- Email: [email protected]
The point mutation and polymorphism in keratoconus candidate gene TGFBI in Chinese population
Gene 503 (2012) 137–139
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Short Communication
The point mutation and polymorphism in keratoconus candidate gene TGFBI in Chinese population Tao Guan a, Chibo Liu b,⁎, Zhangwei Ma a, Shiping Ding a a b
Taizhou Eye Hospital, Taizhou, Zhejiang, 318000, Zhejiang Province, China Department of Laboratory Medicine, Taizhou Municipal Hospital, Taizhou 318000, Zhejiang Province, China
a r t i c l e
i n f o
Article history: Accepted 18 April 2012 Available online 2 May 2012 Keywords: Keratoconus TGFBI gene Point mutation Genetic polymorphism
a b s t r a c t Objective: To understand the region point mutations and single nucleotide polymorphisms characteristic of keratoconus candidate gene in Chinese population, the TGFBI. Methods: Polymerase chain reaction–single strand conformation polymorphism and DNA direct sequencing were performed on blood samples from 30 cases of keratoconus patients and 30 normal controls. 17 exons from the coding region of TGFBI gene were examined for point mutations and single nucleotide polymorphisms. Results: Two types of base mutation were found in exon 12, which were both heterozygous. In 1 patient the site 535 showed GGA→TGA substitution, which was the change from glycine to stop codon (G535X). This was not found in all control cases. In 2 patients and 1 control case the site 540 showed TTT→TTC substitutions without changing of the coding for phenylalanine (F540F), suggesting for the polymorphism. Conclusion: The candidate keratoconus gene TGFB1 showed genetic variation and mutation in keratoconus population. The gene might play a role in the development of keratoconus in Chinese population. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Keratoconus is a congenital disease of non-inflammatory corneal ectasia, with incidence rate of 1/2000, and male/female ratio at 1.7. The disease showed sporadic distribution, with family history in 6% to 10% patients including both autosomal dominant and recessive forms (Rabinowitz, 1998). The pathological feature of keratoconus includes the decreased corneal collagen or abnormal distribution of the collagen fiber, which will reduce the mechanical resistance of the cornea and therefore the protruding forward center of cornea, leading to a thin conical shape (Romero-Jimenez et al., 2010; Warren, 2008). The slit lamp microscope examination of keratoconus patient could demonstrate the Vogt's line, Fleischer's ring and the corneal scar (El Dib and de Freitas, 2008; Ertan and Colin, 2007; Rabinowitz, 1998; Romero-Jimenez et al., 2010). The onset of the disease occurs in the puberty period, involving both eyes, and with highly irregular astigmatism. In late phase the patient will show acute corneal edema and scar formation, significant vision loss, and can only be treated with cornea transplant (Jhanji et al., 2011; Kumar and Rootman, 2010).
Abbreviations: TGFBI, Transforming growth factor β-induced; PCR-SSCP, Polymerase chain reaction-single strand conformation polymorphism; COL6A1, Collagen type VI α1 chain. ⁎ Corresponding author. E-mail address: [email protected] (C. Liu). 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2012.04.061
It has been suggested that keratoconus was relevant to the corneal stroma hypoplasia (Romero-Jimenez et al., 2010). Transforming growth factor β-induced (TGFBI) gene and its translation product (βig-h3 protein) play roles in cell adhesion, movement and interaction with the extracellular matrix during the orderly development of the corneal stroma. Previous studies showed the decreased expression of βig-h3 protein in the matrix layers of cornea and epithelium of keratoconus patients (Takacs et al., 1999), suggesting the potential involvement of TGFBI in keratoconus development. The present study employed polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and direct DNA sequencing techniques to examine point mutations and single nucleotide polymorphisms on 17 exons of the TGFBI gene in a Chinese population of keratoconus patients. 2. Subjects and methods 2.1. Clinical subjects 30 cases of keratoconus patients (12 male and 18 female aged from 9 to 46 years old) were admitted into the hospital from Sep 2006 to Jun 2009. The diagnosis was based on symptoms and slit lamp microscope examinations; the diagnostic features included progressive curvature of the anterior corneal surface steepening, the corresponding region of corneal thinning, Fleischer ring, Vogt's stripes, etc., combined with the corneal surface topography and a thicker caudal surface of cornea than 20 μm. 30 cases of healthy controls (11 male and 19 male aged from 11 to 44 years) were also
138
T. Guan et al. / Gene 503 (2012) 137–139
included. The study was approved by the local Ethics Committee of Taizhou Municipal Hospital, and had the informed written consent of the patients and control subjects. The systemic physical examination was performed to exclude other concurrent diseases, and 3 ml peripheral blood was extracted from the subject and stored in EDTA anticoagulation tubes before the whole genome DNA extraction with conventional phenol–chloroform approach. 2.2. Primer design The primers for 17 exons of human TGFBI gene were designed based on previous studies [4, 5] and the human genome DNA sequence of TGFBI from NCBI database. The primers were synthesized by Shanghai Shenggong biocompany (Shanghai, China), with the sequences as below (Table 1). 2.3. PCR reaction The HBP 220 PCR cycler (HYBAID, England) was used. 50μlPCR reaction system containing DNA template 200 ng, 10× buffer solution 5 μl, 1.5 mmol/L MgCl2, 0.25 μmol/L primer, dNTP each 100 μmol/L, and Taq enzyme (Shanghai Shenggong company) 2U. The procedure was as following: 94 °C for 5 min, then the 35 amplification cycles −94 °C denaturation 45 s, annealing 45 s, 72 °C extension for 50 s, finally the reaction was stopped after 72 °C extension for 10 min. The PCR products were examined with 2% agarose gel electrophoresis and EB staining. 2.4. SSCP-silver staining and DNA sequencing The 8% (49:1) non-denaturing polyacrylamide gel with 5% glycerol was used for SSCP-silver staining. 5 μl PCR products mixed with
Fig. 1. SSCP silver staining: Lane 1 and 5 are from the health control, with lane 2, 3, and 4 from keratoconus patients.
sample buffer (90% formamide, 0.05% bromophenol blue, and 0.05% xylene blue) were processed for denaturation at 95 °C for 10 min, then ice bath before the electrophoresis (100 V) at room temperature for 5 to 6 h (when xylene blue reached the bottom of the gel). Then the gel was fixed in 10% ethanol for 5 min, then 1% silver nitrate for 5 min, before the staining in 0.012 mol/L silver nitrate and 0.05% formaldehyde for 10 min. Then the gel was processed in 0.28 mol/L sodium carbonate, 0.1% formaldehyde, and 0.1 g/L sodium thiosulfate for colorization, which was stopped in 10% acetic acid finally. The gel was examined and abnormal bands were processed for PCR products purification. Then the DNA was sequenced on automated sequencing machines. The sequences were deposited to Genebank (reference number in process). 3. Results 3.1. PCR-SSCP results
Table 1 The primer sequence for 17 exons of TGFBI and PCR amplification conditions. Exon Primer sequence (5′→3′)
Annealing temperature (°C)
Product length (bp)
1
62
277
64
290
63
260
62
252
67
165
56
248
55
238
56
310
62
192
60
222
55
228
56
199
58
195
60
280
57
231
55
246
62
214
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
F: CGGAGGCGCTCTCACTTCC R: CGAGCCCCGACTACCTGACC F: GGGAGTCATTAAAGTGGGGTGGA R: AGCTTGGTCTCCTGGCTGGTTAC F: CAACTTAGTGGAGAGGGGCCAGA R: CTCTCTCCCACCATTCCCTTCC F: GCCATCCCTCCTTCTGTCTTCTG R: CCTCGGGGAAGTAAGGCAGTTC F: ACTGACACCCTGTCCTTCCTCCT R: AGCCCACACATGGAACAGAAATG F:CTGCTCATCCTTGCTGCTTCTCT R: AGAGTTCCTGCTAGGCCCCTCTT F: TCTGTGGGGAGTGCCAGAGTC R: CAAATGAGGCAGCAGCAGGA F: TGGACCCTGACTTGACCTGAGTC R: AAAGGATGGCAGAAGAGATGGTG F: CCCTGGGGTGGATGAATGATAAA R: GCCTCCAGGGACAATCTAACAGG F: ATTGCAGGAGCACATCTCTCTGG R: GCTTCCCAGGAGCATGATTTAGG F: GCCCCTCGTGGAAGTATAACCAG R: ATCCCACTCCAGCATGACCACT F: GGGCCCTGAGGGATCACTACTTT R: TGACAGGTGACATTTTCTGTGTGTG F: CAGCCTTTGATTTGCAGGACACT R: TGACCAGGCTAATTACCATTCTTGG F: CCAACTGCCACATGAAGAAAAGG R: TGCTCTACCTTTCAACCACTACTCTG F: CCTCTATGGCCCAAACAGAGGAC R: TACCTCTGGTCAAACCTGCCTTT F: ATACAGCAGATGGCAGGCTTGG R: GCCATTGTCATAAGCAGTTGCAG F: ATTGAGGTGTGGAGGAGCATGAC R: TGGGGAGATCTGCACCTATTTGA
The PCR products showed high specificity and efficiency in amplification on the agarose gel electrophoresis, with single band at the correct fragment length, suggesting that there were no large fragment insertion or deletion in 17 exons of the TGFBI gene. With the SSCP-silver staining, the 12th exon showed abnormal electrophoresis band, with two more single-chain bands other than the two normal bands as in control (Fig. 1), suggesting for the heterozygous base change. This was found in 3 cases of keratoconus patients and in 1 case of health control. There were no abnormal bands found for other exons of the TFBI gene in the present experiment. 3.2. DNA sequencing The DNA sequencing results confirmed the changes in the 12 exons in the cases described above. The results showed two types of base mutation, which are both heterozygous, with one non-sense mutation and the other synonymous mutation. In 1 patient the site
Fig. 2. The G535X mutation of the TGFBI gene. The arrow is showing the heterozygous replacement of base G by T at 1603 site of the 12th exon.
T. Guan et al. / Gene 503 (2012) 137–139
Fig. 3. The F540F mutation of the TGFBI gene. The arrow is showing the heterozygous replacement of base T by C at 1620 site of the 12th exon.
535 showed GGA→TGA substitution (Fig. 2), which was the change from glycine to stop codon (G535X) (TGFBI gene site 1603). This was not found in all control cases. In 2 patients and 1 health control case the site 540 showed TTT→TTC substitutions (Fig. 3), without changing of the coding for phenylalanine (F540F) (TGFBI gene site 1620), suggesting for the polymorphisms.
139
without changing of the coding for phenylalanine (F540F) (TGFBI gene site 1620), suggesting for the polymorphisms. This is consistent with the results in the previous study (Udar et al., 2004). In 1 patient the site 535 showed GGA→TGA substitution, which was the change from glycine to stop codon (G535X) (TGFBI gene site 1603). The patient was 17 years old, male, with 10 years history of keratoconus. The slit lamp microscope examination showed the conical protrusion (opacity at the top) of cornea in both eyes, with corneal thinning and vertical line scar, as well as the complete Fleischer ring. We believe that the stop codon caused by G535X disrupt the translation of βigh3 protein, which could contribute to the instability of the cornea of the patient. The etiology of keratoconus is complicated, and genetic bases of the disease just began to be discovered. How the environmental factors contribute to the disease progression and interact with the genetic susceptibility are still to be investigated. The present study firstly showed the potential involvement of TGFBI gene in the keratoconus of the Chinese population. Still, larger-scale studies recruiting more patients are required to further understand the genetic mechanisms underlying the pathogenesis of keratoconus. Conflict of interests
4. Discussion None declared. Keratoconus mainly affects young people, and appears at the age of 20 years old, causing severe loss of the vision (Romero-Jimenez et al., 2010). The etiology of the disease was considered to the abnormal collagen synthesis or degradation caused by numerous factors, including genetic, virus, toxins, metabolic and immune variations (Hu and Wei, 2010; Romero-Jimenez et al., 2010). In recent years, the disease was considered as a disease caused by multiple genetic variations, including those controlling the collagen dynamics during development (Edwards et al., 2001; Grunauer-Kloevekorn and Duncker, 2006; Rabinowitz, 2003; Romero-Jimenez et al., 2010). For instance, there were correlationship studies between keratoconus and collagen type VI α1 chain (COL6A1) gene, homeobox VSX1 gene, as well as TGFBI gene (Heon et al., 2002; Hu and Wei, 2010; Stabuc-Silih et al., 2009; Suesskind et al., 2006). TGFBI gene locates in 5q 31.1, with the size of 37 kb, and contains 17 exons, encoding the secreted βig-h3 protein (683 amino acids, 68 kDa). The protein is the integrating component of the extracellular matrix structure elements, and helps the adhesion as well as migration of corneal fibroblasts. The βig-h3 protein also plays roles in the secretion and regulation of elastic fiber, fibronectin and collagen type II in the corneal stroma. Previous studies showed the decreased amount of TGFBI gene in keratoconus patients in a severity-dependent manner (Rabinowitz et al., 2005; Takacs et al., 1999; Zhao et al., 2002), with diminished expression in well-developed cases. Another study with PCR-DNA direct sequencing including 15 cases of patients reported 8 base variations (4 polymorphic changes) (Udar et al., 2004). However to our knowledge no study yet examined the genetic bases of TGFBI in the Chinese population with keratoconus. The current study examined 17 exons of the TGFBI gene from 30 keratoconus patients and 30 healthy controls with PCR-SSCP technique and the DNA sequencing. With the SSCP-silver staining, the 12th exon in 3 cases of patients and 1 case of health control showed abnormal electrophoresis band, with two more single-chain bands other than the two normal bands as in control, suggesting for the heterozygous base changes. The DNA sequencing results showed two types of base mutation, which are both heterozygous, with one nonsense mutation and the other synonymous mutation. In 2 patients and 1 health control case the site 540 showed TTT→TTC substitutions,
Acknowledgment The work was supported by Department of Health of Zhejiang Province funding (No. 20050A110). References Edwards, M., McGhee, C.N., Dean, S., 2001. The genetics of keratoconus. Clin. Exp. Ophthalmol. 29, 345–351. El Dib, R.P., de Freitas, D., 2008. A systematic review of Ferrara's ring in the treatment of keratoconus. J. Refract. Surg. 24, 865–866. Ertan, A., Colin, J., 2007. Intracorneal rings for keratoconus and keratectasia. J. Cataract. Refract. Surg. 33, 1303–1314. Grunauer-Kloevekorn, C., Duncker, G.I., 2006. Keratoconus: epidemiology, risk factors and diagnosis. Klin. Monbl. Augenheilkd. 223, 493–502. Heon, E., et al., 2002. VSX1: a gene for posterior polymorphous dystrophy and keratoconus. Hum. Mol. Genet. 11, 1029–1036. Hu, F.P., Wei, C.H., 2010. Etiology study of idiopathic keratoconus. Med. Recapitulate 16, 107–110. Jhanji, V., Sharma, N., Vajpayee, R.B., 2011. Management of keratoconus: current scenario. Br. J. Ophthalmol. 95, 1044–1050. Kumar, N.L., Rootman, D.S., 2010. Newer surgical techniques in the management of keratoconus. Int. Ophthalmol. Clin. 50, 77–88. Rabinowitz, Y.S., 1998. Keratoconus. Surv. Ophthalmol. 42, 297–319. Rabinowitz, Y.S., 2003. The genetics of keratoconus. Ophthalmol. Clin. North Am. 16, 607–620 (vii). Rabinowitz, Y.S., Dong, L., Wistow, G., 2005. Gene expression profile studies of human keratoconus cornea for NEIBank: a novel cornea-expressed gene and the absence of transcripts for aquaporin 5. Invest. Ophthalmol. Vis. Sci. 46, 1239–1246. Romero-Jimenez, M., Santodomingo-Rubido, J., Wolffsohn, J.S., 2010. Keratoconus: a review. Cont. Lens Anterior Eye 33, 157–166 (quiz 205). Stabuc-Silih, M., Ravnik-Glavac, M., Glavac, D., Hawlina, M., Strazisar, M., 2009. Polymorphisms in COL4A3 and COL4A4 genes associated with keratoconus. Mol. Vis. 15, 2848–2860. Suesskind, D., Auw-Haedrich, C., Schorderet, D.F., Munier, F.L., Loeffler, K.U., 2006. Keratoepithelin in secondary corneal amyloidosis. Graefes Arch. Clin. Exp. Ophthalmol. 244, 725–731. Takacs, L., Csutak, A., Balazs, E., Modis Jr., L., Berta, A., 1999. Expression of betaig-h3 is lower than normal in keratoconus corneas but increases with scarring. Cornea 18, 599–605. Udar, N., et al., 2004. Keratoconus—no association with the transforming growth factor beta-induced gene in a cohort of American patients. Cornea 23, 13–17. Warren, C., 2008. Understanding keratoconus. Insight 33, 28–29. Zhao, G., et al., 2002. The expression of protein betaig-h3 inducible by transforming growth factor-beta in keratoconus and normal cornea. Zhonghua Yan Ke Za Zhi 38, 419–421.
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Short Communication
The point mutation and polymorphism in keratoconus candidate gene TGFBI in Chinese population Tao Guan a, Chibo Liu b,⁎, Zhangwei Ma a, Shiping Ding a a b
Taizhou Eye Hospital, Taizhou, Zhejiang, 318000, Zhejiang Province, China Department of Laboratory Medicine, Taizhou Municipal Hospital, Taizhou 318000, Zhejiang Province, China
a r t i c l e
i n f o
Article history: Accepted 18 April 2012 Available online 2 May 2012 Keywords: Keratoconus TGFBI gene Point mutation Genetic polymorphism
a b s t r a c t Objective: To understand the region point mutations and single nucleotide polymorphisms characteristic of keratoconus candidate gene in Chinese population, the TGFBI. Methods: Polymerase chain reaction–single strand conformation polymorphism and DNA direct sequencing were performed on blood samples from 30 cases of keratoconus patients and 30 normal controls. 17 exons from the coding region of TGFBI gene were examined for point mutations and single nucleotide polymorphisms. Results: Two types of base mutation were found in exon 12, which were both heterozygous. In 1 patient the site 535 showed GGA→TGA substitution, which was the change from glycine to stop codon (G535X). This was not found in all control cases. In 2 patients and 1 control case the site 540 showed TTT→TTC substitutions without changing of the coding for phenylalanine (F540F), suggesting for the polymorphism. Conclusion: The candidate keratoconus gene TGFB1 showed genetic variation and mutation in keratoconus population. The gene might play a role in the development of keratoconus in Chinese population. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Keratoconus is a congenital disease of non-inflammatory corneal ectasia, with incidence rate of 1/2000, and male/female ratio at 1.7. The disease showed sporadic distribution, with family history in 6% to 10% patients including both autosomal dominant and recessive forms (Rabinowitz, 1998). The pathological feature of keratoconus includes the decreased corneal collagen or abnormal distribution of the collagen fiber, which will reduce the mechanical resistance of the cornea and therefore the protruding forward center of cornea, leading to a thin conical shape (Romero-Jimenez et al., 2010; Warren, 2008). The slit lamp microscope examination of keratoconus patient could demonstrate the Vogt's line, Fleischer's ring and the corneal scar (El Dib and de Freitas, 2008; Ertan and Colin, 2007; Rabinowitz, 1998; Romero-Jimenez et al., 2010). The onset of the disease occurs in the puberty period, involving both eyes, and with highly irregular astigmatism. In late phase the patient will show acute corneal edema and scar formation, significant vision loss, and can only be treated with cornea transplant (Jhanji et al., 2011; Kumar and Rootman, 2010).
Abbreviations: TGFBI, Transforming growth factor β-induced; PCR-SSCP, Polymerase chain reaction-single strand conformation polymorphism; COL6A1, Collagen type VI α1 chain. ⁎ Corresponding author. E-mail address: [email protected] (C. Liu). 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2012.04.061
It has been suggested that keratoconus was relevant to the corneal stroma hypoplasia (Romero-Jimenez et al., 2010). Transforming growth factor β-induced (TGFBI) gene and its translation product (βig-h3 protein) play roles in cell adhesion, movement and interaction with the extracellular matrix during the orderly development of the corneal stroma. Previous studies showed the decreased expression of βig-h3 protein in the matrix layers of cornea and epithelium of keratoconus patients (Takacs et al., 1999), suggesting the potential involvement of TGFBI in keratoconus development. The present study employed polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and direct DNA sequencing techniques to examine point mutations and single nucleotide polymorphisms on 17 exons of the TGFBI gene in a Chinese population of keratoconus patients. 2. Subjects and methods 2.1. Clinical subjects 30 cases of keratoconus patients (12 male and 18 female aged from 9 to 46 years old) were admitted into the hospital from Sep 2006 to Jun 2009. The diagnosis was based on symptoms and slit lamp microscope examinations; the diagnostic features included progressive curvature of the anterior corneal surface steepening, the corresponding region of corneal thinning, Fleischer ring, Vogt's stripes, etc., combined with the corneal surface topography and a thicker caudal surface of cornea than 20 μm. 30 cases of healthy controls (11 male and 19 male aged from 11 to 44 years) were also
138
T. Guan et al. / Gene 503 (2012) 137–139
included. The study was approved by the local Ethics Committee of Taizhou Municipal Hospital, and had the informed written consent of the patients and control subjects. The systemic physical examination was performed to exclude other concurrent diseases, and 3 ml peripheral blood was extracted from the subject and stored in EDTA anticoagulation tubes before the whole genome DNA extraction with conventional phenol–chloroform approach. 2.2. Primer design The primers for 17 exons of human TGFBI gene were designed based on previous studies [4, 5] and the human genome DNA sequence of TGFBI from NCBI database. The primers were synthesized by Shanghai Shenggong biocompany (Shanghai, China), with the sequences as below (Table 1). 2.3. PCR reaction The HBP 220 PCR cycler (HYBAID, England) was used. 50μlPCR reaction system containing DNA template 200 ng, 10× buffer solution 5 μl, 1.5 mmol/L MgCl2, 0.25 μmol/L primer, dNTP each 100 μmol/L, and Taq enzyme (Shanghai Shenggong company) 2U. The procedure was as following: 94 °C for 5 min, then the 35 amplification cycles −94 °C denaturation 45 s, annealing 45 s, 72 °C extension for 50 s, finally the reaction was stopped after 72 °C extension for 10 min. The PCR products were examined with 2% agarose gel electrophoresis and EB staining. 2.4. SSCP-silver staining and DNA sequencing The 8% (49:1) non-denaturing polyacrylamide gel with 5% glycerol was used for SSCP-silver staining. 5 μl PCR products mixed with
Fig. 1. SSCP silver staining: Lane 1 and 5 are from the health control, with lane 2, 3, and 4 from keratoconus patients.
sample buffer (90% formamide, 0.05% bromophenol blue, and 0.05% xylene blue) were processed for denaturation at 95 °C for 10 min, then ice bath before the electrophoresis (100 V) at room temperature for 5 to 6 h (when xylene blue reached the bottom of the gel). Then the gel was fixed in 10% ethanol for 5 min, then 1% silver nitrate for 5 min, before the staining in 0.012 mol/L silver nitrate and 0.05% formaldehyde for 10 min. Then the gel was processed in 0.28 mol/L sodium carbonate, 0.1% formaldehyde, and 0.1 g/L sodium thiosulfate for colorization, which was stopped in 10% acetic acid finally. The gel was examined and abnormal bands were processed for PCR products purification. Then the DNA was sequenced on automated sequencing machines. The sequences were deposited to Genebank (reference number in process). 3. Results 3.1. PCR-SSCP results
Table 1 The primer sequence for 17 exons of TGFBI and PCR amplification conditions. Exon Primer sequence (5′→3′)
Annealing temperature (°C)
Product length (bp)
1
62
277
64
290
63
260
62
252
67
165
56
248
55
238
56
310
62
192
60
222
55
228
56
199
58
195
60
280
57
231
55
246
62
214
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
F: CGGAGGCGCTCTCACTTCC R: CGAGCCCCGACTACCTGACC F: GGGAGTCATTAAAGTGGGGTGGA R: AGCTTGGTCTCCTGGCTGGTTAC F: CAACTTAGTGGAGAGGGGCCAGA R: CTCTCTCCCACCATTCCCTTCC F: GCCATCCCTCCTTCTGTCTTCTG R: CCTCGGGGAAGTAAGGCAGTTC F: ACTGACACCCTGTCCTTCCTCCT R: AGCCCACACATGGAACAGAAATG F:CTGCTCATCCTTGCTGCTTCTCT R: AGAGTTCCTGCTAGGCCCCTCTT F: TCTGTGGGGAGTGCCAGAGTC R: CAAATGAGGCAGCAGCAGGA F: TGGACCCTGACTTGACCTGAGTC R: AAAGGATGGCAGAAGAGATGGTG F: CCCTGGGGTGGATGAATGATAAA R: GCCTCCAGGGACAATCTAACAGG F: ATTGCAGGAGCACATCTCTCTGG R: GCTTCCCAGGAGCATGATTTAGG F: GCCCCTCGTGGAAGTATAACCAG R: ATCCCACTCCAGCATGACCACT F: GGGCCCTGAGGGATCACTACTTT R: TGACAGGTGACATTTTCTGTGTGTG F: CAGCCTTTGATTTGCAGGACACT R: TGACCAGGCTAATTACCATTCTTGG F: CCAACTGCCACATGAAGAAAAGG R: TGCTCTACCTTTCAACCACTACTCTG F: CCTCTATGGCCCAAACAGAGGAC R: TACCTCTGGTCAAACCTGCCTTT F: ATACAGCAGATGGCAGGCTTGG R: GCCATTGTCATAAGCAGTTGCAG F: ATTGAGGTGTGGAGGAGCATGAC R: TGGGGAGATCTGCACCTATTTGA
The PCR products showed high specificity and efficiency in amplification on the agarose gel electrophoresis, with single band at the correct fragment length, suggesting that there were no large fragment insertion or deletion in 17 exons of the TGFBI gene. With the SSCP-silver staining, the 12th exon showed abnormal electrophoresis band, with two more single-chain bands other than the two normal bands as in control (Fig. 1), suggesting for the heterozygous base change. This was found in 3 cases of keratoconus patients and in 1 case of health control. There were no abnormal bands found for other exons of the TFBI gene in the present experiment. 3.2. DNA sequencing The DNA sequencing results confirmed the changes in the 12 exons in the cases described above. The results showed two types of base mutation, which are both heterozygous, with one non-sense mutation and the other synonymous mutation. In 1 patient the site
Fig. 2. The G535X mutation of the TGFBI gene. The arrow is showing the heterozygous replacement of base G by T at 1603 site of the 12th exon.
T. Guan et al. / Gene 503 (2012) 137–139
Fig. 3. The F540F mutation of the TGFBI gene. The arrow is showing the heterozygous replacement of base T by C at 1620 site of the 12th exon.
535 showed GGA→TGA substitution (Fig. 2), which was the change from glycine to stop codon (G535X) (TGFBI gene site 1603). This was not found in all control cases. In 2 patients and 1 health control case the site 540 showed TTT→TTC substitutions (Fig. 3), without changing of the coding for phenylalanine (F540F) (TGFBI gene site 1620), suggesting for the polymorphisms.
139
without changing of the coding for phenylalanine (F540F) (TGFBI gene site 1620), suggesting for the polymorphisms. This is consistent with the results in the previous study (Udar et al., 2004). In 1 patient the site 535 showed GGA→TGA substitution, which was the change from glycine to stop codon (G535X) (TGFBI gene site 1603). The patient was 17 years old, male, with 10 years history of keratoconus. The slit lamp microscope examination showed the conical protrusion (opacity at the top) of cornea in both eyes, with corneal thinning and vertical line scar, as well as the complete Fleischer ring. We believe that the stop codon caused by G535X disrupt the translation of βigh3 protein, which could contribute to the instability of the cornea of the patient. The etiology of keratoconus is complicated, and genetic bases of the disease just began to be discovered. How the environmental factors contribute to the disease progression and interact with the genetic susceptibility are still to be investigated. The present study firstly showed the potential involvement of TGFBI gene in the keratoconus of the Chinese population. Still, larger-scale studies recruiting more patients are required to further understand the genetic mechanisms underlying the pathogenesis of keratoconus. Conflict of interests
4. Discussion None declared. Keratoconus mainly affects young people, and appears at the age of 20 years old, causing severe loss of the vision (Romero-Jimenez et al., 2010). The etiology of the disease was considered to the abnormal collagen synthesis or degradation caused by numerous factors, including genetic, virus, toxins, metabolic and immune variations (Hu and Wei, 2010; Romero-Jimenez et al., 2010). In recent years, the disease was considered as a disease caused by multiple genetic variations, including those controlling the collagen dynamics during development (Edwards et al., 2001; Grunauer-Kloevekorn and Duncker, 2006; Rabinowitz, 2003; Romero-Jimenez et al., 2010). For instance, there were correlationship studies between keratoconus and collagen type VI α1 chain (COL6A1) gene, homeobox VSX1 gene, as well as TGFBI gene (Heon et al., 2002; Hu and Wei, 2010; Stabuc-Silih et al., 2009; Suesskind et al., 2006). TGFBI gene locates in 5q 31.1, with the size of 37 kb, and contains 17 exons, encoding the secreted βig-h3 protein (683 amino acids, 68 kDa). The protein is the integrating component of the extracellular matrix structure elements, and helps the adhesion as well as migration of corneal fibroblasts. The βig-h3 protein also plays roles in the secretion and regulation of elastic fiber, fibronectin and collagen type II in the corneal stroma. Previous studies showed the decreased amount of TGFBI gene in keratoconus patients in a severity-dependent manner (Rabinowitz et al., 2005; Takacs et al., 1999; Zhao et al., 2002), with diminished expression in well-developed cases. Another study with PCR-DNA direct sequencing including 15 cases of patients reported 8 base variations (4 polymorphic changes) (Udar et al., 2004). However to our knowledge no study yet examined the genetic bases of TGFBI in the Chinese population with keratoconus. The current study examined 17 exons of the TGFBI gene from 30 keratoconus patients and 30 healthy controls with PCR-SSCP technique and the DNA sequencing. With the SSCP-silver staining, the 12th exon in 3 cases of patients and 1 case of health control showed abnormal electrophoresis band, with two more single-chain bands other than the two normal bands as in control, suggesting for the heterozygous base changes. The DNA sequencing results showed two types of base mutation, which are both heterozygous, with one nonsense mutation and the other synonymous mutation. In 2 patients and 1 health control case the site 540 showed TTT→TTC substitutions,
Acknowledgment The work was supported by Department of Health of Zhejiang Province funding (No. 20050A110). References Edwards, M., McGhee, C.N., Dean, S., 2001. The genetics of keratoconus. Clin. Exp. Ophthalmol. 29, 345–351. El Dib, R.P., de Freitas, D., 2008. A systematic review of Ferrara's ring in the treatment of keratoconus. J. Refract. Surg. 24, 865–866. Ertan, A., Colin, J., 2007. Intracorneal rings for keratoconus and keratectasia. J. Cataract. Refract. Surg. 33, 1303–1314. Grunauer-Kloevekorn, C., Duncker, G.I., 2006. Keratoconus: epidemiology, risk factors and diagnosis. Klin. Monbl. Augenheilkd. 223, 493–502. Heon, E., et al., 2002. VSX1: a gene for posterior polymorphous dystrophy and keratoconus. Hum. Mol. Genet. 11, 1029–1036. Hu, F.P., Wei, C.H., 2010. Etiology study of idiopathic keratoconus. Med. Recapitulate 16, 107–110. Jhanji, V., Sharma, N., Vajpayee, R.B., 2011. Management of keratoconus: current scenario. Br. J. Ophthalmol. 95, 1044–1050. Kumar, N.L., Rootman, D.S., 2010. Newer surgical techniques in the management of keratoconus. Int. Ophthalmol. Clin. 50, 77–88. Rabinowitz, Y.S., 1998. Keratoconus. Surv. Ophthalmol. 42, 297–319. Rabinowitz, Y.S., 2003. The genetics of keratoconus. Ophthalmol. Clin. North Am. 16, 607–620 (vii). Rabinowitz, Y.S., Dong, L., Wistow, G., 2005. Gene expression profile studies of human keratoconus cornea for NEIBank: a novel cornea-expressed gene and the absence of transcripts for aquaporin 5. Invest. Ophthalmol. Vis. Sci. 46, 1239–1246. Romero-Jimenez, M., Santodomingo-Rubido, J., Wolffsohn, J.S., 2010. Keratoconus: a review. Cont. Lens Anterior Eye 33, 157–166 (quiz 205). Stabuc-Silih, M., Ravnik-Glavac, M., Glavac, D., Hawlina, M., Strazisar, M., 2009. Polymorphisms in COL4A3 and COL4A4 genes associated with keratoconus. Mol. Vis. 15, 2848–2860. Suesskind, D., Auw-Haedrich, C., Schorderet, D.F., Munier, F.L., Loeffler, K.U., 2006. Keratoepithelin in secondary corneal amyloidosis. Graefes Arch. Clin. Exp. Ophthalmol. 244, 725–731. Takacs, L., Csutak, A., Balazs, E., Modis Jr., L., Berta, A., 1999. Expression of betaig-h3 is lower than normal in keratoconus corneas but increases with scarring. Cornea 18, 599–605. Udar, N., et al., 2004. Keratoconus—no association with the transforming growth factor beta-induced gene in a cohort of American patients. Cornea 23, 13–17. Warren, C., 2008. Understanding keratoconus. Insight 33, 28–29. Zhao, G., et al., 2002. The expression of protein betaig-h3 inducible by transforming growth factor-beta in keratoconus and normal cornea. Zhonghua Yan Ke Za Zhi 38, 419–421.