- Email: [email protected]
The pitfalls of sequencing: revised sequence of the X-CGD gene
let
T I C , - August 1987, VoL 3, no. 8
The pitfalls of sequencing: revised sequence of the X-CGD gene In the recent TIG review of Xlinked clu'onic granulomatous disease (X-CGD), it was proposed that the 90 kDa b-cytochrome component encoded by the 'disease' gene 2.a is derived from a primary translation product of 506 amino acids from which a 20-amino acid segment peptide ndght be removed. This latter conclusion was based on (I) the prediction of a 20-amino acid signal peptide4 Lmmediately foaowmg an AUG about 200 nucleoddes into the cDNA sequence; (2) wheat germ translation of RNA synthesized in
cDNA sequences originally proposed as 5'-untranslated region. Second, in our laboratory, genomic DNA sequences were examined which revealed discrepandes with the sequence derived from our longest (and only) cDNA to extend to the 5' end of the mRH~L In the revised sequence (see Fig. 1), a consensus AUG codon precedes the determined N-terminal glycine and is inframe with the largest open reading frame of the cDNA. $1 analysis has cOnfLrmed previous primer extension data3 which indicated the complete-
cell must be directed by internal sequences. Conclusions regarding the nature of the protein encoded by the X-CGD and its function(s) remain unaffected. The difficukies encountered in assignig the N-terminus only underscore the need for direct biochemical confirmation of predictions derived from DNA sequence data, a conclusion stressed before. If a single nucleotide sequencing error has created such confusion for us, dare we consider the prospects for misinterpre. tation when predictions are based on a complete genome sequence? References
I Orkin, S. H. (1987) Trends Genet. 3, 149151
Original~
CTTGCTG~CACCATC-GGGGAACTGGGCTGTGAATGAGGGGCTCTCCATTTTTGCTATTCTGGTTTGGCTGGGGTTGAACG
.
.
.
.
.
Corrected: CCTCTGCCACCAT-GGGGAACTGGGCTGTGAATGAGGGGCTCTCCATTTTTGTCATTCTGCTTTGGCTGGGGTTGAACG. . . . .
HE TGlyAsnTrpAlaValAsnGluGlyLeuSerllePheValIleLeuValTrpLeuG1yLeuAsn Fig. 1. X-CGD eDNA seque~es. ~/tro3, which supported use of this AUG (rather than a downstream one which had been initially favored); and (3) the lack of in-frame AUGs upstream in the original cDNA sequences. Very recently, two developments have led to a reassessment of these conclusions. First, Teahan et al. s provided direct amino acid sequences of the 90 kDa b-cytochrome subunit, which demonstrated an Nterminal glycine and translation of
ness of the cDNA. The unusually shoA extent of the 5'-untranslated region (11 nucleotides) and a critical
sequence error contributed to our difficulties in settling the N-terminus from DNA sequence "alone. The primary tr&~.slation product of the X-CGD gene is, therefore, 570 amino acids (including the initiation methionine). Since no cleavable signal peptide exists, targeting of the protein to plasma membrane and specific granules in the phagecyOc
REPRINTS and BACK IF~RUES We can supply reprints of any article appearing in T/G at very reasonable rates. Please apply for details to: Production Manager, Elsevier Publications Cambridge, 68 Hills Road, Cambridge CB2 1LA, UK (minimum order 100) For information concerning orders for single complete issues of T/G please write to: TIG Back Issues, at the same address. © 19ffl, Elsevier~
F..zabmlge 0168-
9r'-~S,IB'//I~-t,.OO
2 Royer-PeLorz. B. etaL (1986) Nature 322, 32-38 3 Dinauer, M. C. el aL (1987) N,,tare 327, 717-720 4 Creighton, T. E. (1986) Nature 324. 21 5 Teahan, C. et at (1987) Nature 327. 720-721 STUART H. ORKIN
Division of Hematology, Howard Hughes Medical ltzstitute. Children's Hos#ital, 300 Longwood Ave, Boston, MA 02115, USA.
Coming soon, in Trends in Genetics How Drosophila larvae make glue: control of Sgs-3gene expression by Elliot M. Meyerowitz, K. VijayRaghavan, Peter H. Mathers and Margaret Roark The glue genes of Drosophila are expressed under control of a steroid hormone in third instar larvae. Recently. the cis- and transacting elements that regulate expression of Sgs-3, one of the glue genes, have been analysed. Sgs-3 expression is normally associated with a polytene chromosome puff. but there are mutations that uncouple puffing from gene expression.
T I C , - August 1987, VoL 3, no. 8
The pitfalls of sequencing: revised sequence of the X-CGD gene In the recent TIG review of Xlinked clu'onic granulomatous disease (X-CGD), it was proposed that the 90 kDa b-cytochrome component encoded by the 'disease' gene 2.a is derived from a primary translation product of 506 amino acids from which a 20-amino acid segment peptide ndght be removed. This latter conclusion was based on (I) the prediction of a 20-amino acid signal peptide4 Lmmediately foaowmg an AUG about 200 nucleoddes into the cDNA sequence; (2) wheat germ translation of RNA synthesized in
cDNA sequences originally proposed as 5'-untranslated region. Second, in our laboratory, genomic DNA sequences were examined which revealed discrepandes with the sequence derived from our longest (and only) cDNA to extend to the 5' end of the mRH~L In the revised sequence (see Fig. 1), a consensus AUG codon precedes the determined N-terminal glycine and is inframe with the largest open reading frame of the cDNA. $1 analysis has cOnfLrmed previous primer extension data3 which indicated the complete-
cell must be directed by internal sequences. Conclusions regarding the nature of the protein encoded by the X-CGD and its function(s) remain unaffected. The difficukies encountered in assignig the N-terminus only underscore the need for direct biochemical confirmation of predictions derived from DNA sequence data, a conclusion stressed before. If a single nucleotide sequencing error has created such confusion for us, dare we consider the prospects for misinterpre. tation when predictions are based on a complete genome sequence? References
I Orkin, S. H. (1987) Trends Genet. 3, 149151
Original~
CTTGCTG~CACCATC-GGGGAACTGGGCTGTGAATGAGGGGCTCTCCATTTTTGCTATTCTGGTTTGGCTGGGGTTGAACG
.
.
.
.
.
Corrected: CCTCTGCCACCAT-GGGGAACTGGGCTGTGAATGAGGGGCTCTCCATTTTTGTCATTCTGCTTTGGCTGGGGTTGAACG. . . . .
HE TGlyAsnTrpAlaValAsnGluGlyLeuSerllePheValIleLeuValTrpLeuG1yLeuAsn Fig. 1. X-CGD eDNA seque~es. ~/tro3, which supported use of this AUG (rather than a downstream one which had been initially favored); and (3) the lack of in-frame AUGs upstream in the original cDNA sequences. Very recently, two developments have led to a reassessment of these conclusions. First, Teahan et al. s provided direct amino acid sequences of the 90 kDa b-cytochrome subunit, which demonstrated an Nterminal glycine and translation of
ness of the cDNA. The unusually shoA extent of the 5'-untranslated region (11 nucleotides) and a critical
sequence error contributed to our difficulties in settling the N-terminus from DNA sequence "alone. The primary tr&~.slation product of the X-CGD gene is, therefore, 570 amino acids (including the initiation methionine). Since no cleavable signal peptide exists, targeting of the protein to plasma membrane and specific granules in the phagecyOc
REPRINTS and BACK IF~RUES We can supply reprints of any article appearing in T/G at very reasonable rates. Please apply for details to: Production Manager, Elsevier Publications Cambridge, 68 Hills Road, Cambridge CB2 1LA, UK (minimum order 100) For information concerning orders for single complete issues of T/G please write to: TIG Back Issues, at the same address. © 19ffl, Elsevier~
F..zabmlge 0168-
9r'-~S,IB'//I~-t,.OO
2 Royer-PeLorz. B. etaL (1986) Nature 322, 32-38 3 Dinauer, M. C. el aL (1987) N,,tare 327, 717-720 4 Creighton, T. E. (1986) Nature 324. 21 5 Teahan, C. et at (1987) Nature 327. 720-721 STUART H. ORKIN
Division of Hematology, Howard Hughes Medical ltzstitute. Children's Hos#ital, 300 Longwood Ave, Boston, MA 02115, USA.
Coming soon, in Trends in Genetics How Drosophila larvae make glue: control of Sgs-3gene expression by Elliot M. Meyerowitz, K. VijayRaghavan, Peter H. Mathers and Margaret Roark The glue genes of Drosophila are expressed under control of a steroid hormone in third instar larvae. Recently. the cis- and transacting elements that regulate expression of Sgs-3, one of the glue genes, have been analysed. Sgs-3 expression is normally associated with a polytene chromosome puff. but there are mutations that uncouple puffing from gene expression.