
Fig. 8. Molecular modeling of the u-PA putative protein. (A–C) Six different views of the three-dimensional (3D) theoretical model of the u-PA putative protein that contains the amino acid residues 28–234, showing nine beta sheets and two alpha helices. (B) The u-PAR binding site (a.a. 36–59) is depicted in yellow. (C) The kringle domain (a.a. 69–154) is depicted in yellow.
G. Theodorou et al. / Gene 443 (2009) 158–169
167
Fig. 9. Molecular modeling of the u-PAR putative catalytic domain. (A)–(C) Six different views of the three-dimensional (3D) theoretical model of the u-PAR putative protein that contains the amino acid residues 22–292, showing 19 beta sheets and two alpha helices. (A) LU domain I (a.a. 22–100) is depicted in yellow. (B) LU domain II (a.a. 114–197) is depicted in yellow. (C) LU domain III (a.a. 210–292) is depicted in yellow.
that the highest expression of u-PA was observed in the adipose tissue, the mammary tissue and the kidney, the lowest in the liver and the cerebellum and intermediate levels in the spleen, adrenal glands, heart and ovaries. The highest expression for u-PAR was also observed in adipose and mammary tissue. In contrast, the kidney along with liver, heart, cerebellum and ovaries displayed the lowest expression. Intermediate levels were observed in spleen and adrenal glands. The above data are consistent with previous studies that report expression of both u-PA and u-PAR in the mammary gland (Busso et
al., 1989; Rabot et al., 2007) and kidney (Bhuvarahamurthy et al., 2005; Ohba et al., 2005). On the other hand, adipose tissue, regarded exclusively as an energy storage organ until a decade ago, is known now as a major endocrine organ. In fact, fat either white or brown, the latter found principally in neonates, can be considered the biggest endocrine organ of the body (Bulcao et al., 2006). White fat comprises of adipocytes, pre-adipocytes, macrophages, endothelial cells, fibroblasts, and leukocytes (Wozniak et al., 2008). These cells produce a number of hormones, such as TNF-alpha, IL-6, IL-8, as well as plasminogen activator inhibitor-1(PAI-1), angiotensin-II, leptin, and
168
G. Theodorou et al. / Gene 443 (2009) 158–169
Fig. 10. u-PA and u-PAR mRNA expression in various tissues and organs. Relative quantities of mRNA were determined in each sample using the Comparative CT method of real-time PCR data analysis using 18 s rRNA as an endogenous control. Values are arithmetical means ± SD.
adiponectin (Hauner 2005). Thus, based on the information available today, the only component of the PA system produced locally in the adipose tissue is PAI-1. Therefore, the present paper is the first reporting expression of u-PA and u-PAR in the adipose tissue of any species. The nature of the cells within the adipose tissue expressing uPA and u-PAR are not known. However, several studies report expression of both genes in macrophages and neutrophils (Politis and Fragou, 2006), endothelial cells (Kliem et al., 2007) and fibroblasts (Iwamoto et al., 2003). Hence, we favour the hypothesis that one or more of these cell types may be responsible for the expression of u-PA and u-PAR in the adipose tissue.
3.7. Conclusions Full length cDNAs for ovine u-PA and u-PAR were characterized. Both sequences, as expected, bear the highest degree of homology with their bovine counterparts. The novel finding of this report is that high levels of expression for both genes were detected in the adipose tissue, strengthening the suggestion that adipose tissue should be considered as an endocrine organ in addition to its well known function as an energy store. Furthermore, higher levels of u-PA and uPAR expression were observed in the mammary gland of involuting compared to those observed in lactating animals, reinforcing the
3.6. Comparative real-time analysis of mRNA expression for ovine u-PA and u-PAR in the mammary gland between lactation and involution Fig. 11 presents a comparison of relative mRNA quantification in the mammary gland for u-PA and u-PAR between two different physiological states; lactation and involution. Data indicated a 7-fold increase of u-PA expression in non-lactating ewes compared to lactating. In a similar fashion, u-PAR expression was 8.5 times higher in non-lactating ewes compared to lactating. This indicates an activation of the u-PA system during the ovine involution (7–14 days following cessation of milk). These findings partially agree with previous studies. More specifically, Rabot et al. (2007) report higher levels of u-PA and u-PAR expression in bovine mammary gland tissue in late involution (14–28 days following cessation of milk) compared to those observed in late lactation (8–12 months of lactation). Moreover, Busso et al. (1989) also reported an increase in u-PA expression during involution of the murine mammary gland. However a direct comparison between our findings and those reported by Rabot et al. (2007) and Busso et al. (1989) is not possible as involution proceeds with different speed in different species. Our findings reinforce the theory that the activation of the u-PA system may play a prominent role in the process of involution of the mammary gland. However, a more extensive expression study needs to be performed in order to identify the exact period of time following cessation of milking when the u-PA system is activated.
Fig. 11. u-PA and u-PAR mRNA expression in the mammary gland in lactating and nonlactating ewes. Relative quantities of mRNA were determined in each sample using the Comparative CT method of real-time PCR data analysis with 18 s rRNA as an endogenous control. Values are arithmetical means ± SEM. (a,bMeans with different letters differ at P b 0.01).
G. Theodorou et al. / Gene 443 (2009) 158–169
theory that the activation of the u-PA system may play a prominent role in the process of involution of the mammary gland. References Behrendt, N., Ploug, M., Patthy, L., Houen, G., Blasi, F., Dano, K., 1991. The ligand-binding domain of the cell surface receptor for urokinase-type plasminogen activator. J. Biol. Chem. 266, 7842–7847. Bhuvarahamurthy, V., et al., 2005. Differential gene expression of urokinase-type plasminogen activator and its receptor in human renal cell carcinoma. Oncol. Rep. 14, 777–782. Bulcao, C., Ferreira, S.R., Giuffrida, F.M., Ribeiro-Filho, F.F., 2006. The new adipose tissue and adipocytokines. Current Diabetes Reviews 2, 19–28. Busso, N., Huarte, J., Vassalli, J.D., Sappino, A.P., Belin, D., 1989. Plasminogen activators in the mouse mammary gland. Decreased expression during lactation. J. Biol. Chem. 264, 7455–7457. Dano, K., et al., 2005. Plasminogen activation and cancer. Thromb. Haemost. 93, 676–681. Estreicher, A., Wohlwend, A., Belin, D., Schleuning, W.D., Vassalli, J.D., 1989. Characterization of the cellular binding site for the urokinase-type plasminogen activator. J. Biol. Chem. 264, 1180–1189. Felsenstein, J., 1989. PHYLIP — Phylogeny Inference Package (Version 3.2). Cladistics 5, 164–166. Fish, P.V., et al., 2007. Selective urokinase-type plasminogen activator inhibitors. 4. 1-(7sulfonamidoisoquinolinyl)guanidines. J. Med. Chem. 50, 2341–2351. Guex, N., Peitsch, M.C., 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18, 2714–2723. Hauner, H., 2005. Secretory factors from human adipose tissue and their functional role. Proc. Nutr. Soc. 64, 163–169. Huai, Q., et al., 2006. Structure of human urokinase plasminogen activator in complex with its receptor. Science 311, 656–659. Iwamoto, J., et al., 2003. Expression of urokinase-type plasminogen activator and its receptor in gastric fibroblasts and effects of nonsteroidal antiinflammatory drugs and prostaglandin. Dig. Dis. Sci. 48, 2247–2256. Jones, D.T., 1999. Protein secondary structure prediction based on position-specific scoring matrices. J. Mol. Biol. 292, 195–202. Kliem, H., et al., 2007. Expression and localisation of extracellular matrix degrading proteases and their inhibitors during the oestrous cycle and after induced luteolysis in the bovine corpus luteum. Reproduction 134, 535–547. Kozak, M., 1981. Mechanism of mRNA recognition by eukaryotic ribosomes during initiation of protein synthesis. Curr. Top. Microbiol. Immunol. 93, 81–123. Kratzschmar, J., Haendler, B., Kojima, S., Rifkin, D.B., Schleuning, W.D., 1993. Bovine urokinase-type plasminogen activator and its receptor: cloning and induction by retinoic acid. Gene 125, 177–183.
169
Kwak, S.H., et al., 2005. The kringle domain of urokinase-type plasminogen activator potentiates LPS-induced neutrophil activation through interaction with {alpha}V {beta}3 integrins. J. Leukocyte Biol. 78, 937–945. Lund, L.R., et al., 2000. Lactational competence and involution of the mouse mammary gland require plasminogen. Development 127, 4481–4492. Moller, L.B., Ploug, M., Blasi, F., 1992. Structural requirements for glycosyl-phosphatidylinositol-anchor attachment in the cellular receptor for urokinase plasminogen activator. Eur. J. Biochem. 208, 493–500. O'Mullane, M.J., Baker, M.S., 1999. Elevated plasminogen receptor expression occurs as a degradative phase event in cellular apoptosis. Immunol. Cell Biol. 77, 249–255. Ohba, K., Miyata, Y., Kanda, S., Koga, S., Hayashi, T., Kanetake, H., 2005. Expression of urokinase-type plasminogen activator, urokinase-type plasminogen activator receptor and plasminogen activator inhibitors in patients with renal cell carcinoma: correlation with tumor associated macrophage and prognosis. J. Urol. 174, 461–465. Ploug, M., Kjalke, M., Ronne, E., Weidle, U., Hoyer-Hansen, G., Dano, K., 1993. Localization of the disulfide bonds in the NH2-terminal domain of the cellular receptor for human urokinase-type plasminogen activator. A domain structure belonging to a novel superfamily of glycolipid-anchored membrane proteins. J. Biol. Chem. 268, 17539–17546. Ploug, M., Ellis, V., Dano, K., 1994. Ligand interaction between urokinase-type plasminogen activator and its receptor probed with 8-anilino-1-naphthalenesulfonate. Evidence for a hydrophobic binding site exposed only on the intact receptor. Biochemistry (Mosc). 33, 8991–8997. Politis, I., 1996. Plasminogen activator system: implications for mammary cell growth and involution. J. Dairy Sci. 79, 1097–1107. Politis, I., Fragou, S., 2006. Vitamin E and its effects on macrophages and neutrophils. In: Preedy, V.R., Watson, R. (Eds.), The Encyclopedia of Vitamin E. CABI Publishing, Oxfordshire, UK, pp. 819–825. Politis, I., Zavizjon, B., Cheli, F., Baldi, A., 2002. Expression of urokinase plasminogen activator receptor in resting and activated bovine neutrophils. J. Dairy Res. 69,195–204. Quax, P.H., et al., 1998. Binding of human urokinase-type plasminogen activator to its receptor: residues involved in species specificity and binding. Arterioscler. Thromb. Vasc. Biol. 18, 693–701. Rabot, A., Sinowatz, F., Berisha, B., Meyer, H.H., Schams, D., 2007. Expression and localization of extracellular matrix-degrading proteinases and their inhibitors in the bovine mammary gland during development, function, and involution. J. Dairy Sci. 90, 740–748. Reuning, U., Little, S.P., Dixon, E.P., Johnstone, E.M., Bang, N.U., 1993. Molecular cloning of cDNA for the bovine urokinase-type plasminogen activator receptor. Thromb. Res. 72, 59–70. Tarui, T., et al., 2006. Direct interaction of the kringle domain of urokinase-type plasminogen activator (uPA) and integrin alpha v beta 3 induces signal transduction and enhances plasminogen activation. Thromb. Haemost. 95, 524–534. Wozniak, S.E., Gee, L.L., Wachtel, M.S., Frezza, E.E., 2008. Adipose tissue: the new endocrine organ? A Review Article. Dig. Dis. Sci. Electronic publication.