- Email: [email protected]
The Phylogenetic Relationships of “Predatory Water-Fleas” (Cladocera: Onychopoda, Haplopoda) Inferred from 12S rDNA
Molecular Phylogenetics and Evolution Vol. 19, No. 1, April, pp. 105–113, 2001 doi:10.1006/mpev.2000.0901, available online at http://www.idealibrary.com on
The Phylogenetic Relationships of “Predatory Water-Fleas” (Cladocera: Onychopoda, Haplopoda) Inferred from 12S rDNA Stefan Richter,* Anke Braband,* Nikolai Aladin,† and Gerhard Scholtz* *Vergleichende Zoologie, Institut fu¨r Biologie, Humboldt-Universita¨t zu Berlin, Philippstr. 13, 10115 Berlin, Germany; and †Zoological Institute, Russian Academy of Science, Universitetskaya nab., 1, 199034 St. Petersburg, Russian Federation Received April 25, 2000
Within the Cladocera, the water-fleas, four major taxa can be distinguished: Anomopoda, Ctenopoda, Haplopoda, and Onychopoda. Haplopoda and Onychopoda are called “predatory water-fleas.” The Haplopoda is monotypic; its only representative, Leptodora kindtii, is common in palearctic and nearctic freshwater bodies. The Onychopoda show a remarkable geographic distribution. Most of the described species are restricted to the Caspian Sea, the Aral Sea, and peripheral areas of the Black Sea, including the Sea of Azov—all remnants of the Eastern Paratethys. The remaining onychopods are either freshwater inhabitants or marine animals, widespread in the world oceans. We present molecular evidence for a sister group relationship between Haplopoda and Onychopoda within the Cladocera. The Onychopoda and its three families are monophyletic. We suggest an independent invasion into the Ponto–Caspian basin at least three times, twice originating in the palearctic freshwater bodies and once starting from the world oceans. © 2001 Academic Press
INTRODUCTION The Cladocera, the water-fleas, is a highly diverse group which plays an important role in the ecology of freshwater habitats. In contrast to other branchiopod taxa (Anostraca, Notostraca, and Conchostraca) whose representatives are inhabitants mainly of temporary waters, most cladoceran species live in permanent freshwater pools, and few species live in the sea. Four higher taxa within the Cladocera can be distinguished: Ctenopoda (e.g., Sida, Holopedium), Anomopoda (e.g., Daphnia, Chydorus, Bosmina), Haplopoda (Leptodora kindtii), and Onychopoda (e.g., Polyphemus, Bythotrephes, Podon). The monophyly of the entire Cladocera has been doubted (Schminke, 1981, 1996; Fryer, 1987) but some recent analyses based on morphological and molecular data support a monophyletic Cladocera (Walossek, 1993; Martin and Cash-Clark, 1995; Olesen, 1998; Negrea et al., 1999; Spears and Abele, 2000; Braband et al., 2000). The phylogenetic relation-
ships within the Cladocera are also a matter of debate. Martin and Cash-Clark (1995) suggested a sister group relationship between the Onychopoda and the monotypic Haplopoda. To this taxon the Anomopoda is the sister group and the Ctenopoda is the sister group to all other Cladocera. A sister group relationship between Haplopoda and Onychopoda, united as Gymnomera (originally introduced in 1867 by G. O. Sars), is also favored by Olesen (1998) and is supported by 16S rDNA data (Schwenk et al., 1998) and by 18S rDNA data (Taylor et al., 1999). This is in contrast to the view that the Haplopoda with free-living larvae (metanauplius) is separated from all other cladocerans with direct development, which are united as Eucladocera (e.g., Eriksson, 1934; Wingstrand, 1978; Bowman and Abele, 1982; Gruner, 1993; Negrea et al., 1999). Interestingly enough, even this view has been supported by 18S rDNA data (Spears and Abele, 2000). Here we want to focus on the relationships of and within the Onychopoda. Two groups of the Cladocera, the monotypic Haplopoda and the Onychopoda, are often called “predatory” in contrast to filter-feeders (e.g., Rivier, 1998), although the term “macrophagous” would be more appropriate because some Onychopoda prefer to “predate” algae. The monophyly of the Onychopoda has been suggested based on morphological data (Martin and Cash-Clark, 1995; Olesen, 1998) but no molecular analysis so far comprises at least one representative of each of the three families within the Onychopoda (Polyphemidae, Cercopagididae, Podonidae). Within the Onychopoda, Martin and CashClark (1995) suggested a sister group relationship between Cercopagididae and Podonidae. Many representatives of the Onychopoda possess a remarkable general appearance with extensions of head and carapace valves (Fig. 1) but the geographic distribution of the entire taxon is equally remarkable. Thirteen of 14 species of the family Cercopagididae, 1 of 2 species of the Polyphemidae, and 9 of 17 species of the Podonidae (species numbers according to Rivier (1998)) are restricted to the Ponto–Caspian basin, comprising the Black Sea, Caspian Sea, and Aral Sea, all
105
1055-7903/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
106
RICHTER ET AL.
the last 100 years (Sars, 1902; Gibitz, 1922; Mordukhai-Boltovskoi, 1966; Mordukhai-Boltovskoi and Rivier, 1987; Potts and Durning, 1980; Aladin, 1995; Rivier, 1998; Dumont, 1998a). In the present study we analyzed the relationships within and of the Onychopoda using a partial sequence of the 12S rDNA. The monophyly of the Gymnomera, Onychopoda, Cercopagididae, and Podonidae is supported. The results are discussed with respect to geological changes in the area of the Paratethys. MATERIALS AND METHODS Taxonomic Sampling
FIG. 1. SEM micrographs of Cercopagis pengoi (A) and Cornigerius maeoticus (B).
remnants of the Eastern Paratethys. The remaining species of the Cercopagididae, Bythotrephes longimanus, and the Polyphemidae, Polyphemus pediculus, are inhabitants of holarctic freshwater bodies (Bythotrephes was just recently introduced into North America; see Martin and Cash-Clark, 1995), whereas the remaining Podonidae are marine (with one exception in lake Hazar Go¨lu¨ in Turkey; Spandl, 1923), common in most parts of the world oceans (distribution according to Mordukhai-Boltovskoi and Rivier, 1987; Rivier, 1998; Onbe´, 1999). The distribution of the Onychopoda in the Ponto–Caspian basin is complex. Simplified, one group of species occurs in the Caspian Sea, Sea of Azov, and other peripheral parts of the Black Sea with relatively low salinity, e.g., the Danube, Dniester, and Dniepr estuaries; a second group is common either only in the Caspian Sea or also in the Aral Sea. In the central part of the Black Sea with a relatively high salinity, the same podonid species occur as in the Mediterranean Sea (Fig. 2) (Mordukhai-Boltovskoi and Rivier, 1987; Rivier, 1998). More recently, Pleopis polyphemoides also invaded the Caspian Sea via the Volga–Don canal (Mordukhai-Boltovskov, 1962). This distribution provokes the question of the evolutionary origin of the onychopod cladocerans. The Ponto–Caspian basin—and in particular the Caspian Sea— has been claimed to be the center of adaptive radiations for many taxa such as molluscs, fish, and crustaceans (Dumont, 1998b). For instance, an origin in the Ponto–Caspian basin followed by multiple immigrations into freshwater has been suggested for the European freshwater crayfish species (Astacidae) (Karaman, 1962; but see Scholtz, 1995, for a different opinion). Also for the Onychopoda—and in particular for the Podonidae—the role of the Ponto–Caspian basin for the recent distribution has been discussed over
We included 11 representatives of the Cladocera Onychopoda, 2 of the Cladocera Ctenopoda, 2 of the Cladocera Anomopoda, the only recent representative of the Cladocera Haplopoda, and 1 representative of the Conchostraca Spinicaudata as definitive outgroup in this study (Table 1). The Ponto–Caspian onychopods were collected in the northern part of the Caspian Sea, off Zhemtschuzhnyi Island, the marine podonid species (Podon leuckarti, P. intermedius, Evadne nordmanni) in the North Sea, off Sylt and Helgoland, and all other cladocerans in freshwater bodies in Berlin or the environments of Berlin. Imnadia yeyetta was collected in the Marchauen, close to Vienna, Austria. All specimens were preserved in 100% ethanol and stored at 4°C. Sample Preparation Genomic DNA from up to 20 individuals per species was isolated using a 4% CTAB extraction (Doyle and
FIG. 2. Simplified distribution of the Ponto–Caspian Onychopoda (Aral Sea not considered because of recent changes in the fauna due to the increased salinity in the Aral Sea). According to their distribution, three groups of Onychopoda can be distinguished: group 1, Podonevadne trigona (in two subspecies), Cornigerius maeoticus (in two subspecies), Cornigerius bicornis, Cercopagis pengoi, Cercopagis neonilae; group 2, Evadne anonyx, Evadne prolongata, Podonevadne camptonyx, Caspievadne maximowitschi, Cornigerius arvidi, Polyphemus exiguus, and all other Cercopagis sp. which do not belong to group 1; group 3, Pleopis polyphemoides (recently also introduced into the Caspian Sea), Pseudoevadne tergestina, Podon leuckarti, Podon intermedius, Evadne spinifera, E. nordmanni.
107
PHYLOGENY OF CLADOCERA
TABLE 1 Species Used in This Study with Accession Nos. from GenBank Conchostraca Spinicaudata Cladocera Haplopoda Ctenopoda
-Limnadiidae
Imnadia yeyetta Hertzog, 1935
AY009487
-Leptodoridae -Sididae
Leptodora kindtii (Focke, 1844) Diaphanosoma brachyurum (Lie´ven, 1848) Sida crystallina (O. F. Mu¨ller, 1776) Daphnia pulex Leydig, 1860 Simocephalus vetulus (O. F. Mu¨ller, 1776) Bythotrephes longimanus Leydig, 1860 Cercopagis pengoi (Ostroumov, 1892) Polyphemus pediculus (Linnaeus, 1761) Podon leuckarti (Sars, 1862) Podon intermedius Lilljeborg, 1853 Evadne nordmanni Loven, 1836 Evadne anonyx Sars, 1897 Podonevadne trigona (Sars, 1897) Podonevadne camptonyx (Sars, 1897) Podonevadne angusta (Sars, 1902) Cornigerius maeoticus (Pengo, 1879)
AY009488 AY009489 AY009490 AY009491 AY009492 AY009493 AY009494 AY009495 AY009496 AY009497 AY009498 AY009499 AY009500 AY009501 AY009502 AY009503
Anomopoda
-Daphniidae
Onychopoda
-Cercopagididae -Polyphemidae -Podonidae
Doyle, 1990) in a declined procedures. The homogenization procedure was performed directly in CTAB buffer with grains of sea sand. Selective amplification was carried out for a portion of the mitochondrial gene 12s rDNA (SSU) by polymerase chain reaction (PCR) using the primers 12CR3 (5⬘-ACTTTGTTACGACTTATCTC-3⬘) and 12s-5c (5⬘-GCCAGCCGTCGCGGTTAGAC-3⬘). Both PCR primers were extended at the 5⬘ end with the sequences of the primers M13 forward and M13 reverse. PCR conditions were 40 cycles with 94°C/30 s denaturing, 40 – 42°C/45 s annealing, and 72°C/45 s extensions. PCR products were gel-purified and concentrated using microconcentrators (Microcon 50). PCR products were directly cycle-sequenced by dideoxy chain termination using fluorescein-labeled M13 forward and M13 reverse primers. Sequencing gels were run on ALF sequencers (Pharmacia). Phylogenetic Analysis In general, alignment is the first crucial step in the analysis of rDNA sequences that has a major influence on the results of the phylogenetic analysis. In a cladistic framework the best alignment is that which yields the most parsimonious cladogram. We used the direct optimization procedure (Wheeler, 1996) as implemented in the program Poy (Gladstein and Wheeler, 1996 –2000) using parsimony as optimality criterion. Direct optimization combines both alignment and phylogenetic analysis in one step, which guarantees a consistent use of analysis assumptions in the entire analysis (Philipps et al., 2000). The key difference between direct optimization and multiple alignment is that evolutionary differences in sequence length are accommodated not by the use of gap characters but by allowing insertion– deletion events. As preferred weighting scheme we weighted substitutions 1 (transitions and
transversions equally weighted) and indels 2. In a sensitivity analysis (Wheeler, 1995) six other weighting schemes were also used (transition:transversion:indels, 1:2:2, 1:1:4, 1:2:4, 1:2:8, 1:1:7, 1:1:10). Each analysis was carried out using the options “norandomizeoutgroup,” “maxtrees 10,” “fitchtrees,” “multibuild 10,” “checkslop 10,” and “random 100.” This includes 10 sequence random additions without branch swapping, SPR and TBR branch swapping based on the shortest tree of these 10 calculations, and an extra TBR branch swapping round, checking all cladogram lengths that are within 1% of the current minimum value. Using the option “impliedalignment,” a topology-specific multiple alignment was generated under the preferred weighting scheme (see Appendix). This alignment was transformed into a Phast-file (Goloboff, 1993–2000) and calculated using “autocal,” “hold 1000,” “mult* 20” (same weighting scheme as in Poy). Also, the decay index (Bremer, 1994) was calculated with Phast (“hold 1000,” “bs 20”). A bootstrap analysis (Felsenstein, 1985) was carried out with Nona (Goloboff, 1993–2000) using the same alignment (1000 replications, “mult* 10,” “hold/10,” “tbr”). Winclada (Nixon, 1999 –2000) was used as shell program. RESULTS The calculation under our preferred weighting scheme (ts:tv:indel ⫽ 1:1:2) resulted in one most-parsimonious tree (amb-) with a length of 646 steps (181 parsimony informative characters counted in Winclada) (Fig. 3). The calculation of Phast resulted in the same most-parsimonious trees with 646 steps. All clades apart from (Simocephalus–Daphnia) (not supported under assumptions 1:1:7 and 1:1:10) are also supported by all other weighting schemes used.
108
RICHTER ET AL.
FIG. 3. Phylogenetic hypothesis of the Onychopoda and other representatives of the Cladocera (Anomopoda, Ctenopoda, Haplopoda), inferred from a direct optimization analysis of DNA sequences of a fragment of the mitochondral 12S rDNA. The decay indices are given above the lines and the bootstrap values below the lines.
Our analysis is in agreement with the Gymnomera concept, which suggests a sister group relationship between Haplopoda and Onychopoda but the support is relatively weak (decay index 2; bootstrap value 57%). The monophyly of the Onychopoda and the monophyletic origin of the Cercopagididae and Podonidae are well supported. Only one representative of the Polyphemidae was included in our analysis. Cercopagididae and Podonidae are sister groups and the Polyphemidae is the sister group of both. Within the Podonidae, the two species of the exclusively marine genus Podon form the most basal clade. The three Podonevadne species (P. trigona, P. camptony, and P. angusta) and Cornigerius maeoticus form a monophyletic clade that cannot be resolved with the gene fragment studied. The sister group of this clade is represented by the two Evadne species. Most of the clades within the Podonidae are well supported, except for the Evadne clade, which shows a low decay index (2) and a relatively low bootstrap value (73%).
DISCUSSION In addition to morphological cladistic studies (Martin and Cash-Clark, 1995; Olesen, 1998) and molecular analyses based on 16S rDNA data (Schwenk et al., 1998) and 18S rDNA data (Taylor et al., 1999), our 12S rDNA data also support a sister group relationship between Haplopoda (Leptodora kindtii) and Onychopoda and therefore a monophyletic Gymnomera. Although the Sida–Diaphanosoma and Daphnia–Simocephalus clades are well supported, it is not justified to infer monophyly for the Ctenopoda or Anomopoda. The taxon sampling is too restricted and some crucial taxa of these groups are not considered (e.g., Holopedium for the Ctenopoda or the Chydoridae for the Anomopoda). The monophyly of the Onychopoda and of its three families is supported by our analysis. The sister group relationship between Cercopagididae and Podonidae, as has been proposed by Martin and Cash-Clark (1995), is also supported by our molecular data. One of the most interesting questions of our analysis
PHYLOGENY OF CLADOCERA
109
FIG. 4. Hypothesis of the invasions of onychopod water-fleas into the Ponto–Caspian basin. The Ponto–Caspian basin was twice conquered by freshwater invaders (light gray arrows). For the ancestors of the Podonidae, a transition from freshwater into the world oceans is suggested (black arrow). Within the Podonidae, a double invasion into the Ponto–Caspian is hypothesized (dark gray arrows).
concerns the habitat of the different onychopod taxa. Unfortunately, different possibilities are equally parsimonious under the assumption of equal probability of changing the habitat; i.e., the interpretation depends on the optimization mode. Therefore, our suggestions are based not only on the here-presented phylogenetic relationships but also on a tentative morphological phylogenetic analysis including the podonid genera Pleopis and Pseudoevadne (unpublished) and geological data. We suggest several independent invasions into the Ponto–Capian basin—separate in each of the onychopod families (Fig. 4). Quite probable is that there were two invasions from freshwater. One of these took place within the Cercopagididae. As a freshwater inhabitant, Bythotrephes longimanus represents the ancestral condition. The ancestor of the representatives of Cercopagis invaded the Ponto–Caspian basin. A second invasion from freshwater is suggested for the ancestor of the Caspian polyphemid species P. exiguus. Although this species is not included in our analysis, a sister group relationship to the freshwater species Polyphemus pediculus is strongly suggested based on
morphological correspondences (Mordukhai-Boltovskoi, 1968); as a matter of fact, it cannot be excluded that P. exiguus is only a different morphotype from P. pediculus (Aladin et al., 1999). The interpretation of phylogenetic relationships within the Podonidae with respect to habitats is more complicated. There is no doubt that the early ancestors of the Podonidae lived in freshwater like almost all other Cladocera. The crucial question is whether the freshwater ancestors invaded the Ponto–Caspian, and then later the world oceans, or whether they directly conquered the world oceans from freshwater and later the Ponto–Caspian basin. Both possibilities have been suggested by several authors. Due to the already mentioned fact that almost all other cladocerans are freshwater inhabitants, it has been claimed that freshwater ancestors immigrated into the Ponto–Caspian basin and that much later, after a species radiation, the most salt-tolerant species expanded to the world oceans through the Bosporus (Aladin, 1995; Dumont, 1998a). Dumont (1998a) supposed that the latter happened during its most recent opening in the Holocene. On the
110
RICHTER ET AL.
other hand, Gibitz (1922), Mordukhai-Boltovskoi and Rivier (1987), and Potts and Durning (1980) argued for an origin of the Ponto–Caspian Podonidae in the world oceans. We think that the latter is the more plausible explanation. A good candidate for the time of the podonid invasion into the Ponto–Caspian is the Agchagylian transgression (3.4 –2 myr ago) when Eastern Paratethys was reconnected with the world oceans (Degens and Paluska, 1979; Jones and Simmons, 1996). During this time marine plankton was introduced into the Ponto–Caspian basin (Jones and Simmons, 1996). However, after this event, the Ponto– Caspian basin freshened again and only a brackish water fauna could survive (Jones and Simmons, 1996). Some of these fauna representatives were possibly the ancestors of the Ponto–Caspian podonids of the genera Cornigerius, Podonevadne, Caspievadne, and the Caspian Evadne species. After this major Agchagylian transgression period, beginning with the Aspheronian (2– 0.7 myr ago, which was according to Jones and Simmons (1996) essentially regressive in character), several high and low stands of the Ponto–Caspian basin were linked to the glaciation cycles (Dumont, 1998b). The invasions from freshwater within the Cercopagididae and Polyphemidae probably occurred in one of these transgression periods when smaller freshwater bodies (lakes and rivers) were flooded by the Caspian and Black Seas. At this time, both “seas” were freshwater bodies at least in their major parts (Dumont, 1998b). Due to the fact that Cercopagis pengoi occurs in the Caspian Sea and the Sea of Azov, this invasion probably happened before these water bodies became separated. This was about 77,000 years ago
(Yakovlev, 1956). One could argue that this period (between about 2 myr and some 100,000 years ago) is not long enough for a radiation of the 13 Cercopagis species, but the species number is very likely to be overestimated (Aladin, 1995; Aladin et al., 1999). Only very recently, long after the loss of the connection between the Black Sea and the Caspian Sea, the connection between the Mediterranean Sea and the Black Sea opened again. This Holocenian event—recently interpreted as Noah’s flood (Ryan and Pitman, 2000)— about 7150 years ago, resulted in a rapid increase in the water level of the Black Sea (Ryan et al., 1997; Demirbag et al., 1999). Also, the salinity of the central part of the Black Sea increased and marine species from the Mediterranean Sea invaded this region (Schrader, 1979). We suggest that podonid species (our group 3) also were involved in this invasion. The brackish water Ponto–Caspian endemics, which had lived in the freshened Black Sea before, were displaced to the Sea of Azov and other peripheral parts of the Black Sea with a lower salinity. ACKNOWLEDGMENTS We are grateful to Dr. Vasili Petuchov, Dr. R. Saborowski, and E. Eder for theis assistance in collecting specimens. We are thankful to Replicon GmbH, which allowed the complete DNA work to be carried out in its lab. We thank Dr. B. Schro¨der for support with geological interpretations and for providing literature, Dr. J. Olesen for comments on the manuscript, Dr. S. Rogaschewski for support during the SEM study, and I. Drescher for translations from Russian into German. The financial support by the Deutsche Forschungsgemeinschaft to S.R. and G.S. (436 RUS 18/15/98; DFG Scho 442/6-1) and the financial support to N.A. (Russian Fund for Basic Research 96-04-48114) is gratefully acknowledged.
APPENDIX Alignment Resulting from Poy’s “Impliedalignment” under the Preferred Weighting Scheme (646 Steps) I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
GGGCGATGTGTACACATCTCAGAGC-TTTTTTCAAATTATCTTTCTAAAATAATTTTACTTCCAAATCCA GGGCGATATGTACATATTCTATTGCTAAATTTCAATTCTTTATAATTAAAAAAATTTACTCACAAATCCG GGGCGATATGTGCACATCCTATTGC-CTTATTCAACTTACTGTACTTAAGTAAATTTACTAATAAATCCA GGGCGATATGTACACATCTCAGAGC-CAAATTCAGCTAACCTTTCTTAAATTAACTTACTAACAAATCCA GGGCGATATGTACACATCTCAGAGC-CAAATTCAGTTAACCTTTCTTAAATTAACTTACTAACAAATCCA GGGCGATATGTACACATCTCAGAGC-CAACTTCAATTATCTTTTCTTAAAATAATTTACTGACAAATCCA GGGCGATATGTACACATCTCAGAGC-CAACTTCAACTATACTTTCTTAGACTAGTTTACTGACAAATCCA GGGCGATATGTGCACATCCCAGAGC-CAAATTCAATATACGATTCTAAAATATATTTACTAACAAATCCA GGGCGATATGTACATACCTCATAGC-CTTATTCAAATAAATATTCTAATTTTATTTTACTGACAAATCCA GGGCGATATGTACACGCCTCAGAGC-CAACTTAAAATAATTATTCTTAAAGTATTTTACTAGTAAATCCA GGGCGATATGTGCACACCCCAGGGC-CAACTTCAATAGAGGATTCTTAACTCTATTTACTGACAAATCCA GGGCGATATGTACACATCTCCCCGC-CAACTTCAATTATCTTTTCTTAAAATAATTTACTGACAAATCCA GGGCGATATGTACACATCTCAGAGC-CAACTTCAATTATCTTTTCTTAAAATAATTTACTGACAAATCCA ??????????????????????????????????????????????????????????????????T-CA GGGCGATATGTACACATCTCATAGC-CAACTTCAATTATCTTTTCTTAAAATAATTTACTGACAAATCCA GGGCGATATGTACACATTCTTTTAC-CTTCTTCAAAAAGTTATACTTAAACAATTTTACTAGCAAATCCA GGGCGATATGTGCATATTTCATTGC-AACCTTCAGTGAATCTTTCTTAAATACACTTACTTACAAATCCA
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius
CCTTAAAT-TGTTT-TTTCATAA-A-ATTTCCGTGTAATTTATAATTATTGTAACCCATC-ACCACCTTC CCTTCATA-TGATT-TTTCATACAT-AATCCGTTATTAATTAAATTAAATGTAGCTCATC-TTCTCTTAG CCTTCACC-TGAGT-TTTAAGCCTA-AAATCCGTATTTCTATTAAAAATTGTAGCTCATC-ACTGCCCTT CCTTCATA--AAGGAATTACACCTTAAAATCCGTATTAATAACTTTAATTGTAGCTCATCTGCGACTTAA CCTTCATA--AAGGAATTACACCTTAAAATCCGTATTAATAAATTTAATTGTTGCTCATCTGCCACTTAA
PHYLOGENY OF CLADOCERA
111
E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
CCTTCAAG--AAGG-ATTACACCTT-AAATCCGTATTAGTAACTCTAATTGTAGCTCATCTGAAACTTAA CCTTCAAG--AAGGAATTACACCTT-AAATCCGCATTAATAACTCTAATTGTAGCCCATCTGAAACTTAA CCTTCCTA--AAAG-ATTACACTTT-TTATCCGTATAAATAACATTTATTGTAGCTCATC-TACTCTTAA CTTTCATAGCCATG-TTTAAAAACT-AATCCATAATTAATTAATTTAATTGTAGCTCACC-ACCACTTAA CCTTCAAT--AAAG-ATTACACTTT-ATTTCCGTATTTAT-ACATAAATTGTAGCTCATC-AATCCTTAA CCTTCCTA--GAAG-ATTACACTTC-TATTCCGTATAAATATCATTTATTGTAGCTCATC-GACTCTCAA CCTTCAGA--AAGGAATTACACCTT-AAATCCGTATTAGTAACTCTAATTGTAGCTCATCCGAAACTTAG CCTTCAGA--AAGGAATTACACCTT-AAATCCGTATTAGTAACTCTAATTGTAGCTCATCCGAAACTTAG CCTTCAGA--AAGGAATTACACCTT-AAATCCGTATTAGTAACTCTTATTGTAGCTCATCCGAAACTTAG CCTTCAGA--AAGGAATTACACCTT-AAATCCGTATTAGTAACTCTAATTGTAGCTCATCCGAAACTTAG CCTTC-CA-AAAGT-ATTAAAACTA-ATATCTGTTTTTTTAAATTAAATTGTAGCTCACC-ACTACCCTT CCTTCTTA-ATGGG-TTTCACCATT-GATTCGTTTTTAATTATTTTAATTGTAGCTCATC-ACCTCTTAA
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
TTATAAGCTGCACCTTGACCTGAAGTTAGTAAAAATA---GTTAAT-TT-AGATAATA-TCTTTT-TAGA TTATAAGTTGCACCTTGACCTGAAG-TC-TTTAAATT---ATCAAT-GA-AGGAAACA-TTCTTT-TAAA CTATAAACTGCACCTTGACCTGAAG-TA-AGAAAAAT---ATTTTT-CC-TGAAAACG-TTCTTT-TAAA CTATAAACTGCACCTTGACCTGAAG-TA-AAAGACCT---TTCTTT-AT-TGAAAACA-TCCTAT-AGGA CTATAAACTGCACCTTGACCTGAAG-TA-AAAGAAGT---ATCTTT-TT-TGAAAACA-TCCTAT-AGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAAATT---ATATTT-AT-TGAAAACG-TCCTAT-TGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAACTT---ATATTT-AT-TGAAAACG-TCCTAT-TGGA TCATAGACTACACCTTGACCTGAAG-TA-AAAGAACT---ATCTTT-AG-AGAAAACA-CCCTTT-TAGA CCATAAACTGCACCTTGACCTGAAG-TG-AAAAAATT---ATTTTT-CT-AGAAGACA-TCCTAT-AAGA CCATAGGCTACACCTTTACCTGAAG-TA-ATAGAATT---ATCTAA-CT-CGAAAACT-TCCTCT-AGGA TCATAGACGGCACCTTGACCTGAAG-TG-AAAGAATT---ATCTTT-AA-AGAAAAC--TCCTAT-TAGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAATCT---ATATTT-AT-TGAAAACA-TCCTAT-TGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAATCT---ATATTT-AT-TGAAAACA-TCCTAT-TGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAATCT---ATATTT-AT-TGAAAACA-TCCTAT-TGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAATCT---ATATTT-AT-TGAAAACA-TCCTAT-TGGA TTATTAGCTGCACCTTGACCTGAAG-TA-AAAAAATT---ATTTTTATT-TGAAAACGTTTCTTTATGAA TCATAAGCTGCACTGTGACCTGAAT-TT-TTGAAGTTGGGGTTATT-TAGTGGGAACA-TTCTTT-TAAA
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
ATTATCTGACAACGGCGGTATACAAACT---A-G-ACAAAAGAAGGTAAGGTAAAACGTGGATTGTCGAT GTAACCTGAC-ACGGCGGTATACAAACTGC-TAT-ACAAAACCAAGAAAGGTAAATCGAGGATTATCAAT GTAATCTGACAACGGCGGTATACAAGCT---T-A-ACAAAAAAGGGTAAGATAAAATGGGGACTATCAAT GTAATCTGACAACGGAGGTATACAAGCTG-ATTAACCAAA-TTAAGTAAGATTTAACGGGGATTATCGAT GTAATCTGACAACGGAGGTATACAAGCTG-ATTAACCAAG-CTAAGTAAGATATAACGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATCTAACGGGGATTATCGAT GTAATCTGACAACGGCGGTATATAGG-TG-AATTAACTAGACCAAGAAAGATATAATGAGGGGTATCAAT GTAGTCTGACAACGGAGGTATACAAGTTG--AAA-ACAAGGTTAAGAAAGATCTAACGGGGACTATCATT GTAATCTGACAACGGCGGTATATAAGCTG--TTT-ACAAGATTAAGTAAGATTTAATGGGGAATATCAAT GTAATCTGACAACGGAGGTATACCGGCTG-ATTCAACAAGACTGAGAAAGATATAATGGGGAACATCAAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGAGGTATACAAGCT---C-T-ACAAAAAAAGGTAAGATAAAACGAGGATAATCGAT GTAACCTGACAACGGTGGTATACAAGCTG--AAT-ACTAGATTAAGTAAGATTAAACGGGGGTTATCGAT
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
TACGGGACAGGTTCCTCTGGAAAGAGTGAGATGCCGTCAAATT-CTTTGGGTTTGGAGATTTTCTTTTAC TATGAGACAAGCTCCTCTGTAAAGG-TAGAATACCGCCAAAAT-CTTTGGGTTTGAAGAACATCTTTTAC TATAGGACAAGCTCCTCTATTAGGA-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACAACTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAATATCTTTTAC CACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAATCTCTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACGTCTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACATCTTTTAC TATGTGACAAGCTCCTCTGTTAGGT-TAGGATGCCGCCAAAGT-CTTTGGGTTTGAAGAATTTCTTTTAC TAAAGGGCAAGCTCCTCTGTTAGGA-TAAGGTACCGCCAAATT-CTTTGGGTTTGAAGAA-TTCTTTTAC TATACGACAAGCTCCTCTACTAGGA-TAAGGCACCGCCAAAAT-CTTTGGGTTTGAAGAACATCTTTTAC TATGTGACAAGCTCCTCTGTTAGGT-TAGGGTACCGCCAAAGT-CTTTGGGTTTGAAGAACTTCTTTTAC TACACGACAAGCTCTTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACAACTTTTAC TACACGACAAGCTCCTCTGTGAAGG-TAAGATGCCGCCAAAATCCTTTGGGTTTGAAGAACAACTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACAACTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACAACTTTTAC TATAGGACAAGCTCCTCTGTTTGGT-TAAAATGCCGCCAAAAC-CTTTGGGTTTGAAGGATAACTTTTAC TATGGGACAAGCTCCTCTGTTGTGG-TGAAATACCGCCAAAGT-CTTTGGGTTTGAAGGATTTCTTTTAC
112
RICHTER ET AL.
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
TACCCT--GGCAAT-GAAG-GATA-AGAATAGTAGGGTATCTAA-T-CCTAGTTTA TACCCT--AAAATC-ATTT--AGTTAAAATAACAGGGTATCTAA-T-CCTGGTTTA TACCCTA-TTTACA-TTAT-TATTTAGAATAACAGGGTATCTAA-T-CCTGGTTTT TACCCT--GACAAG-AAGT-CAACTGGAATAACAGGGTATCTAA-T-CCTGGTTTT TACCCT--GACAAG-AAAT-CATCTAGAATAACAGGGTATCTAA-T-CCTGGTTTT TACCCT--GACAAGTTATT-GGGCTGGGATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--GACAAGTTATT-TGGCTGGGATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--AACAT--ATGT-ATACTAGTATAGCAGGGTATCTAATTCCCTGGGTTT TACCCT-AGTAAAG-CTTT-CAAGAAGAATAACAGGGTATCTAA-T-CCTGGTTTA TACCCT--TACATA-AGAG-GGGCTAGAATAATAGGGTCTCTAA-T-CCTAGTCTT TACCCT--GACATA-AAGT-TAACTAGTATAACAGGGTATCTAA-T-CCTGGTTTA TACCCT--GACAAGTAATT-GGGCTGGAATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--GACAAGTAATTAGGGCTGGAATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--GACAAGTAATT-GGGCTGGAATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--GACAAGTAATT-GGGCTGGAATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--TGAAAA-ATAT-T-TAGAAATTAACAGGGTATCTAA-T-CCTGGTTTA TACCCT--GAATAA-TTTT--TACTAAAATAGCAGGGTCTCTAA-T-CCTGGTTTT
Note. More parsimonious alignments might be possible but they should not produce more parsimonious topologies.
REFERENCES Aladin, N. V. (1995). The conservation ecology of the Podonidae from the Caspian and Aral seas. Hydrobiologia 307: 85–97. Aladin, N. V., Ryabova, V. N., Chuykov, Y. S., and Plotnikov, I. S. (1999). Problems of macro- and microevolution in the superfamily Polyphemeoidea–Onychopoda (Cladocera). Proc. Zool. Inst. RAS 281: 97–100. Bowman, T. E., and Abele, L. G. (1982). Classification of the recent Crustacea. In “The Biology of the Crustacea,” Vol. I: “Systematics, the Fossil Record and Biogeography” (L. G. Abele, Ed.), pp. 1–27. Academic Press, New York. Braband, A., Richter, S., Hiesel, R., and Scholtz, G. (2000). Phylogeny of the Branchiopoda (Crustacea) inferred by DNA data. Zoology 103, Suppl. III (DZG 93.1): 99. Bremer, K. (1994). Branch support and tree stability. Cladistics 10: 295–304. Degens, E. T., and Paluska, A. (1979). Tectonic and climatic pulses recorded in Quaternary sediments of the Caspian–Black Sea region. Sediment. Geol. 23: 149 –163. Demirbag, E., Go¨kasan, E., Oktay, F. Y., Simsek, M., and Yu¨ce, H. (1999). The last sea level changes in the Black Sea: Evidence from the seismic data. Mar. Geol. 157: 259 –265. Doyle, J. J., and Doyle, L. (1990). Isolation of plant DNA from fresh tissue. Focus 12: 13–15. Dumont, H. J. (1998a). Editor’s introduction—The Caspian Cradle. In “The Predatory Cladocera (Onychopoda: Podonidae, Polyphemidae, Cercopagidae) and Leptodorida of the World” (Rivier, I. K.), pp. 9 –15. Backhuys, Leiden. Dumont, H. J. (1998b). The Caspian Lake: History, biota, structure, and function. Limnol. Oceanogr. 43: 44 –52. Eriksson, S. (1934). Studien u¨ber die Fangapparate der Branchiopoden nebst einigen phylogenetischen Bemerkungen. Zool. bidrag fran Uppsala 15: 23–287. Felsenstein, J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783–791. Fryer, G. (1987). Morphology and the classification of the so-called Cladocera. Hydrobiologia 145: 19 –28. Gibitz, A. (1922). Verbreitung und Abstammung mariner Cladoceren. Verh. Zool.-Bot. Gesell. Wien 71: 85–105. Gladstein, D., and Wheeler, W. C. (1996 –2000). POY—Phylogeny reconstruction via direct optimization of DNA data, version 2.0. Am. Mus. Nat. Hist., New York.
Goloboff, P. A. (1993–2000). PIWE/NONA/PHAST/SPA (Parsimony with Implied Weights). P. Goloboff, Instituto Miguel Lillo, Tucuman, Argentina. Gruner, H.-E. (1993). Crustacea. In “Arthropoda (ohne Insecta). Lehrbuch der Speziellen Zoologie” (H.-E. Gruner, Ed.), Bd. I, 4. Teil. pp. 448 –1030. Fischer, Jena. Jones, R. W., and Simmons, M. D. (1996). A review of the stratigraphy of Eastern Paratethys (Oligocene–Holocene). Bull. Nat. Hist. Mus. Lond (Geol.) 52: 25– 49. Karaman, M. (1962). Ein Beitrag zur Systematik der Astacidae. Crustaceana 3: 173–201. Martin, J. W., and Cash-Clark, C. E. (1995). The external morphology of the onychopod ‘cladoceran’ genus Bythotrephes (Crustacea, Branchiopoda, Onychopoda, Cercopagididae), with notes on the morphology and phylogeny of the order Onychopoda. Zool. Scripta 24: 61–90. Mordukhai-Boltovskoy, P. D. (1962). Poyavlenie v Kaspiyskom more predstavitelya sredizemnomorskih polifemid [Appearance of Mediterranian polyphemids in the Caspian Sea]. Zool. Z. 41: 289 –290. Mordukhai-Boltovskoi, P. D. (1966). Distribution, biology and morphology of Polyphemidae in fresh and brackish waters of the Pontocaspian basin. Verh. Int. Ver. Limnol. 16: 1677–1683. Mordukhai-Boltovskoi, P. D. (1968). On the taxonomy of the Polyphemidae. Crustaceana 14: 197–209. Mordukhai-Boltovskoi, P. D., and Rivier, I. K. (1987). “Predatory Cladoceran Podonidae, Polyphemidae, Cercopagidae and Leptodoridae of the World Fauna.” Nauka, Leningrad. [in Russian] Negrea, S., Botnariuc, N., and Dumont, H. (1999). Phylogeny, evolution and classification of the Branchiopoda (Crustacea). Hydrobiologia 412: 191–212. Nixon, K. C. 1999 –2000: Winclada (Beta) ver. 0.9.9, Ithaca, NY. Olesen, J. (1998). A phylogenetic analysis of the Conchostraca and Cladocera (Crustacea, Branchiopoda, Diplostraca). Zool. J. Linn. Soc. 122: 491–536. Onbe´, T. (1999). Ctenopoda and Onychopoda (⫽Cladocera). In “South Atlantic Zooplankton” (D. Boltovskoy, Ed.), pp. 797– 813. Backhuys, Leiden. Philipps, A., Janies, D., and Wheeler, W. (2000). Multiple sequence alignment in phylogenetic analysis. Mol. Phylogenet. Evol. 16: 317–330. Potts, W. T. W., and Durning, C. T. (1980). Physiological evolution in the branchiopods. Comp. Biochem. Physiol. 67B: 475– 484. Rivier, I. K. (1998). The predatory Cladocera (Onychopoda:
PHYLOGENY OF CLADOCERA Podonidae, Polyphemidae, Cercopagidae) and Leptodorida of the world. In “Guides to the Identification of the Microinvertebrates of the Continental Waters of the World” (H. J. Dumont, Ed.), pp. 16 –213. Backhuys, Leiden. Ryan, W. B. F., Pitman, W. C., Major, C. O., Shimkus, K., Moskalenko, V., Jones, G. A., Dimitrov, P., Go¨ru¨r, N., Sakinc, M., and Yu¨ce, H. (1997). An abrupt drowning of the Black Sea shelf. Mar. Geol. 138: 119 –126. Ryan, W. B. F., and Pitman, W. C. (2000). “Noah’s Flood.” Touchstone, London. Sars, G. O. (1902). On the Polyphemidae of the Caspian Sea. Ezhegodnik Zool. Muz. Akad. Nauk 8: 31–54. Schminke, H. K. (1981). Adaptation of Bathynellacea (Crustacea, Syncarida) to life in the interstitial (“Zoea Theory”). Int. Revue Ges. Hydrobiol. 66: 575– 637. Schminke, H. K. (1996). Crustacea, Krebse. In “Spezielle Zoologie. Erster Teil: Einzeller und Wirbellose Tiere” (W. Westheide and R. Rieger, Eds.), pp. 501–581. Fischer, Stuttgart. Scholtz, G. (1995). Ursprung und Evolution der Flusskrebse (Crustacea, Astacida). Sitzber. Ges. Naturforsch. Freunde Berlin (N.F.) 34: 93–115. Schrader, H.-J. (1979). Quaternary paleoclimatology of the Black Sea basin. Sediment. Geol. 23: 165–180. Schwenk, K., Sand, A., Boersma, M., Brehm, M., Mader, E., Offerhaus, D., and Spaak, P. (1998). Genetic markers, genealogies and biogeographic patterns in the Cladocera. Aquat. Ecol. 32: 37–51.
113
Spandl, H. (1923). Zur Kenntnis der Su¨sswassermikrofauna Vorderasiens. Ann. Nat. Hist. Mus. Wien 36: 124 –149. Spears, T., and Abele, L. G. (2000). Branchiopod monophyly and interordinal phylogeny inferred from 18S ribosomal DNA. J. Crust. Biol. 20: 1–24. Taylor, D. J., Crease, T. J., and Brown, W. M. (1999). Phylogenetic evidence for a single long-lived clade of crustacean cyclic parthenogens and its implications for the evolution of sex. Proc. R. Soc. Lond. B 266: 791–797. Walossek, D. (1993). The Upper Cambrian Rehbachiella and the phylogeny of Branchiopoda and Crustacea. Fossils Strata 32: 1–202. Wheeler, W. C. (1995). Sequence alignment, parameter sensitivity, and the phylogenetic analysis of molecular data. Syst. Biol. 44: 321–331. Wheeler, W. C. (1996). Optimization alignment: The end of multiple sequence alignment in phylogenetics? Cladistics 12: 1–9. Wingstrand, K. G. (1978). Comparative spermatology of the Crustacea Entomostraca. 1. Subclass Branchiopoda. Kong. Dansk. Vidensk. Selsk. Biolog. Skrifter 22: 1– 67. Yakovlev, S. A. (1956). Principles of geology of quaternary deposits of the Russian plainland (Stratigraphy). [in Russian; cited in: Rivier, I. K. (1998). “The predatory Cladocera (Onychopoda: Podonidae, Polyphemidae, Cercopagidae) and Leptodorida of the world,” pp. 16 –213, Backhuys, Leiden]
The Phylogenetic Relationships of “Predatory Water-Fleas” (Cladocera: Onychopoda, Haplopoda) Inferred from 12S rDNA Stefan Richter,* Anke Braband,* Nikolai Aladin,† and Gerhard Scholtz* *Vergleichende Zoologie, Institut fu¨r Biologie, Humboldt-Universita¨t zu Berlin, Philippstr. 13, 10115 Berlin, Germany; and †Zoological Institute, Russian Academy of Science, Universitetskaya nab., 1, 199034 St. Petersburg, Russian Federation Received April 25, 2000
Within the Cladocera, the water-fleas, four major taxa can be distinguished: Anomopoda, Ctenopoda, Haplopoda, and Onychopoda. Haplopoda and Onychopoda are called “predatory water-fleas.” The Haplopoda is monotypic; its only representative, Leptodora kindtii, is common in palearctic and nearctic freshwater bodies. The Onychopoda show a remarkable geographic distribution. Most of the described species are restricted to the Caspian Sea, the Aral Sea, and peripheral areas of the Black Sea, including the Sea of Azov—all remnants of the Eastern Paratethys. The remaining onychopods are either freshwater inhabitants or marine animals, widespread in the world oceans. We present molecular evidence for a sister group relationship between Haplopoda and Onychopoda within the Cladocera. The Onychopoda and its three families are monophyletic. We suggest an independent invasion into the Ponto–Caspian basin at least three times, twice originating in the palearctic freshwater bodies and once starting from the world oceans. © 2001 Academic Press
INTRODUCTION The Cladocera, the water-fleas, is a highly diverse group which plays an important role in the ecology of freshwater habitats. In contrast to other branchiopod taxa (Anostraca, Notostraca, and Conchostraca) whose representatives are inhabitants mainly of temporary waters, most cladoceran species live in permanent freshwater pools, and few species live in the sea. Four higher taxa within the Cladocera can be distinguished: Ctenopoda (e.g., Sida, Holopedium), Anomopoda (e.g., Daphnia, Chydorus, Bosmina), Haplopoda (Leptodora kindtii), and Onychopoda (e.g., Polyphemus, Bythotrephes, Podon). The monophyly of the entire Cladocera has been doubted (Schminke, 1981, 1996; Fryer, 1987) but some recent analyses based on morphological and molecular data support a monophyletic Cladocera (Walossek, 1993; Martin and Cash-Clark, 1995; Olesen, 1998; Negrea et al., 1999; Spears and Abele, 2000; Braband et al., 2000). The phylogenetic relation-
ships within the Cladocera are also a matter of debate. Martin and Cash-Clark (1995) suggested a sister group relationship between the Onychopoda and the monotypic Haplopoda. To this taxon the Anomopoda is the sister group and the Ctenopoda is the sister group to all other Cladocera. A sister group relationship between Haplopoda and Onychopoda, united as Gymnomera (originally introduced in 1867 by G. O. Sars), is also favored by Olesen (1998) and is supported by 16S rDNA data (Schwenk et al., 1998) and by 18S rDNA data (Taylor et al., 1999). This is in contrast to the view that the Haplopoda with free-living larvae (metanauplius) is separated from all other cladocerans with direct development, which are united as Eucladocera (e.g., Eriksson, 1934; Wingstrand, 1978; Bowman and Abele, 1982; Gruner, 1993; Negrea et al., 1999). Interestingly enough, even this view has been supported by 18S rDNA data (Spears and Abele, 2000). Here we want to focus on the relationships of and within the Onychopoda. Two groups of the Cladocera, the monotypic Haplopoda and the Onychopoda, are often called “predatory” in contrast to filter-feeders (e.g., Rivier, 1998), although the term “macrophagous” would be more appropriate because some Onychopoda prefer to “predate” algae. The monophyly of the Onychopoda has been suggested based on morphological data (Martin and Cash-Clark, 1995; Olesen, 1998) but no molecular analysis so far comprises at least one representative of each of the three families within the Onychopoda (Polyphemidae, Cercopagididae, Podonidae). Within the Onychopoda, Martin and CashClark (1995) suggested a sister group relationship between Cercopagididae and Podonidae. Many representatives of the Onychopoda possess a remarkable general appearance with extensions of head and carapace valves (Fig. 1) but the geographic distribution of the entire taxon is equally remarkable. Thirteen of 14 species of the family Cercopagididae, 1 of 2 species of the Polyphemidae, and 9 of 17 species of the Podonidae (species numbers according to Rivier (1998)) are restricted to the Ponto–Caspian basin, comprising the Black Sea, Caspian Sea, and Aral Sea, all
105
1055-7903/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
106
RICHTER ET AL.
the last 100 years (Sars, 1902; Gibitz, 1922; Mordukhai-Boltovskoi, 1966; Mordukhai-Boltovskoi and Rivier, 1987; Potts and Durning, 1980; Aladin, 1995; Rivier, 1998; Dumont, 1998a). In the present study we analyzed the relationships within and of the Onychopoda using a partial sequence of the 12S rDNA. The monophyly of the Gymnomera, Onychopoda, Cercopagididae, and Podonidae is supported. The results are discussed with respect to geological changes in the area of the Paratethys. MATERIALS AND METHODS Taxonomic Sampling
FIG. 1. SEM micrographs of Cercopagis pengoi (A) and Cornigerius maeoticus (B).
remnants of the Eastern Paratethys. The remaining species of the Cercopagididae, Bythotrephes longimanus, and the Polyphemidae, Polyphemus pediculus, are inhabitants of holarctic freshwater bodies (Bythotrephes was just recently introduced into North America; see Martin and Cash-Clark, 1995), whereas the remaining Podonidae are marine (with one exception in lake Hazar Go¨lu¨ in Turkey; Spandl, 1923), common in most parts of the world oceans (distribution according to Mordukhai-Boltovskoi and Rivier, 1987; Rivier, 1998; Onbe´, 1999). The distribution of the Onychopoda in the Ponto–Caspian basin is complex. Simplified, one group of species occurs in the Caspian Sea, Sea of Azov, and other peripheral parts of the Black Sea with relatively low salinity, e.g., the Danube, Dniester, and Dniepr estuaries; a second group is common either only in the Caspian Sea or also in the Aral Sea. In the central part of the Black Sea with a relatively high salinity, the same podonid species occur as in the Mediterranean Sea (Fig. 2) (Mordukhai-Boltovskoi and Rivier, 1987; Rivier, 1998). More recently, Pleopis polyphemoides also invaded the Caspian Sea via the Volga–Don canal (Mordukhai-Boltovskov, 1962). This distribution provokes the question of the evolutionary origin of the onychopod cladocerans. The Ponto–Caspian basin—and in particular the Caspian Sea— has been claimed to be the center of adaptive radiations for many taxa such as molluscs, fish, and crustaceans (Dumont, 1998b). For instance, an origin in the Ponto–Caspian basin followed by multiple immigrations into freshwater has been suggested for the European freshwater crayfish species (Astacidae) (Karaman, 1962; but see Scholtz, 1995, for a different opinion). Also for the Onychopoda—and in particular for the Podonidae—the role of the Ponto–Caspian basin for the recent distribution has been discussed over
We included 11 representatives of the Cladocera Onychopoda, 2 of the Cladocera Ctenopoda, 2 of the Cladocera Anomopoda, the only recent representative of the Cladocera Haplopoda, and 1 representative of the Conchostraca Spinicaudata as definitive outgroup in this study (Table 1). The Ponto–Caspian onychopods were collected in the northern part of the Caspian Sea, off Zhemtschuzhnyi Island, the marine podonid species (Podon leuckarti, P. intermedius, Evadne nordmanni) in the North Sea, off Sylt and Helgoland, and all other cladocerans in freshwater bodies in Berlin or the environments of Berlin. Imnadia yeyetta was collected in the Marchauen, close to Vienna, Austria. All specimens were preserved in 100% ethanol and stored at 4°C. Sample Preparation Genomic DNA from up to 20 individuals per species was isolated using a 4% CTAB extraction (Doyle and
FIG. 2. Simplified distribution of the Ponto–Caspian Onychopoda (Aral Sea not considered because of recent changes in the fauna due to the increased salinity in the Aral Sea). According to their distribution, three groups of Onychopoda can be distinguished: group 1, Podonevadne trigona (in two subspecies), Cornigerius maeoticus (in two subspecies), Cornigerius bicornis, Cercopagis pengoi, Cercopagis neonilae; group 2, Evadne anonyx, Evadne prolongata, Podonevadne camptonyx, Caspievadne maximowitschi, Cornigerius arvidi, Polyphemus exiguus, and all other Cercopagis sp. which do not belong to group 1; group 3, Pleopis polyphemoides (recently also introduced into the Caspian Sea), Pseudoevadne tergestina, Podon leuckarti, Podon intermedius, Evadne spinifera, E. nordmanni.
107
PHYLOGENY OF CLADOCERA
TABLE 1 Species Used in This Study with Accession Nos. from GenBank Conchostraca Spinicaudata Cladocera Haplopoda Ctenopoda
-Limnadiidae
Imnadia yeyetta Hertzog, 1935
AY009487
-Leptodoridae -Sididae
Leptodora kindtii (Focke, 1844) Diaphanosoma brachyurum (Lie´ven, 1848) Sida crystallina (O. F. Mu¨ller, 1776) Daphnia pulex Leydig, 1860 Simocephalus vetulus (O. F. Mu¨ller, 1776) Bythotrephes longimanus Leydig, 1860 Cercopagis pengoi (Ostroumov, 1892) Polyphemus pediculus (Linnaeus, 1761) Podon leuckarti (Sars, 1862) Podon intermedius Lilljeborg, 1853 Evadne nordmanni Loven, 1836 Evadne anonyx Sars, 1897 Podonevadne trigona (Sars, 1897) Podonevadne camptonyx (Sars, 1897) Podonevadne angusta (Sars, 1902) Cornigerius maeoticus (Pengo, 1879)
AY009488 AY009489 AY009490 AY009491 AY009492 AY009493 AY009494 AY009495 AY009496 AY009497 AY009498 AY009499 AY009500 AY009501 AY009502 AY009503
Anomopoda
-Daphniidae
Onychopoda
-Cercopagididae -Polyphemidae -Podonidae
Doyle, 1990) in a declined procedures. The homogenization procedure was performed directly in CTAB buffer with grains of sea sand. Selective amplification was carried out for a portion of the mitochondrial gene 12s rDNA (SSU) by polymerase chain reaction (PCR) using the primers 12CR3 (5⬘-ACTTTGTTACGACTTATCTC-3⬘) and 12s-5c (5⬘-GCCAGCCGTCGCGGTTAGAC-3⬘). Both PCR primers were extended at the 5⬘ end with the sequences of the primers M13 forward and M13 reverse. PCR conditions were 40 cycles with 94°C/30 s denaturing, 40 – 42°C/45 s annealing, and 72°C/45 s extensions. PCR products were gel-purified and concentrated using microconcentrators (Microcon 50). PCR products were directly cycle-sequenced by dideoxy chain termination using fluorescein-labeled M13 forward and M13 reverse primers. Sequencing gels were run on ALF sequencers (Pharmacia). Phylogenetic Analysis In general, alignment is the first crucial step in the analysis of rDNA sequences that has a major influence on the results of the phylogenetic analysis. In a cladistic framework the best alignment is that which yields the most parsimonious cladogram. We used the direct optimization procedure (Wheeler, 1996) as implemented in the program Poy (Gladstein and Wheeler, 1996 –2000) using parsimony as optimality criterion. Direct optimization combines both alignment and phylogenetic analysis in one step, which guarantees a consistent use of analysis assumptions in the entire analysis (Philipps et al., 2000). The key difference between direct optimization and multiple alignment is that evolutionary differences in sequence length are accommodated not by the use of gap characters but by allowing insertion– deletion events. As preferred weighting scheme we weighted substitutions 1 (transitions and
transversions equally weighted) and indels 2. In a sensitivity analysis (Wheeler, 1995) six other weighting schemes were also used (transition:transversion:indels, 1:2:2, 1:1:4, 1:2:4, 1:2:8, 1:1:7, 1:1:10). Each analysis was carried out using the options “norandomizeoutgroup,” “maxtrees 10,” “fitchtrees,” “multibuild 10,” “checkslop 10,” and “random 100.” This includes 10 sequence random additions without branch swapping, SPR and TBR branch swapping based on the shortest tree of these 10 calculations, and an extra TBR branch swapping round, checking all cladogram lengths that are within 1% of the current minimum value. Using the option “impliedalignment,” a topology-specific multiple alignment was generated under the preferred weighting scheme (see Appendix). This alignment was transformed into a Phast-file (Goloboff, 1993–2000) and calculated using “autocal,” “hold 1000,” “mult* 20” (same weighting scheme as in Poy). Also, the decay index (Bremer, 1994) was calculated with Phast (“hold 1000,” “bs 20”). A bootstrap analysis (Felsenstein, 1985) was carried out with Nona (Goloboff, 1993–2000) using the same alignment (1000 replications, “mult* 10,” “hold/10,” “tbr”). Winclada (Nixon, 1999 –2000) was used as shell program. RESULTS The calculation under our preferred weighting scheme (ts:tv:indel ⫽ 1:1:2) resulted in one most-parsimonious tree (amb-) with a length of 646 steps (181 parsimony informative characters counted in Winclada) (Fig. 3). The calculation of Phast resulted in the same most-parsimonious trees with 646 steps. All clades apart from (Simocephalus–Daphnia) (not supported under assumptions 1:1:7 and 1:1:10) are also supported by all other weighting schemes used.
108
RICHTER ET AL.
FIG. 3. Phylogenetic hypothesis of the Onychopoda and other representatives of the Cladocera (Anomopoda, Ctenopoda, Haplopoda), inferred from a direct optimization analysis of DNA sequences of a fragment of the mitochondral 12S rDNA. The decay indices are given above the lines and the bootstrap values below the lines.
Our analysis is in agreement with the Gymnomera concept, which suggests a sister group relationship between Haplopoda and Onychopoda but the support is relatively weak (decay index 2; bootstrap value 57%). The monophyly of the Onychopoda and the monophyletic origin of the Cercopagididae and Podonidae are well supported. Only one representative of the Polyphemidae was included in our analysis. Cercopagididae and Podonidae are sister groups and the Polyphemidae is the sister group of both. Within the Podonidae, the two species of the exclusively marine genus Podon form the most basal clade. The three Podonevadne species (P. trigona, P. camptony, and P. angusta) and Cornigerius maeoticus form a monophyletic clade that cannot be resolved with the gene fragment studied. The sister group of this clade is represented by the two Evadne species. Most of the clades within the Podonidae are well supported, except for the Evadne clade, which shows a low decay index (2) and a relatively low bootstrap value (73%).
DISCUSSION In addition to morphological cladistic studies (Martin and Cash-Clark, 1995; Olesen, 1998) and molecular analyses based on 16S rDNA data (Schwenk et al., 1998) and 18S rDNA data (Taylor et al., 1999), our 12S rDNA data also support a sister group relationship between Haplopoda (Leptodora kindtii) and Onychopoda and therefore a monophyletic Gymnomera. Although the Sida–Diaphanosoma and Daphnia–Simocephalus clades are well supported, it is not justified to infer monophyly for the Ctenopoda or Anomopoda. The taxon sampling is too restricted and some crucial taxa of these groups are not considered (e.g., Holopedium for the Ctenopoda or the Chydoridae for the Anomopoda). The monophyly of the Onychopoda and of its three families is supported by our analysis. The sister group relationship between Cercopagididae and Podonidae, as has been proposed by Martin and Cash-Clark (1995), is also supported by our molecular data. One of the most interesting questions of our analysis
PHYLOGENY OF CLADOCERA
109
FIG. 4. Hypothesis of the invasions of onychopod water-fleas into the Ponto–Caspian basin. The Ponto–Caspian basin was twice conquered by freshwater invaders (light gray arrows). For the ancestors of the Podonidae, a transition from freshwater into the world oceans is suggested (black arrow). Within the Podonidae, a double invasion into the Ponto–Caspian is hypothesized (dark gray arrows).
concerns the habitat of the different onychopod taxa. Unfortunately, different possibilities are equally parsimonious under the assumption of equal probability of changing the habitat; i.e., the interpretation depends on the optimization mode. Therefore, our suggestions are based not only on the here-presented phylogenetic relationships but also on a tentative morphological phylogenetic analysis including the podonid genera Pleopis and Pseudoevadne (unpublished) and geological data. We suggest several independent invasions into the Ponto–Capian basin—separate in each of the onychopod families (Fig. 4). Quite probable is that there were two invasions from freshwater. One of these took place within the Cercopagididae. As a freshwater inhabitant, Bythotrephes longimanus represents the ancestral condition. The ancestor of the representatives of Cercopagis invaded the Ponto–Caspian basin. A second invasion from freshwater is suggested for the ancestor of the Caspian polyphemid species P. exiguus. Although this species is not included in our analysis, a sister group relationship to the freshwater species Polyphemus pediculus is strongly suggested based on
morphological correspondences (Mordukhai-Boltovskoi, 1968); as a matter of fact, it cannot be excluded that P. exiguus is only a different morphotype from P. pediculus (Aladin et al., 1999). The interpretation of phylogenetic relationships within the Podonidae with respect to habitats is more complicated. There is no doubt that the early ancestors of the Podonidae lived in freshwater like almost all other Cladocera. The crucial question is whether the freshwater ancestors invaded the Ponto–Caspian, and then later the world oceans, or whether they directly conquered the world oceans from freshwater and later the Ponto–Caspian basin. Both possibilities have been suggested by several authors. Due to the already mentioned fact that almost all other cladocerans are freshwater inhabitants, it has been claimed that freshwater ancestors immigrated into the Ponto–Caspian basin and that much later, after a species radiation, the most salt-tolerant species expanded to the world oceans through the Bosporus (Aladin, 1995; Dumont, 1998a). Dumont (1998a) supposed that the latter happened during its most recent opening in the Holocene. On the
110
RICHTER ET AL.
other hand, Gibitz (1922), Mordukhai-Boltovskoi and Rivier (1987), and Potts and Durning (1980) argued for an origin of the Ponto–Caspian Podonidae in the world oceans. We think that the latter is the more plausible explanation. A good candidate for the time of the podonid invasion into the Ponto–Caspian is the Agchagylian transgression (3.4 –2 myr ago) when Eastern Paratethys was reconnected with the world oceans (Degens and Paluska, 1979; Jones and Simmons, 1996). During this time marine plankton was introduced into the Ponto–Caspian basin (Jones and Simmons, 1996). However, after this event, the Ponto– Caspian basin freshened again and only a brackish water fauna could survive (Jones and Simmons, 1996). Some of these fauna representatives were possibly the ancestors of the Ponto–Caspian podonids of the genera Cornigerius, Podonevadne, Caspievadne, and the Caspian Evadne species. After this major Agchagylian transgression period, beginning with the Aspheronian (2– 0.7 myr ago, which was according to Jones and Simmons (1996) essentially regressive in character), several high and low stands of the Ponto–Caspian basin were linked to the glaciation cycles (Dumont, 1998b). The invasions from freshwater within the Cercopagididae and Polyphemidae probably occurred in one of these transgression periods when smaller freshwater bodies (lakes and rivers) were flooded by the Caspian and Black Seas. At this time, both “seas” were freshwater bodies at least in their major parts (Dumont, 1998b). Due to the fact that Cercopagis pengoi occurs in the Caspian Sea and the Sea of Azov, this invasion probably happened before these water bodies became separated. This was about 77,000 years ago
(Yakovlev, 1956). One could argue that this period (between about 2 myr and some 100,000 years ago) is not long enough for a radiation of the 13 Cercopagis species, but the species number is very likely to be overestimated (Aladin, 1995; Aladin et al., 1999). Only very recently, long after the loss of the connection between the Black Sea and the Caspian Sea, the connection between the Mediterranean Sea and the Black Sea opened again. This Holocenian event—recently interpreted as Noah’s flood (Ryan and Pitman, 2000)— about 7150 years ago, resulted in a rapid increase in the water level of the Black Sea (Ryan et al., 1997; Demirbag et al., 1999). Also, the salinity of the central part of the Black Sea increased and marine species from the Mediterranean Sea invaded this region (Schrader, 1979). We suggest that podonid species (our group 3) also were involved in this invasion. The brackish water Ponto–Caspian endemics, which had lived in the freshened Black Sea before, were displaced to the Sea of Azov and other peripheral parts of the Black Sea with a lower salinity. ACKNOWLEDGMENTS We are grateful to Dr. Vasili Petuchov, Dr. R. Saborowski, and E. Eder for theis assistance in collecting specimens. We are thankful to Replicon GmbH, which allowed the complete DNA work to be carried out in its lab. We thank Dr. B. Schro¨der for support with geological interpretations and for providing literature, Dr. J. Olesen for comments on the manuscript, Dr. S. Rogaschewski for support during the SEM study, and I. Drescher for translations from Russian into German. The financial support by the Deutsche Forschungsgemeinschaft to S.R. and G.S. (436 RUS 18/15/98; DFG Scho 442/6-1) and the financial support to N.A. (Russian Fund for Basic Research 96-04-48114) is gratefully acknowledged.
APPENDIX Alignment Resulting from Poy’s “Impliedalignment” under the Preferred Weighting Scheme (646 Steps) I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
GGGCGATGTGTACACATCTCAGAGC-TTTTTTCAAATTATCTTTCTAAAATAATTTTACTTCCAAATCCA GGGCGATATGTACATATTCTATTGCTAAATTTCAATTCTTTATAATTAAAAAAATTTACTCACAAATCCG GGGCGATATGTGCACATCCTATTGC-CTTATTCAACTTACTGTACTTAAGTAAATTTACTAATAAATCCA GGGCGATATGTACACATCTCAGAGC-CAAATTCAGCTAACCTTTCTTAAATTAACTTACTAACAAATCCA GGGCGATATGTACACATCTCAGAGC-CAAATTCAGTTAACCTTTCTTAAATTAACTTACTAACAAATCCA GGGCGATATGTACACATCTCAGAGC-CAACTTCAATTATCTTTTCTTAAAATAATTTACTGACAAATCCA GGGCGATATGTACACATCTCAGAGC-CAACTTCAACTATACTTTCTTAGACTAGTTTACTGACAAATCCA GGGCGATATGTGCACATCCCAGAGC-CAAATTCAATATACGATTCTAAAATATATTTACTAACAAATCCA GGGCGATATGTACATACCTCATAGC-CTTATTCAAATAAATATTCTAATTTTATTTTACTGACAAATCCA GGGCGATATGTACACGCCTCAGAGC-CAACTTAAAATAATTATTCTTAAAGTATTTTACTAGTAAATCCA GGGCGATATGTGCACACCCCAGGGC-CAACTTCAATAGAGGATTCTTAACTCTATTTACTGACAAATCCA GGGCGATATGTACACATCTCCCCGC-CAACTTCAATTATCTTTTCTTAAAATAATTTACTGACAAATCCA GGGCGATATGTACACATCTCAGAGC-CAACTTCAATTATCTTTTCTTAAAATAATTTACTGACAAATCCA ??????????????????????????????????????????????????????????????????T-CA GGGCGATATGTACACATCTCATAGC-CAACTTCAATTATCTTTTCTTAAAATAATTTACTGACAAATCCA GGGCGATATGTACACATTCTTTTAC-CTTCTTCAAAAAGTTATACTTAAACAATTTTACTAGCAAATCCA GGGCGATATGTGCATATTTCATTGC-AACCTTCAGTGAATCTTTCTTAAATACACTTACTTACAAATCCA
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius
CCTTAAAT-TGTTT-TTTCATAA-A-ATTTCCGTGTAATTTATAATTATTGTAACCCATC-ACCACCTTC CCTTCATA-TGATT-TTTCATACAT-AATCCGTTATTAATTAAATTAAATGTAGCTCATC-TTCTCTTAG CCTTCACC-TGAGT-TTTAAGCCTA-AAATCCGTATTTCTATTAAAAATTGTAGCTCATC-ACTGCCCTT CCTTCATA--AAGGAATTACACCTTAAAATCCGTATTAATAACTTTAATTGTAGCTCATCTGCGACTTAA CCTTCATA--AAGGAATTACACCTTAAAATCCGTATTAATAAATTTAATTGTTGCTCATCTGCCACTTAA
PHYLOGENY OF CLADOCERA
111
E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
CCTTCAAG--AAGG-ATTACACCTT-AAATCCGTATTAGTAACTCTAATTGTAGCTCATCTGAAACTTAA CCTTCAAG--AAGGAATTACACCTT-AAATCCGCATTAATAACTCTAATTGTAGCCCATCTGAAACTTAA CCTTCCTA--AAAG-ATTACACTTT-TTATCCGTATAAATAACATTTATTGTAGCTCATC-TACTCTTAA CTTTCATAGCCATG-TTTAAAAACT-AATCCATAATTAATTAATTTAATTGTAGCTCACC-ACCACTTAA CCTTCAAT--AAAG-ATTACACTTT-ATTTCCGTATTTAT-ACATAAATTGTAGCTCATC-AATCCTTAA CCTTCCTA--GAAG-ATTACACTTC-TATTCCGTATAAATATCATTTATTGTAGCTCATC-GACTCTCAA CCTTCAGA--AAGGAATTACACCTT-AAATCCGTATTAGTAACTCTAATTGTAGCTCATCCGAAACTTAG CCTTCAGA--AAGGAATTACACCTT-AAATCCGTATTAGTAACTCTAATTGTAGCTCATCCGAAACTTAG CCTTCAGA--AAGGAATTACACCTT-AAATCCGTATTAGTAACTCTTATTGTAGCTCATCCGAAACTTAG CCTTCAGA--AAGGAATTACACCTT-AAATCCGTATTAGTAACTCTAATTGTAGCTCATCCGAAACTTAG CCTTC-CA-AAAGT-ATTAAAACTA-ATATCTGTTTTTTTAAATTAAATTGTAGCTCACC-ACTACCCTT CCTTCTTA-ATGGG-TTTCACCATT-GATTCGTTTTTAATTATTTTAATTGTAGCTCATC-ACCTCTTAA
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
TTATAAGCTGCACCTTGACCTGAAGTTAGTAAAAATA---GTTAAT-TT-AGATAATA-TCTTTT-TAGA TTATAAGTTGCACCTTGACCTGAAG-TC-TTTAAATT---ATCAAT-GA-AGGAAACA-TTCTTT-TAAA CTATAAACTGCACCTTGACCTGAAG-TA-AGAAAAAT---ATTTTT-CC-TGAAAACG-TTCTTT-TAAA CTATAAACTGCACCTTGACCTGAAG-TA-AAAGACCT---TTCTTT-AT-TGAAAACA-TCCTAT-AGGA CTATAAACTGCACCTTGACCTGAAG-TA-AAAGAAGT---ATCTTT-TT-TGAAAACA-TCCTAT-AGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAAATT---ATATTT-AT-TGAAAACG-TCCTAT-TGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAACTT---ATATTT-AT-TGAAAACG-TCCTAT-TGGA TCATAGACTACACCTTGACCTGAAG-TA-AAAGAACT---ATCTTT-AG-AGAAAACA-CCCTTT-TAGA CCATAAACTGCACCTTGACCTGAAG-TG-AAAAAATT---ATTTTT-CT-AGAAGACA-TCCTAT-AAGA CCATAGGCTACACCTTTACCTGAAG-TA-ATAGAATT---ATCTAA-CT-CGAAAACT-TCCTCT-AGGA TCATAGACGGCACCTTGACCTGAAG-TG-AAAGAATT---ATCTTT-AA-AGAAAAC--TCCTAT-TAGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAATCT---ATATTT-AT-TGAAAACA-TCCTAT-TGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAATCT---ATATTT-AT-TGAAAACA-TCCTAT-TGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAATCT---ATATTT-AT-TGAAAACA-TCCTAT-TGGA CTATAGACTGCACCTTGACCTGAAG-TA-AAAAATCT---ATATTT-AT-TGAAAACA-TCCTAT-TGGA TTATTAGCTGCACCTTGACCTGAAG-TA-AAAAAATT---ATTTTTATT-TGAAAACGTTTCTTTATGAA TCATAAGCTGCACTGTGACCTGAAT-TT-TTGAAGTTGGGGTTATT-TAGTGGGAACA-TTCTTT-TAAA
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
ATTATCTGACAACGGCGGTATACAAACT---A-G-ACAAAAGAAGGTAAGGTAAAACGTGGATTGTCGAT GTAACCTGAC-ACGGCGGTATACAAACTGC-TAT-ACAAAACCAAGAAAGGTAAATCGAGGATTATCAAT GTAATCTGACAACGGCGGTATACAAGCT---T-A-ACAAAAAAGGGTAAGATAAAATGGGGACTATCAAT GTAATCTGACAACGGAGGTATACAAGCTG-ATTAACCAAA-TTAAGTAAGATTTAACGGGGATTATCGAT GTAATCTGACAACGGAGGTATACAAGCTG-ATTAACCAAG-CTAAGTAAGATATAACGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATCTAACGGGGATTATCGAT GTAATCTGACAACGGCGGTATATAGG-TG-AATTAACTAGACCAAGAAAGATATAATGAGGGGTATCAAT GTAGTCTGACAACGGAGGTATACAAGTTG--AAA-ACAAGGTTAAGAAAGATCTAACGGGGACTATCATT GTAATCTGACAACGGCGGTATATAAGCTG--TTT-ACAAGATTAAGTAAGATTTAATGGGGAATATCAAT GTAATCTGACAACGGAGGTATACCGGCTG-ATTCAACAAGACTGAGAAAGATATAATGGGGAACATCAAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGCGGTATACAAGCTG-AAAAACCAAG-CTAAGTAAGATTTATCGGGGATTATCGAT GTAATCTGACAACGGAGGTATACAAGCT---C-T-ACAAAAAAAGGTAAGATAAAACGAGGATAATCGAT GTAACCTGACAACGGTGGTATACAAGCTG--AAT-ACTAGATTAAGTAAGATTAAACGGGGGTTATCGAT
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
TACGGGACAGGTTCCTCTGGAAAGAGTGAGATGCCGTCAAATT-CTTTGGGTTTGGAGATTTTCTTTTAC TATGAGACAAGCTCCTCTGTAAAGG-TAGAATACCGCCAAAAT-CTTTGGGTTTGAAGAACATCTTTTAC TATAGGACAAGCTCCTCTATTAGGA-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACAACTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAATATCTTTTAC CACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAATCTCTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACGTCTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACATCTTTTAC TATGTGACAAGCTCCTCTGTTAGGT-TAGGATGCCGCCAAAGT-CTTTGGGTTTGAAGAATTTCTTTTAC TAAAGGGCAAGCTCCTCTGTTAGGA-TAAGGTACCGCCAAATT-CTTTGGGTTTGAAGAA-TTCTTTTAC TATACGACAAGCTCCTCTACTAGGA-TAAGGCACCGCCAAAAT-CTTTGGGTTTGAAGAACATCTTTTAC TATGTGACAAGCTCCTCTGTTAGGT-TAGGGTACCGCCAAAGT-CTTTGGGTTTGAAGAACTTCTTTTAC TACACGACAAGCTCTTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACAACTTTTAC TACACGACAAGCTCCTCTGTGAAGG-TAAGATGCCGCCAAAATCCTTTGGGTTTGAAGAACAACTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACAACTTTTAC TACACGACAAGCTCCTCTGTGAGGT-TAAGATGCCGCCAAAAT-CTTTGGGTTTGAAGAACAACTTTTAC TATAGGACAAGCTCCTCTGTTTGGT-TAAAATGCCGCCAAAAC-CTTTGGGTTTGAAGGATAACTTTTAC TATGGGACAAGCTCCTCTGTTGTGG-TGAAATACCGCCAAAGT-CTTTGGGTTTGAAGGATTTCTTTTAC
112
RICHTER ET AL.
I. yeyetta S. crystallina D. pulex P. leuckarti P. intermedius E. nordmanni E. anonyx B. longimanus L. kindtii P. pediculus C. pengoi C. maeoticus P. angusta P. camptonyx P. trigona S. vetulus D. brachyurum
TACCCT--GGCAAT-GAAG-GATA-AGAATAGTAGGGTATCTAA-T-CCTAGTTTA TACCCT--AAAATC-ATTT--AGTTAAAATAACAGGGTATCTAA-T-CCTGGTTTA TACCCTA-TTTACA-TTAT-TATTTAGAATAACAGGGTATCTAA-T-CCTGGTTTT TACCCT--GACAAG-AAGT-CAACTGGAATAACAGGGTATCTAA-T-CCTGGTTTT TACCCT--GACAAG-AAAT-CATCTAGAATAACAGGGTATCTAA-T-CCTGGTTTT TACCCT--GACAAGTTATT-GGGCTGGGATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--GACAAGTTATT-TGGCTGGGATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--AACAT--ATGT-ATACTAGTATAGCAGGGTATCTAATTCCCTGGGTTT TACCCT-AGTAAAG-CTTT-CAAGAAGAATAACAGGGTATCTAA-T-CCTGGTTTA TACCCT--TACATA-AGAG-GGGCTAGAATAATAGGGTCTCTAA-T-CCTAGTCTT TACCCT--GACATA-AAGT-TAACTAGTATAACAGGGTATCTAA-T-CCTGGTTTA TACCCT--GACAAGTAATT-GGGCTGGAATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--GACAAGTAATTAGGGCTGGAATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--GACAAGTAATT-GGGCTGGAATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--GACAAGTAATT-GGGCTGGAATAACAGGGTATCTAA-T-CCTGCTTTT TACCCT--TGAAAA-ATAT-T-TAGAAATTAACAGGGTATCTAA-T-CCTGGTTTA TACCCT--GAATAA-TTTT--TACTAAAATAGCAGGGTCTCTAA-T-CCTGGTTTT
Note. More parsimonious alignments might be possible but they should not produce more parsimonious topologies.
REFERENCES Aladin, N. V. (1995). The conservation ecology of the Podonidae from the Caspian and Aral seas. Hydrobiologia 307: 85–97. Aladin, N. V., Ryabova, V. N., Chuykov, Y. S., and Plotnikov, I. S. (1999). Problems of macro- and microevolution in the superfamily Polyphemeoidea–Onychopoda (Cladocera). Proc. Zool. Inst. RAS 281: 97–100. Bowman, T. E., and Abele, L. G. (1982). Classification of the recent Crustacea. In “The Biology of the Crustacea,” Vol. I: “Systematics, the Fossil Record and Biogeography” (L. G. Abele, Ed.), pp. 1–27. Academic Press, New York. Braband, A., Richter, S., Hiesel, R., and Scholtz, G. (2000). Phylogeny of the Branchiopoda (Crustacea) inferred by DNA data. Zoology 103, Suppl. III (DZG 93.1): 99. Bremer, K. (1994). Branch support and tree stability. Cladistics 10: 295–304. Degens, E. T., and Paluska, A. (1979). Tectonic and climatic pulses recorded in Quaternary sediments of the Caspian–Black Sea region. Sediment. Geol. 23: 149 –163. Demirbag, E., Go¨kasan, E., Oktay, F. Y., Simsek, M., and Yu¨ce, H. (1999). The last sea level changes in the Black Sea: Evidence from the seismic data. Mar. Geol. 157: 259 –265. Doyle, J. J., and Doyle, L. (1990). Isolation of plant DNA from fresh tissue. Focus 12: 13–15. Dumont, H. J. (1998a). Editor’s introduction—The Caspian Cradle. In “The Predatory Cladocera (Onychopoda: Podonidae, Polyphemidae, Cercopagidae) and Leptodorida of the World” (Rivier, I. K.), pp. 9 –15. Backhuys, Leiden. Dumont, H. J. (1998b). The Caspian Lake: History, biota, structure, and function. Limnol. Oceanogr. 43: 44 –52. Eriksson, S. (1934). Studien u¨ber die Fangapparate der Branchiopoden nebst einigen phylogenetischen Bemerkungen. Zool. bidrag fran Uppsala 15: 23–287. Felsenstein, J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783–791. Fryer, G. (1987). Morphology and the classification of the so-called Cladocera. Hydrobiologia 145: 19 –28. Gibitz, A. (1922). Verbreitung und Abstammung mariner Cladoceren. Verh. Zool.-Bot. Gesell. Wien 71: 85–105. Gladstein, D., and Wheeler, W. C. (1996 –2000). POY—Phylogeny reconstruction via direct optimization of DNA data, version 2.0. Am. Mus. Nat. Hist., New York.
Goloboff, P. A. (1993–2000). PIWE/NONA/PHAST/SPA (Parsimony with Implied Weights). P. Goloboff, Instituto Miguel Lillo, Tucuman, Argentina. Gruner, H.-E. (1993). Crustacea. In “Arthropoda (ohne Insecta). Lehrbuch der Speziellen Zoologie” (H.-E. Gruner, Ed.), Bd. I, 4. Teil. pp. 448 –1030. Fischer, Jena. Jones, R. W., and Simmons, M. D. (1996). A review of the stratigraphy of Eastern Paratethys (Oligocene–Holocene). Bull. Nat. Hist. Mus. Lond (Geol.) 52: 25– 49. Karaman, M. (1962). Ein Beitrag zur Systematik der Astacidae. Crustaceana 3: 173–201. Martin, J. W., and Cash-Clark, C. E. (1995). The external morphology of the onychopod ‘cladoceran’ genus Bythotrephes (Crustacea, Branchiopoda, Onychopoda, Cercopagididae), with notes on the morphology and phylogeny of the order Onychopoda. Zool. Scripta 24: 61–90. Mordukhai-Boltovskoy, P. D. (1962). Poyavlenie v Kaspiyskom more predstavitelya sredizemnomorskih polifemid [Appearance of Mediterranian polyphemids in the Caspian Sea]. Zool. Z. 41: 289 –290. Mordukhai-Boltovskoi, P. D. (1966). Distribution, biology and morphology of Polyphemidae in fresh and brackish waters of the Pontocaspian basin. Verh. Int. Ver. Limnol. 16: 1677–1683. Mordukhai-Boltovskoi, P. D. (1968). On the taxonomy of the Polyphemidae. Crustaceana 14: 197–209. Mordukhai-Boltovskoi, P. D., and Rivier, I. K. (1987). “Predatory Cladoceran Podonidae, Polyphemidae, Cercopagidae and Leptodoridae of the World Fauna.” Nauka, Leningrad. [in Russian] Negrea, S., Botnariuc, N., and Dumont, H. (1999). Phylogeny, evolution and classification of the Branchiopoda (Crustacea). Hydrobiologia 412: 191–212. Nixon, K. C. 1999 –2000: Winclada (Beta) ver. 0.9.9, Ithaca, NY. Olesen, J. (1998). A phylogenetic analysis of the Conchostraca and Cladocera (Crustacea, Branchiopoda, Diplostraca). Zool. J. Linn. Soc. 122: 491–536. Onbe´, T. (1999). Ctenopoda and Onychopoda (⫽Cladocera). In “South Atlantic Zooplankton” (D. Boltovskoy, Ed.), pp. 797– 813. Backhuys, Leiden. Philipps, A., Janies, D., and Wheeler, W. (2000). Multiple sequence alignment in phylogenetic analysis. Mol. Phylogenet. Evol. 16: 317–330. Potts, W. T. W., and Durning, C. T. (1980). Physiological evolution in the branchiopods. Comp. Biochem. Physiol. 67B: 475– 484. Rivier, I. K. (1998). The predatory Cladocera (Onychopoda:
PHYLOGENY OF CLADOCERA Podonidae, Polyphemidae, Cercopagidae) and Leptodorida of the world. In “Guides to the Identification of the Microinvertebrates of the Continental Waters of the World” (H. J. Dumont, Ed.), pp. 16 –213. Backhuys, Leiden. Ryan, W. B. F., Pitman, W. C., Major, C. O., Shimkus, K., Moskalenko, V., Jones, G. A., Dimitrov, P., Go¨ru¨r, N., Sakinc, M., and Yu¨ce, H. (1997). An abrupt drowning of the Black Sea shelf. Mar. Geol. 138: 119 –126. Ryan, W. B. F., and Pitman, W. C. (2000). “Noah’s Flood.” Touchstone, London. Sars, G. O. (1902). On the Polyphemidae of the Caspian Sea. Ezhegodnik Zool. Muz. Akad. Nauk 8: 31–54. Schminke, H. K. (1981). Adaptation of Bathynellacea (Crustacea, Syncarida) to life in the interstitial (“Zoea Theory”). Int. Revue Ges. Hydrobiol. 66: 575– 637. Schminke, H. K. (1996). Crustacea, Krebse. In “Spezielle Zoologie. Erster Teil: Einzeller und Wirbellose Tiere” (W. Westheide and R. Rieger, Eds.), pp. 501–581. Fischer, Stuttgart. Scholtz, G. (1995). Ursprung und Evolution der Flusskrebse (Crustacea, Astacida). Sitzber. Ges. Naturforsch. Freunde Berlin (N.F.) 34: 93–115. Schrader, H.-J. (1979). Quaternary paleoclimatology of the Black Sea basin. Sediment. Geol. 23: 165–180. Schwenk, K., Sand, A., Boersma, M., Brehm, M., Mader, E., Offerhaus, D., and Spaak, P. (1998). Genetic markers, genealogies and biogeographic patterns in the Cladocera. Aquat. Ecol. 32: 37–51.
113
Spandl, H. (1923). Zur Kenntnis der Su¨sswassermikrofauna Vorderasiens. Ann. Nat. Hist. Mus. Wien 36: 124 –149. Spears, T., and Abele, L. G. (2000). Branchiopod monophyly and interordinal phylogeny inferred from 18S ribosomal DNA. J. Crust. Biol. 20: 1–24. Taylor, D. J., Crease, T. J., and Brown, W. M. (1999). Phylogenetic evidence for a single long-lived clade of crustacean cyclic parthenogens and its implications for the evolution of sex. Proc. R. Soc. Lond. B 266: 791–797. Walossek, D. (1993). The Upper Cambrian Rehbachiella and the phylogeny of Branchiopoda and Crustacea. Fossils Strata 32: 1–202. Wheeler, W. C. (1995). Sequence alignment, parameter sensitivity, and the phylogenetic analysis of molecular data. Syst. Biol. 44: 321–331. Wheeler, W. C. (1996). Optimization alignment: The end of multiple sequence alignment in phylogenetics? Cladistics 12: 1–9. Wingstrand, K. G. (1978). Comparative spermatology of the Crustacea Entomostraca. 1. Subclass Branchiopoda. Kong. Dansk. Vidensk. Selsk. Biolog. Skrifter 22: 1– 67. Yakovlev, S. A. (1956). Principles of geology of quaternary deposits of the Russian plainland (Stratigraphy). [in Russian; cited in: Rivier, I. K. (1998). “The predatory Cladocera (Onychopoda: Podonidae, Polyphemidae, Cercopagidae) and Leptodorida of the world,” pp. 16 –213, Backhuys, Leiden]