- Email: [email protected]
The porcine mu opioid receptor: molecular cloning and mRNA distribution in lymphoid tissues
Journal of Neuroimmunology 90 Ž1998. 192–198
The porcine mu opioid receptor: molecular cloning and mRNA distribution in lymphoid tissues Mary S. Pampusch ) , Mark A. Osinski 1, David R. Brown, Michael P. Murtaugh Department of Veterinary PathoBiology, UniÕersity of Minnesota, 1971 Commonwealth AÕe, St. Paul, MN 55108, USA Received 3 April 1998; revised 18 May 1998; accepted 19 May 1998
Abstract The porcine m opioid receptor ŽpMOR., was cloned from cerebral cortex RNA using PCR methodologies. Porcine MOR is 96% identical with human MOR in amino acid sequence. An RT-PCR survey for pMOR mRNA indicated that pMOR is widely distributed in the gut, and is present in thymus and Peyer’s patches but absent in other immune tissues and in isolated immune cells. Based on these findings, it appears that opioids do not exert an immunosuppressive effect through direct interaction with the m-opioid receptor on immune cells. In certain tissues, however, opioids may modulate immune function indirectly through neuronal MOR. q 1998 Elsevier Science B.V. All rights reserved. Keywords: Opioid receptor: mu type; Pig; Swine; Immunocyte; Gut
1. Introduction A correlation between the chronic use of opiates and an increased incidence of infectious disease has led to investigations of whether opiates are capable of suppressing immune function either directly or indirectly. A number of in vivo studies, carried out predominantly with rodents, and to a lesser extent, with pigs, humans, and monkeys, indicate that morphine can modulate both nonspecific ŽBryant et al., 1988; Bayer et al., 1990; Sei et al., 1991. and antigen-specific ŽBryant and Roudebush, 1990; Buissiere et al., 1992; Molitor et al., 1992. immune functions. Conversely, in vitro studies have not definitively demonstrated a direct effect of morphine on immune cells.
Abbreviations: ConA, Concanavalin A; HPRT, Hypoxanthine phosphoribosyl transferase; LPS, Lipopolysaccharide; MOR, m opioid receptor; PBMC, Peripheral blood mononuclear cells; PCR, Polymerase chain reaction; RACE-PCR, Rapid amplification of cDNA ends; RT, Reverse transcription; TM, Transmembrane domain ) Corresponding author. Tel.: q1 612 6244926; fax: q1 612 6255203; e-mail: [email protected] 1 Present address: School of Pharmacy, University of Wisconsin, 425 N. Charter St., Madison, WI, 53706, USA.
For example, alterations in oxygen metabolism ŽPeterson et al., 1987a., natural killer ŽNK. cell activity ŽThomas et al., 1995. and changes in the levels of cytokines such as interferon-g ŽPeterson et al., 1987b., tumor necrosis factora ŽChao et al., 1993., and transforming growth factor-beta ŽChao et al., 1992., have been noted in morphine-treated human peripheral blood mononuclear cells ŽPBMC.. In contrast, lymphocyte proliferation ŽBayer et al., 1990; Chuang et al., 1993., NK cell activity ŽBayer et al., 1990. and production of interleukin-2 ŽChuang et al., 1993; Thomas et al., 1995. and interleukin-4 ŽThomas et al., 1995. were not affected by morphine application to murine and simian immune cells. Opioid receptors have been implicated in immunomodulation since many of the reported immunosuppressive effects of morphine are reversed by opioid antagonists such as naloxone and naltrexone. Specific opioid binding sites have been reported on human granulocytes ŽLopker et al., 1980; Makman et al., 1995., monocytes ŽLopker et al., 1980., and activated lymphocytes ŽMadden et al., 1993.. These observations suggest that immune cells may respond directly to opioids via cell surface receptors. To address this issue, we cloned the porcine m opioid receptor and determined its distribution in porcine immune cells and tissues. We report here that pMOR is encoded by a single gene which is expressed in lymphoid tissues but not in isolated immune cells.
0165-5728r98r$ - see front matter q 1998 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 5 - 5 7 2 8 Ž 9 8 . 0 0 1 4 2 - 8
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
2. Materials and methods 2.1. Cloning procedures Total RNA, isolated from porcine cerebral cortex by acid guanidine phenol extraction ŽChomczynski and Sacchi, 1987., was used in 5X RACE PCR according to the method of Frohman Ž1993. except for the use of 50 mM dNTPs, 1.5 mM MgCl 2 , 0.025 Urml Taq polymerase, and 5% DMSO. 3X RACE PCR was carried out with oligo dT-selected porcine cerebral cortex RNA and the Marathon cDNA amplification kit ŽClontech, Palo Alto, CA.. Primer sequences are indicated in Table 1. The complete open reading frame of MOR was amplified from cerebral cortex cDNA by standard PCR methodology. Both strands were sequenced by fluorescent automated sequencing ŽABI Prizm model 377, Applied Biosystems, Foster City, CA.. 2.2. Isolation of cells PBMC and neutrophils were isolated from whole blood using Lymphocyte Separation Media ŽOrganon Teknika, Durham, NC.. Dextran sedimentation was used to separate neutrophils from erythrocytes ŽMetcalfe, 1996.. Thymo-
193
cytes were obtained following mechanical disruption of the thymus. Alveolar macrophages were isolated by lung lavage ŽBaarsch et al., 1991.. Lamina propria and Peyer’s patch cells were isolated from jejunum and ileum according to the method of Bailey et al. Ž1994.. The cells were either used immediately for RNA isolation or cultured in RPMI 1640 containing 2% swine serum, 2 mM glutamine, MEM nonessential amino acids, 0.05 mM mercaptoethanol, and penicillinrstreptomycin. In cell stimulation studies, alveolar macrophages were treated with 1 mgrml LPS, PBMC and thymocytes with 5 mgrml Con A, and lamina propria and Peyer’s patch cells with both 1 mgrml LPS and 5 mgrml Con A for 18–24 h prior to RNA isolation. 2.3. cDNA synthesis, and PCR amplification cDNA was synthesized from 2 mg total RNA with random hexamers and MuLV reverse transcriptase ŽPerkin Elmer, Foster City, CA.. The cDNA was subjected to 30 cycles of amplification using 1.5 mM MgCl 2 and primers F1 and R1 ŽTable 1.; each cycle consisted of 558C for 30 s, 728C for 45 s, and 938C for 45 s. Products were diluted 100-fold and an additional 30 rounds of amplification were
Table 1 Sequences of primers and probe used in MOR cloning and analysisa Sequence
Locationb Žbp.
AAGAGACCCACCACGCACA GATGGAGTAGAGGGCCATGA CGATCATGGAAGGACTGCCGGT
496–478 476–457 440–423
3 RACE primers Round 1 Round 2
TTGCCTTCATCATGCCTGTCCTCATC TGTCCTGGCACTTCTGCATTGCTC
961–986 1192–1215
RT-PCR primers F1 R1 F2 R2
TCAATGTGCTCCCCAGTACC CTTTGTTGTTGCCATGAACATC TCACCATCATGGCCCTCTAC CAGACCAATGGCTGAAGAGAG
297–316 872–851 451–470 845–825
MOR ORF primers Forward Reverse
GCAACAAGCAGAAGATAATGTCAG AGTGCCTCCCACACATTCTC
34–57 1532–1513
MOR 980 primers Forward Reverse MOR oligo probe
TCAATGTGCTCCCCAGTACC GCATCGTTTGAAGTTTTCATCC CAGAGTGTCAATTACCTAATGGGAACGTGGCCGTTT
297–316 1283–1262 614–649
HPRT Forward Reverse
TGAACGTCTTGCTCGAGATG TCAAATCCAACAAAAGTCTGGC
1–20 407–386
b Actin Forward Reverse
ATGTTTGAGACCTTCAACAC TGATCCACATCTGCTGGAAGG
1–20 706–686
X
5 RACE primers Round 1 Round 2 Round 3 X
a
X
X
All sequences are presented in the 5 to 3 orientation. Location on GenBank sequences L38645 ŽpMOR., U32316 ŽHPRT., and U07786 Žb actin..
b
194
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
carried out using nested primers F2 and R2 ŽTable 1.. MOR PCR products were sequenced to verify their identity. Hypoxanthine phosphoribosyl transferase ŽHPRT. or b actin were amplified using the same conditions and the primers shown in Table 1. PCR products were analyzed on 1.5% agarose gels stained with ethidium bromide. 2.4. Electrophoresis and southern blotting Genomic DNA Ž15 mg. was digested with BamHI, EcoRI, or BbsI and electrophoresed on a 0.7% agarose gel. DNA was transferred overnight to a positively charged nylon membrane ŽBoehringer Mannheim, Indianapolis, IN. in 20 = SSC. Membranes were hybridized overnight with a 980 bp probe generated by incorporation of digoxygenin11-dUTP during PCR amplification of porcine cerebral cortex cDNA Žprimers indicated in Table 1.. The membranes were washed twice in 0.1 = SSC, 0.1% SDS at 688C for 15 min. Labeled DNA was visualized by chemiluminescent detection using the Genius system ŽBoehringer Mannheim, Indianapolis, IN.. PCR products were transferred to a MagnaGraph nylon membrane ŽMSI, Westboro, MA. by rapid alkaline transfer. Membranes were hybridized with a 30 bp digoxygenin-labelled porcine MOR oligonucleotide ŽTable 1. and washed twice in 0.5 = SSC, 0.1% SDS at 428C for 15 min. Labeled products were visualized by chemiluminescent detection using the Genius system ŽBoehringer Mannheim, Indianapolis, IN..
3. Results 3.1. Analysis of porcine MOR sequence We cloned 1881 bp of porcine m opioid receptor mRNA ŽGenBank accession number L38645. consisting of a 1203 bp open reading frame, a 236 bp 5X untranslated region, and a 441 bp 3X untranslated region. Analysis of the porcine m opioid receptor sequence revealed an open reading frame of 401 amino acids with 96% amino acid identity to human MOR and 92% identity to rat MOR. The transmembrane regions are completely conserved between the pig and other species; virtually all differences in amino acid sequence lie within the putative N-terminus of the receptor. All putative glycosylation sites and disulfide bonds identified in human MOR are retained in pMOR. Southern blotting of genomic DNA produced a pattern of hybridizing bands consistent with the presence of a single gene. The 980 bp cDNA fragment is contained on two BbsI fragments, a result which is in agreement with the presence of an internal restriction site in pMOR ŽFig. 1.. The hybridization pattern of three bands with BamHI digestion and two bands with EcoRI digestion, for which there are respectively one and zero internal restriction
Fig. 1. Southern blot of pMOR. Porcine genomic DNA Ž15 mgrsample. was digested with the indicated enzymes and blotted with a digoxygeninlabeled 980 bp MOR cDNA.
sites, suggests the presence of an intron within the probe sequence ŽFig. 1.; this finding is consistent with the genomic structure of rat and mouse MOR ŽThompson et al., 1993; Kaufman et al., 1995.. The Southern blotting results were specific for MOR since hybridization of the membrane with a nociceptin ŽORL-1. receptor cDNA resulted in a different banding pattern Ždata not shown.. 3.2. Distribution of MOR mRNA in gut and immune tissues Nested RT-PCR was used to assess the presence of MOR message in lymphoid tissues and isolated immune cells. PCR products spanned a region encoding TM I to TM IV. Since the products included an intron, PCR products derived from genomic DNA were clearly differentiated from those derived from cDNA based on size differences. High levels of MOR mRNA were observed in porcine brain tissues as evidenced by their detection with one round of PCR. With a second round of amplification, MOR mRNA was also detected in the thymus, and ileal and jejunal Peyer’s patches ŽFig. 2a.. The identity of the PCR products was verified as MOR by Southern blotting ŽFig. 2b.. MOR mRNA was not detected in spleen and
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
lymph nodes by ethidium bromide staining ŽFig. 2a. or Southern blotting ŽFig. 2b.. HPRT message was detected in all samples indicating the presence of amplifiable RNA ŽFig. 2a.. MOR was widely distributed in the gut. RNA from full thickness samples throughout the gastrointestinal tract consistently tested positive for MOR by RT-PCR ŽTable 2, Fig. 2.. In dissected ileum, MOR mRNA was found in preparations of the mucosa–submucosa and the muscularis propria–myenteric plexus but not in isolated epithelium ŽTable 2.. 3.3. Distribution of MOR mRNA in isolated immune cells PBMC, thymocytes, alveolar macrophages, neutrophils, jejunal lamina propria cells, and ileal and jejunal Peyer’s patch cells were isolated from 2 to 5 animals. Following RNA isolation and nested RT-PCR, no products of the expected size were detected by ethidium bromide staining ŽFig. 2a. or Southern blotting ŽFig. 2b.. HPRT or b actin were consistently detected in all samples. To address the possibility that opioid receptor expression may be induced on immune cells following cellular stimulation, alveolar macrophages, PBMC, thymocytes, lamina propria and Peyer’s patch cells were stimulated with ConA andror LPS for 18–24 h as described in Section 2. Cell viability and stimulation were verified by monitoring induction of interleukin-12 ŽIL-12. mRNA in
195
Table 2 Distribution of MOR in porcine gut and lymphoid tissues Tissue
No. positive resultsr No. of animals tested
Spleen Thymus Inguinal lymph node Mesenteric lymph node Esophagus Stomach Duodenum Jejunum Ileum Colon Ileal epithelium Ileal mucosa Ileal Peyer’s patch Jejunal Peyer’s patch Muscularis propria– Myenteric plexus Cortex Cerebellum
0r3 2r3 0r3 0r3 2r2 2r2 2r2 2r2 2r3 2r2 0r3 3r3 5r5 2r2 2r2 4r4 2r2
Nested RT-PCR was carried out on RNA samples from porcine tissues as described in Section 2. A positive result indicates that a product was detected by ethidium bromide staining after two rounds of 30 cycles of amplification.
macrophages, lamina propria and Peyer’s patch cells, and interleukin-10 ŽIL-10. mRNA in PBMC and thymocytes. MOR mRNA was not detected in unstimulated or stimu-
Fig. 2. Ža. Representative ethidium bromide stained gel of second round MOR and HPRT RT-PCR products amplified from porcine tissue and cell total RNA. Žb. Representative Southern blot of second round MOR RT-PCR products hybridized with a MOR oligo probe. The lower band represents second round MOR PCR product while the upper band corresponds in size to residual or newly amplified first round product.
196
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
Fig. 3. Representative ethidium bromide stained gels of MOR, b-actin, HPRT, IL-10 or IL-12 RT-PCR products amplified from cultured cell total RNA. AbbreÕiations: A.M., alveolar macrophages; L.P., lamina propria cells; I1 P.P., ileal Peyer’s patch cells; J.P.P., jejunal Peyer’s Patch cells; Thy, thymocytes; PBMC, peripheral blood mononuclear cells; Žy., untreated cells; Žq., cells stimulated with LPS andror ConA as indicated in Section 2.
lated macrophages, thymocytes, PBMC, lamina propria or Peyer’s patch cells ŽFig. 3. whereas IL-10 or IL-12 were consistently detected in stimulated cells ŽFig. 3.. HPRT or b actin mRNA were detected in all samples indicating the presence of amplifiable RNA ŽFig. 3..
4. Discussion Porcine MOR exhibits high sequence homology with m opioid receptors cloned from human and rodent brain. The majority of the amino acid differences lie at the N and C termini. Amino acid changes in these regions may not significantly alter the binding affinity of the porcine receptor as compared to human MOR since the termini have been shown, using an N- and C-deleted mutant receptor, to be nonessential for agonistrantagonist binding ŽSurratt et al., 1994.. The transmembrane amino acids predicted to be important in agonist and antagonist binding are completely conserved in the porcine sequence as are the first and third extracellular loops thought to be important in m opioid selectivity ŽSurratt et al., 1994; Wang et al., 1995; Xue et al., 1995.. One potential change between the porcine and human or rat sequences is the presence of a putative glycosylation site on extracellular loop 2. The functional significance of glycosylation at this site is unknown. Southern blotting suggests that pMOR is present in the porcine genome as a single gene likely to contain introns. These results are in agreement with those of Hu et al. Ž1997. who localized pMOR to a single gene on chromosome 1p.
MOR distribution has been well characterized in the CNS but limited studies have examined the peripheral distribution of the receptor. Wittert et al. Ž1996. examined MOR distribution in rat tissues and, in agreement with our findings, found it in the small intestine, cortex, and cerebellum but, in contrast, also found it in the spleen. This discrepancy could be due to species and strain variability in distribution of opioid receptor mRNA ŽGrimm et al., 1994.. Although radioligand binding studies have suggested the presence of specific m-opioid receptor binding sites on isolated immune cells, ŽLopker et al., 1980; Madden et al., 1993; Makman et al., 1995. there is also evidence that points toward an indirect effect of m opioids on immunity. In the present study, we demonstrated that porcine PBMC, alveolar macrophages, neutrophils, thymocytes, lamina propria cells, and Peyer’s patch cells do not contain MOR mRNA either immediately after isolation or after 18-24 of stimulation in culture. These results suggest that the cells are unlikely to express the m receptor. Our findings are in agreement with Gaveriaux-Ruff et al. Ž1994. and Wick et al. Ž1996. who failed to detect MOR mRNA in human lymphocytes and lymphoid cell lines. Our results differ from the findings of Sedqi et al. Ž1995., who, through RT-PCR and fluorescence activated cell sorting, reported the presence of MOR in rat peritoneal macrophages, and Chuang et al. Ž1995. who reported receptor message in human T cells and simian PBMC and PMN by RT-PCR. These discrepancies might be due to differences in species or cell source, or to neuronal contamination of immunocyte preparations. Contamination of RNA preparations with
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
residual genomic DNA could have also led to false positives when primers were chosen within the same exon ŽChuang et al., 1995. Based on our RNA analysis, MOR does not appear to be present on porcine immune cells. Opioids could, however, activate MOR on peripheral neurons innervating primary and secondary lymphoid tissues and thereby modulate immune function in an indirect manner. pMOR mRNA was detected in thymus but not in isolated thymocytes, in Peyer’s patches but not in isolated Peyer’s patch cells, and in jejunum but not in jejunal lamina propria cells. Based on these observations, it appears that the receptor message is localized to the neural elements within these tissues rather than on the immune cells themselves. Moreover, morphine may affect immunity by influencing central sympathetic outflow ŽShavit et al., 1986; Weber and Pert, 1989., by acting through the hypothalamic-pituitary-adrenal axis ŽBryant et al., 1988., or through a glucocorticoid-independent mechanism such as the autonomic nervous system ŽFlores et al., 1994.. Since some immune tissues do not appear to express MOR, they may be regulated by morphine and other opioids through the HPA axis; whereas, other immune tissues, including the thymus and Peyer’s patches, may be functionally modified in an indirect manner through m opioid receptors on nonlymphoid cells.
Acknowledgements This research was supported by NIDA grants DA-10200 and DA-08010 awarded to DRB and MPM, respectively. MSP was supported by the Training in Psychoneuroimmunology and Substance Abuse grant DA-07239 and MAO was supported by the Neuroscience Training in Drug Abuse Research grant DA-07234. The authors gratefully acknowledge Michael Zilliox for technical assistance and Christopher Nelsen for assistance with computer analysis.
References Baarsch, M.J., Wannemuehler, M.J., Molitor, T.W., Murtaugh, M.P., 1991. Detection of tumor necrosis factor a from porcine alveolar macrophages using an L929 fibroblast assay. J. Immunol. Methods 140, 15–22. Bailey, M., Hall, L., Bland, P.W., Stokes, C.R., 1994. Production of cytokines by lymphocytes from spleen, mesenteric lymph node and intestinal lamina propria of pigs. Immunology 82, 577–583. Bayer, B.M., Daussin, S., Hernandez, M., Irvin, L., 1990. Morphine inhibition of lymphocyte activity is mediated by an opioid dependent mechanism. Neuropharmacology 29, 369–374. Bryant, H.U., Bernton, E.W., Holaday, J.W., 1988. Morphine pellet-induced immunomodulation in mice: temporal relationships. J. Pharmacol. Exp. Ther. 245, 913–920. Bryant, H.U., Roudebush, R.E., 1990. Suppressive effects of morphine pellet implants on in vivo parameters of immune function. J. Pharmacol. Exp. Ther. 255, 410–414.
197
Buissiere, J.L., Alder, M.W., Rogers, T.J., Eisenstein, T.K., 1992. Differential effects of morphine and naltrexone on the antibody response in various mouse strains. Immunopharmacol. Immunotoxicol. 14, 657– 673. Chao, C.C., Hu, S., Molitor, T.W., Zhou, Y., Murtaugh, M.P., Tsang, M., Peterson, P.K., 1992. Morphine potentiates transforming growth factor-b release from human peripheral blood mononuclear cell cultures. J. Pharmacol. Exp. Ther. 262, 19–24. Chao, C.C., Molitor, T.W., Close, K., Hu, S., Peterson, P.K., 1993. Morphine inhibits the release of tumor necrosis factor in human peripheral blood mononuclear cell cultures. Int. J. Immunopharmacol. 15, 447–453. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Chuang, L.F., Killam, K.F., Chuang, R.Y., 1993. Opioid dependency and T-helper cell functions in rhesus monkey. In vivo 7, 159–166. Chuang, T.K., Killam, K.F. Jr., Chuang, L.F., Kung, H.-F., Sheng, W.S., Chao, C.C., Yu, L., Chuang, R.Y., 1995. Mu opioid receptor gene expression in immune cells. Biochem. Biophys. Res. Commun. 216, 922–930. Flores, L.R., Hernandez, M.C., Bayer, B.M., 1994. Acute immuno-suppressive effects of morphine: lack of involvement of pituitary and adrenal factors. J. Pharmacol. Exp. Ther. 268, 1129–1134. Frohman, M.A., 1993. Rapid amplification of complementary DNA ends for generation of full-length complementary DNAs: thermal RACE. Meth. Enzymol. 218, 340–356. Gaveriaux-Ruff, C., Simonin, F., Peluso, J., Befort, K., Kieffer, B., 1994. Expression of opioid receptor mRNAs in immune cells. Reg. Pept. 54, 103–104. Grimm, L.J., Clock, B.J., Cox, B.M., 1994. Comparison of the distribution of mu and delta opiate receptor mRNA in rat and mouse brain by in situ hybridization. Reg. Pept. 54, 111–112. Hu, Z., Rohrer, G.A., Stone, R.T., Rutherford, M., Osinski, M.A., Pampusch, M.S., Murtaugh, M., Brown, D.R., Beattie, C.W., 1997. Linkage assignment of eleven genes to the porcine genome. Mamm. Genome 8, 559–563. Kaufman, D.L., Keith, D.D. Jr., Anton, B., Tian, J., Magendzo, K., Newman, D., Tran, T.H., Lee, D.S., Wen, C., Xia, Y.-R., Lusis, A.J., Evans, C.J., 1995. Characterization of the murine m opioid receptor gene. J. Biol. Chem. 270, 15877–15883. Lopker, A., Abood, L.G., Hoss, W., Lionetti, F.J., 1980. Stereoselective muscarinic acetylcholine and opiate receptors in human phagocytic leukocytes. Biochem. Pharmacol. 29, 1361–1365. Madden, J.J., Ketelsen, D., Whaley, W.L., 1993. Morphine binding sites on human T lymphocytes. Adv. Exp. Med. Biol. 335, 61–66. Makman, M.H., Bilfinger, T.V., Stefano, G.B., 1995. Human granulocytes contain an opiate alkaloid-selective receptor mediating inhibition of cytokine-induced activation and chemotaxis. J. Immunol. 154, 1323–1330. Metcalfe, D.D., 1996. Preparation and functional analysis of other lymphoid and nonlymphoid cells. In: Coligan, J.E., Kruisbeek, A.M., Margulies, D.H., Shevach, E.M., Strober, W. ŽEds.., Current Protocols in Immunology, Vol. 2. Greene Pub. Associates and Wiley-Interscience, New York, pp. 7.23.2–7.23.4. Molitor, T.W., Morilla, A., Risdahl, J.M., Murtaugh, M.P., Chao, C.C., Peterson, P.K., 1992. Chronic morphine administration impairs cellmediated immune responses in swine. J. Pharmacol. Exp. Ther. 260, 581–586. Peterson, P.K., Sharp, B., Gekker, G., Brummitt, C., Keane, W.F., 1987a. Opioid-mediated suppression of cultured peripheral blood mononuclear cell respiratory burst activity. J. Immunol. 138, 3907–3912. Peterson, P.K., Sharp, B., Gekker, G., Brummitt, C., Keane, W.F., 1987b. Opioid-mediated suppression of interferon-g production by cultured peripheral blood mononuclear cells. J. Clin. Invest. 80, 824–831. Sedqi, M., Roy, S., Ramakrishnan, S., Elde, R., Loh, H.H., 1995.
198
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
Complementary DNA cloning of a m-opioid receptor from rat peritoneal macrophages. Biochem. Biophys. Res. Commun. 209, 563–574. Sei, Y., Yoshimoto, K., McIntyre, T., Skolnick, P., Arora, P.K., 1991. Morphine-induced thymic hypoplasia is glucocorticoid-dependent. J. Immunol. 146, 194–198. Shavit, Y., Depaulis, A., Martin, F.C., Terman, G.W., Pechnick, R.N., Zane, C.J., Gale, R.P., Liebeskind, J.L., 1986. Involvement of brain opiate receptors in the immune-suppressive effect of morphine. Proc. Natl. Acad. Sci. USA 83, 7114–7117. Surratt, C.K., Johnson, P.S., Moriwaki, A., Seidleck, B.K., Blaschak, C.J., Wang, J.B., Uhl, G.R., 1994. m-opiate receptor. J. Biol. Chem. 269, 20548–20553. Thomas, P.T., Bhargava, H.N., House, R.V., 1995. Immunomodulatory effects of in vitro exposure to morphine and its metabolites. Pharmacology 50, 51–62. Thompson, R.C., Mansour, A., Akil, H., Watson, S.J., 1993. Cloning and pharmacological characterization of a rat m-opioid receptor. Neuron 11, 903–913.
Wang, W.W., Shahrestanifar, M., Jin, J., Howells, R.D., 1995. Studies on m and d opioid receptor selectivity utilizing chimeric and site-mutagenized receptors. Proc. Natl. Acad. Sci., U.S.A. 92, 12436–12440. Weber, R.J., Pert, A., 1989. The periaqueductal gray matter mediates opiate-induced immunosuppression. Science 245, 188–190. Wick, M.J., Minnerath, S.R., Roy, S., Ramakrishnan, S., Loh, H.H., 1996. Differential expression of opioid receptor genes in human lymphoid cell lines and peripheral blood lymphocytes. J. Neuroimmunol. 64, 29–36. Wittert, G., Hope, P., Pyle, D., 1996. Tissue distribution of opioid receptor gene expression in the rat. Biochem. Biophys. Res. Comm. 218, 877–881. Xue, J.-C., Chen, C., Zhu, J., Kunapuli, S.P., de Riel, J.K., Yu, L., Liu-Chen, L.-Y., 1995. The third extracellular loop of the m opioid receptor is important for agonist selectivity. J. Biol. Chem. 270, 12977–12979.
The porcine mu opioid receptor: molecular cloning and mRNA distribution in lymphoid tissues Mary S. Pampusch ) , Mark A. Osinski 1, David R. Brown, Michael P. Murtaugh Department of Veterinary PathoBiology, UniÕersity of Minnesota, 1971 Commonwealth AÕe, St. Paul, MN 55108, USA Received 3 April 1998; revised 18 May 1998; accepted 19 May 1998
Abstract The porcine m opioid receptor ŽpMOR., was cloned from cerebral cortex RNA using PCR methodologies. Porcine MOR is 96% identical with human MOR in amino acid sequence. An RT-PCR survey for pMOR mRNA indicated that pMOR is widely distributed in the gut, and is present in thymus and Peyer’s patches but absent in other immune tissues and in isolated immune cells. Based on these findings, it appears that opioids do not exert an immunosuppressive effect through direct interaction with the m-opioid receptor on immune cells. In certain tissues, however, opioids may modulate immune function indirectly through neuronal MOR. q 1998 Elsevier Science B.V. All rights reserved. Keywords: Opioid receptor: mu type; Pig; Swine; Immunocyte; Gut
1. Introduction A correlation between the chronic use of opiates and an increased incidence of infectious disease has led to investigations of whether opiates are capable of suppressing immune function either directly or indirectly. A number of in vivo studies, carried out predominantly with rodents, and to a lesser extent, with pigs, humans, and monkeys, indicate that morphine can modulate both nonspecific ŽBryant et al., 1988; Bayer et al., 1990; Sei et al., 1991. and antigen-specific ŽBryant and Roudebush, 1990; Buissiere et al., 1992; Molitor et al., 1992. immune functions. Conversely, in vitro studies have not definitively demonstrated a direct effect of morphine on immune cells.
Abbreviations: ConA, Concanavalin A; HPRT, Hypoxanthine phosphoribosyl transferase; LPS, Lipopolysaccharide; MOR, m opioid receptor; PBMC, Peripheral blood mononuclear cells; PCR, Polymerase chain reaction; RACE-PCR, Rapid amplification of cDNA ends; RT, Reverse transcription; TM, Transmembrane domain ) Corresponding author. Tel.: q1 612 6244926; fax: q1 612 6255203; e-mail: [email protected] 1 Present address: School of Pharmacy, University of Wisconsin, 425 N. Charter St., Madison, WI, 53706, USA.
For example, alterations in oxygen metabolism ŽPeterson et al., 1987a., natural killer ŽNK. cell activity ŽThomas et al., 1995. and changes in the levels of cytokines such as interferon-g ŽPeterson et al., 1987b., tumor necrosis factora ŽChao et al., 1993., and transforming growth factor-beta ŽChao et al., 1992., have been noted in morphine-treated human peripheral blood mononuclear cells ŽPBMC.. In contrast, lymphocyte proliferation ŽBayer et al., 1990; Chuang et al., 1993., NK cell activity ŽBayer et al., 1990. and production of interleukin-2 ŽChuang et al., 1993; Thomas et al., 1995. and interleukin-4 ŽThomas et al., 1995. were not affected by morphine application to murine and simian immune cells. Opioid receptors have been implicated in immunomodulation since many of the reported immunosuppressive effects of morphine are reversed by opioid antagonists such as naloxone and naltrexone. Specific opioid binding sites have been reported on human granulocytes ŽLopker et al., 1980; Makman et al., 1995., monocytes ŽLopker et al., 1980., and activated lymphocytes ŽMadden et al., 1993.. These observations suggest that immune cells may respond directly to opioids via cell surface receptors. To address this issue, we cloned the porcine m opioid receptor and determined its distribution in porcine immune cells and tissues. We report here that pMOR is encoded by a single gene which is expressed in lymphoid tissues but not in isolated immune cells.
0165-5728r98r$ - see front matter q 1998 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 5 - 5 7 2 8 Ž 9 8 . 0 0 1 4 2 - 8
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
2. Materials and methods 2.1. Cloning procedures Total RNA, isolated from porcine cerebral cortex by acid guanidine phenol extraction ŽChomczynski and Sacchi, 1987., was used in 5X RACE PCR according to the method of Frohman Ž1993. except for the use of 50 mM dNTPs, 1.5 mM MgCl 2 , 0.025 Urml Taq polymerase, and 5% DMSO. 3X RACE PCR was carried out with oligo dT-selected porcine cerebral cortex RNA and the Marathon cDNA amplification kit ŽClontech, Palo Alto, CA.. Primer sequences are indicated in Table 1. The complete open reading frame of MOR was amplified from cerebral cortex cDNA by standard PCR methodology. Both strands were sequenced by fluorescent automated sequencing ŽABI Prizm model 377, Applied Biosystems, Foster City, CA.. 2.2. Isolation of cells PBMC and neutrophils were isolated from whole blood using Lymphocyte Separation Media ŽOrganon Teknika, Durham, NC.. Dextran sedimentation was used to separate neutrophils from erythrocytes ŽMetcalfe, 1996.. Thymo-
193
cytes were obtained following mechanical disruption of the thymus. Alveolar macrophages were isolated by lung lavage ŽBaarsch et al., 1991.. Lamina propria and Peyer’s patch cells were isolated from jejunum and ileum according to the method of Bailey et al. Ž1994.. The cells were either used immediately for RNA isolation or cultured in RPMI 1640 containing 2% swine serum, 2 mM glutamine, MEM nonessential amino acids, 0.05 mM mercaptoethanol, and penicillinrstreptomycin. In cell stimulation studies, alveolar macrophages were treated with 1 mgrml LPS, PBMC and thymocytes with 5 mgrml Con A, and lamina propria and Peyer’s patch cells with both 1 mgrml LPS and 5 mgrml Con A for 18–24 h prior to RNA isolation. 2.3. cDNA synthesis, and PCR amplification cDNA was synthesized from 2 mg total RNA with random hexamers and MuLV reverse transcriptase ŽPerkin Elmer, Foster City, CA.. The cDNA was subjected to 30 cycles of amplification using 1.5 mM MgCl 2 and primers F1 and R1 ŽTable 1.; each cycle consisted of 558C for 30 s, 728C for 45 s, and 938C for 45 s. Products were diluted 100-fold and an additional 30 rounds of amplification were
Table 1 Sequences of primers and probe used in MOR cloning and analysisa Sequence
Locationb Žbp.
AAGAGACCCACCACGCACA GATGGAGTAGAGGGCCATGA CGATCATGGAAGGACTGCCGGT
496–478 476–457 440–423
3 RACE primers Round 1 Round 2
TTGCCTTCATCATGCCTGTCCTCATC TGTCCTGGCACTTCTGCATTGCTC
961–986 1192–1215
RT-PCR primers F1 R1 F2 R2
TCAATGTGCTCCCCAGTACC CTTTGTTGTTGCCATGAACATC TCACCATCATGGCCCTCTAC CAGACCAATGGCTGAAGAGAG
297–316 872–851 451–470 845–825
MOR ORF primers Forward Reverse
GCAACAAGCAGAAGATAATGTCAG AGTGCCTCCCACACATTCTC
34–57 1532–1513
MOR 980 primers Forward Reverse MOR oligo probe
TCAATGTGCTCCCCAGTACC GCATCGTTTGAAGTTTTCATCC CAGAGTGTCAATTACCTAATGGGAACGTGGCCGTTT
297–316 1283–1262 614–649
HPRT Forward Reverse
TGAACGTCTTGCTCGAGATG TCAAATCCAACAAAAGTCTGGC
1–20 407–386
b Actin Forward Reverse
ATGTTTGAGACCTTCAACAC TGATCCACATCTGCTGGAAGG
1–20 706–686
X
5 RACE primers Round 1 Round 2 Round 3 X
a
X
X
All sequences are presented in the 5 to 3 orientation. Location on GenBank sequences L38645 ŽpMOR., U32316 ŽHPRT., and U07786 Žb actin..
b
194
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
carried out using nested primers F2 and R2 ŽTable 1.. MOR PCR products were sequenced to verify their identity. Hypoxanthine phosphoribosyl transferase ŽHPRT. or b actin were amplified using the same conditions and the primers shown in Table 1. PCR products were analyzed on 1.5% agarose gels stained with ethidium bromide. 2.4. Electrophoresis and southern blotting Genomic DNA Ž15 mg. was digested with BamHI, EcoRI, or BbsI and electrophoresed on a 0.7% agarose gel. DNA was transferred overnight to a positively charged nylon membrane ŽBoehringer Mannheim, Indianapolis, IN. in 20 = SSC. Membranes were hybridized overnight with a 980 bp probe generated by incorporation of digoxygenin11-dUTP during PCR amplification of porcine cerebral cortex cDNA Žprimers indicated in Table 1.. The membranes were washed twice in 0.1 = SSC, 0.1% SDS at 688C for 15 min. Labeled DNA was visualized by chemiluminescent detection using the Genius system ŽBoehringer Mannheim, Indianapolis, IN.. PCR products were transferred to a MagnaGraph nylon membrane ŽMSI, Westboro, MA. by rapid alkaline transfer. Membranes were hybridized with a 30 bp digoxygenin-labelled porcine MOR oligonucleotide ŽTable 1. and washed twice in 0.5 = SSC, 0.1% SDS at 428C for 15 min. Labeled products were visualized by chemiluminescent detection using the Genius system ŽBoehringer Mannheim, Indianapolis, IN..
3. Results 3.1. Analysis of porcine MOR sequence We cloned 1881 bp of porcine m opioid receptor mRNA ŽGenBank accession number L38645. consisting of a 1203 bp open reading frame, a 236 bp 5X untranslated region, and a 441 bp 3X untranslated region. Analysis of the porcine m opioid receptor sequence revealed an open reading frame of 401 amino acids with 96% amino acid identity to human MOR and 92% identity to rat MOR. The transmembrane regions are completely conserved between the pig and other species; virtually all differences in amino acid sequence lie within the putative N-terminus of the receptor. All putative glycosylation sites and disulfide bonds identified in human MOR are retained in pMOR. Southern blotting of genomic DNA produced a pattern of hybridizing bands consistent with the presence of a single gene. The 980 bp cDNA fragment is contained on two BbsI fragments, a result which is in agreement with the presence of an internal restriction site in pMOR ŽFig. 1.. The hybridization pattern of three bands with BamHI digestion and two bands with EcoRI digestion, for which there are respectively one and zero internal restriction
Fig. 1. Southern blot of pMOR. Porcine genomic DNA Ž15 mgrsample. was digested with the indicated enzymes and blotted with a digoxygeninlabeled 980 bp MOR cDNA.
sites, suggests the presence of an intron within the probe sequence ŽFig. 1.; this finding is consistent with the genomic structure of rat and mouse MOR ŽThompson et al., 1993; Kaufman et al., 1995.. The Southern blotting results were specific for MOR since hybridization of the membrane with a nociceptin ŽORL-1. receptor cDNA resulted in a different banding pattern Ždata not shown.. 3.2. Distribution of MOR mRNA in gut and immune tissues Nested RT-PCR was used to assess the presence of MOR message in lymphoid tissues and isolated immune cells. PCR products spanned a region encoding TM I to TM IV. Since the products included an intron, PCR products derived from genomic DNA were clearly differentiated from those derived from cDNA based on size differences. High levels of MOR mRNA were observed in porcine brain tissues as evidenced by their detection with one round of PCR. With a second round of amplification, MOR mRNA was also detected in the thymus, and ileal and jejunal Peyer’s patches ŽFig. 2a.. The identity of the PCR products was verified as MOR by Southern blotting ŽFig. 2b.. MOR mRNA was not detected in spleen and
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
lymph nodes by ethidium bromide staining ŽFig. 2a. or Southern blotting ŽFig. 2b.. HPRT message was detected in all samples indicating the presence of amplifiable RNA ŽFig. 2a.. MOR was widely distributed in the gut. RNA from full thickness samples throughout the gastrointestinal tract consistently tested positive for MOR by RT-PCR ŽTable 2, Fig. 2.. In dissected ileum, MOR mRNA was found in preparations of the mucosa–submucosa and the muscularis propria–myenteric plexus but not in isolated epithelium ŽTable 2.. 3.3. Distribution of MOR mRNA in isolated immune cells PBMC, thymocytes, alveolar macrophages, neutrophils, jejunal lamina propria cells, and ileal and jejunal Peyer’s patch cells were isolated from 2 to 5 animals. Following RNA isolation and nested RT-PCR, no products of the expected size were detected by ethidium bromide staining ŽFig. 2a. or Southern blotting ŽFig. 2b.. HPRT or b actin were consistently detected in all samples. To address the possibility that opioid receptor expression may be induced on immune cells following cellular stimulation, alveolar macrophages, PBMC, thymocytes, lamina propria and Peyer’s patch cells were stimulated with ConA andror LPS for 18–24 h as described in Section 2. Cell viability and stimulation were verified by monitoring induction of interleukin-12 ŽIL-12. mRNA in
195
Table 2 Distribution of MOR in porcine gut and lymphoid tissues Tissue
No. positive resultsr No. of animals tested
Spleen Thymus Inguinal lymph node Mesenteric lymph node Esophagus Stomach Duodenum Jejunum Ileum Colon Ileal epithelium Ileal mucosa Ileal Peyer’s patch Jejunal Peyer’s patch Muscularis propria– Myenteric plexus Cortex Cerebellum
0r3 2r3 0r3 0r3 2r2 2r2 2r2 2r2 2r3 2r2 0r3 3r3 5r5 2r2 2r2 4r4 2r2
Nested RT-PCR was carried out on RNA samples from porcine tissues as described in Section 2. A positive result indicates that a product was detected by ethidium bromide staining after two rounds of 30 cycles of amplification.
macrophages, lamina propria and Peyer’s patch cells, and interleukin-10 ŽIL-10. mRNA in PBMC and thymocytes. MOR mRNA was not detected in unstimulated or stimu-
Fig. 2. Ža. Representative ethidium bromide stained gel of second round MOR and HPRT RT-PCR products amplified from porcine tissue and cell total RNA. Žb. Representative Southern blot of second round MOR RT-PCR products hybridized with a MOR oligo probe. The lower band represents second round MOR PCR product while the upper band corresponds in size to residual or newly amplified first round product.
196
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
Fig. 3. Representative ethidium bromide stained gels of MOR, b-actin, HPRT, IL-10 or IL-12 RT-PCR products amplified from cultured cell total RNA. AbbreÕiations: A.M., alveolar macrophages; L.P., lamina propria cells; I1 P.P., ileal Peyer’s patch cells; J.P.P., jejunal Peyer’s Patch cells; Thy, thymocytes; PBMC, peripheral blood mononuclear cells; Žy., untreated cells; Žq., cells stimulated with LPS andror ConA as indicated in Section 2.
lated macrophages, thymocytes, PBMC, lamina propria or Peyer’s patch cells ŽFig. 3. whereas IL-10 or IL-12 were consistently detected in stimulated cells ŽFig. 3.. HPRT or b actin mRNA were detected in all samples indicating the presence of amplifiable RNA ŽFig. 3..
4. Discussion Porcine MOR exhibits high sequence homology with m opioid receptors cloned from human and rodent brain. The majority of the amino acid differences lie at the N and C termini. Amino acid changes in these regions may not significantly alter the binding affinity of the porcine receptor as compared to human MOR since the termini have been shown, using an N- and C-deleted mutant receptor, to be nonessential for agonistrantagonist binding ŽSurratt et al., 1994.. The transmembrane amino acids predicted to be important in agonist and antagonist binding are completely conserved in the porcine sequence as are the first and third extracellular loops thought to be important in m opioid selectivity ŽSurratt et al., 1994; Wang et al., 1995; Xue et al., 1995.. One potential change between the porcine and human or rat sequences is the presence of a putative glycosylation site on extracellular loop 2. The functional significance of glycosylation at this site is unknown. Southern blotting suggests that pMOR is present in the porcine genome as a single gene likely to contain introns. These results are in agreement with those of Hu et al. Ž1997. who localized pMOR to a single gene on chromosome 1p.
MOR distribution has been well characterized in the CNS but limited studies have examined the peripheral distribution of the receptor. Wittert et al. Ž1996. examined MOR distribution in rat tissues and, in agreement with our findings, found it in the small intestine, cortex, and cerebellum but, in contrast, also found it in the spleen. This discrepancy could be due to species and strain variability in distribution of opioid receptor mRNA ŽGrimm et al., 1994.. Although radioligand binding studies have suggested the presence of specific m-opioid receptor binding sites on isolated immune cells, ŽLopker et al., 1980; Madden et al., 1993; Makman et al., 1995. there is also evidence that points toward an indirect effect of m opioids on immunity. In the present study, we demonstrated that porcine PBMC, alveolar macrophages, neutrophils, thymocytes, lamina propria cells, and Peyer’s patch cells do not contain MOR mRNA either immediately after isolation or after 18-24 of stimulation in culture. These results suggest that the cells are unlikely to express the m receptor. Our findings are in agreement with Gaveriaux-Ruff et al. Ž1994. and Wick et al. Ž1996. who failed to detect MOR mRNA in human lymphocytes and lymphoid cell lines. Our results differ from the findings of Sedqi et al. Ž1995., who, through RT-PCR and fluorescence activated cell sorting, reported the presence of MOR in rat peritoneal macrophages, and Chuang et al. Ž1995. who reported receptor message in human T cells and simian PBMC and PMN by RT-PCR. These discrepancies might be due to differences in species or cell source, or to neuronal contamination of immunocyte preparations. Contamination of RNA preparations with
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
residual genomic DNA could have also led to false positives when primers were chosen within the same exon ŽChuang et al., 1995. Based on our RNA analysis, MOR does not appear to be present on porcine immune cells. Opioids could, however, activate MOR on peripheral neurons innervating primary and secondary lymphoid tissues and thereby modulate immune function in an indirect manner. pMOR mRNA was detected in thymus but not in isolated thymocytes, in Peyer’s patches but not in isolated Peyer’s patch cells, and in jejunum but not in jejunal lamina propria cells. Based on these observations, it appears that the receptor message is localized to the neural elements within these tissues rather than on the immune cells themselves. Moreover, morphine may affect immunity by influencing central sympathetic outflow ŽShavit et al., 1986; Weber and Pert, 1989., by acting through the hypothalamic-pituitary-adrenal axis ŽBryant et al., 1988., or through a glucocorticoid-independent mechanism such as the autonomic nervous system ŽFlores et al., 1994.. Since some immune tissues do not appear to express MOR, they may be regulated by morphine and other opioids through the HPA axis; whereas, other immune tissues, including the thymus and Peyer’s patches, may be functionally modified in an indirect manner through m opioid receptors on nonlymphoid cells.
Acknowledgements This research was supported by NIDA grants DA-10200 and DA-08010 awarded to DRB and MPM, respectively. MSP was supported by the Training in Psychoneuroimmunology and Substance Abuse grant DA-07239 and MAO was supported by the Neuroscience Training in Drug Abuse Research grant DA-07234. The authors gratefully acknowledge Michael Zilliox for technical assistance and Christopher Nelsen for assistance with computer analysis.
References Baarsch, M.J., Wannemuehler, M.J., Molitor, T.W., Murtaugh, M.P., 1991. Detection of tumor necrosis factor a from porcine alveolar macrophages using an L929 fibroblast assay. J. Immunol. Methods 140, 15–22. Bailey, M., Hall, L., Bland, P.W., Stokes, C.R., 1994. Production of cytokines by lymphocytes from spleen, mesenteric lymph node and intestinal lamina propria of pigs. Immunology 82, 577–583. Bayer, B.M., Daussin, S., Hernandez, M., Irvin, L., 1990. Morphine inhibition of lymphocyte activity is mediated by an opioid dependent mechanism. Neuropharmacology 29, 369–374. Bryant, H.U., Bernton, E.W., Holaday, J.W., 1988. Morphine pellet-induced immunomodulation in mice: temporal relationships. J. Pharmacol. Exp. Ther. 245, 913–920. Bryant, H.U., Roudebush, R.E., 1990. Suppressive effects of morphine pellet implants on in vivo parameters of immune function. J. Pharmacol. Exp. Ther. 255, 410–414.
197
Buissiere, J.L., Alder, M.W., Rogers, T.J., Eisenstein, T.K., 1992. Differential effects of morphine and naltrexone on the antibody response in various mouse strains. Immunopharmacol. Immunotoxicol. 14, 657– 673. Chao, C.C., Hu, S., Molitor, T.W., Zhou, Y., Murtaugh, M.P., Tsang, M., Peterson, P.K., 1992. Morphine potentiates transforming growth factor-b release from human peripheral blood mononuclear cell cultures. J. Pharmacol. Exp. Ther. 262, 19–24. Chao, C.C., Molitor, T.W., Close, K., Hu, S., Peterson, P.K., 1993. Morphine inhibits the release of tumor necrosis factor in human peripheral blood mononuclear cell cultures. Int. J. Immunopharmacol. 15, 447–453. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Chuang, L.F., Killam, K.F., Chuang, R.Y., 1993. Opioid dependency and T-helper cell functions in rhesus monkey. In vivo 7, 159–166. Chuang, T.K., Killam, K.F. Jr., Chuang, L.F., Kung, H.-F., Sheng, W.S., Chao, C.C., Yu, L., Chuang, R.Y., 1995. Mu opioid receptor gene expression in immune cells. Biochem. Biophys. Res. Commun. 216, 922–930. Flores, L.R., Hernandez, M.C., Bayer, B.M., 1994. Acute immuno-suppressive effects of morphine: lack of involvement of pituitary and adrenal factors. J. Pharmacol. Exp. Ther. 268, 1129–1134. Frohman, M.A., 1993. Rapid amplification of complementary DNA ends for generation of full-length complementary DNAs: thermal RACE. Meth. Enzymol. 218, 340–356. Gaveriaux-Ruff, C., Simonin, F., Peluso, J., Befort, K., Kieffer, B., 1994. Expression of opioid receptor mRNAs in immune cells. Reg. Pept. 54, 103–104. Grimm, L.J., Clock, B.J., Cox, B.M., 1994. Comparison of the distribution of mu and delta opiate receptor mRNA in rat and mouse brain by in situ hybridization. Reg. Pept. 54, 111–112. Hu, Z., Rohrer, G.A., Stone, R.T., Rutherford, M., Osinski, M.A., Pampusch, M.S., Murtaugh, M., Brown, D.R., Beattie, C.W., 1997. Linkage assignment of eleven genes to the porcine genome. Mamm. Genome 8, 559–563. Kaufman, D.L., Keith, D.D. Jr., Anton, B., Tian, J., Magendzo, K., Newman, D., Tran, T.H., Lee, D.S., Wen, C., Xia, Y.-R., Lusis, A.J., Evans, C.J., 1995. Characterization of the murine m opioid receptor gene. J. Biol. Chem. 270, 15877–15883. Lopker, A., Abood, L.G., Hoss, W., Lionetti, F.J., 1980. Stereoselective muscarinic acetylcholine and opiate receptors in human phagocytic leukocytes. Biochem. Pharmacol. 29, 1361–1365. Madden, J.J., Ketelsen, D., Whaley, W.L., 1993. Morphine binding sites on human T lymphocytes. Adv. Exp. Med. Biol. 335, 61–66. Makman, M.H., Bilfinger, T.V., Stefano, G.B., 1995. Human granulocytes contain an opiate alkaloid-selective receptor mediating inhibition of cytokine-induced activation and chemotaxis. J. Immunol. 154, 1323–1330. Metcalfe, D.D., 1996. Preparation and functional analysis of other lymphoid and nonlymphoid cells. In: Coligan, J.E., Kruisbeek, A.M., Margulies, D.H., Shevach, E.M., Strober, W. ŽEds.., Current Protocols in Immunology, Vol. 2. Greene Pub. Associates and Wiley-Interscience, New York, pp. 7.23.2–7.23.4. Molitor, T.W., Morilla, A., Risdahl, J.M., Murtaugh, M.P., Chao, C.C., Peterson, P.K., 1992. Chronic morphine administration impairs cellmediated immune responses in swine. J. Pharmacol. Exp. Ther. 260, 581–586. Peterson, P.K., Sharp, B., Gekker, G., Brummitt, C., Keane, W.F., 1987a. Opioid-mediated suppression of cultured peripheral blood mononuclear cell respiratory burst activity. J. Immunol. 138, 3907–3912. Peterson, P.K., Sharp, B., Gekker, G., Brummitt, C., Keane, W.F., 1987b. Opioid-mediated suppression of interferon-g production by cultured peripheral blood mononuclear cells. J. Clin. Invest. 80, 824–831. Sedqi, M., Roy, S., Ramakrishnan, S., Elde, R., Loh, H.H., 1995.
198
M.S. Pampusch et al.r Journal of Neuroimmunology 90 (1998) 192–198
Complementary DNA cloning of a m-opioid receptor from rat peritoneal macrophages. Biochem. Biophys. Res. Commun. 209, 563–574. Sei, Y., Yoshimoto, K., McIntyre, T., Skolnick, P., Arora, P.K., 1991. Morphine-induced thymic hypoplasia is glucocorticoid-dependent. J. Immunol. 146, 194–198. Shavit, Y., Depaulis, A., Martin, F.C., Terman, G.W., Pechnick, R.N., Zane, C.J., Gale, R.P., Liebeskind, J.L., 1986. Involvement of brain opiate receptors in the immune-suppressive effect of morphine. Proc. Natl. Acad. Sci. USA 83, 7114–7117. Surratt, C.K., Johnson, P.S., Moriwaki, A., Seidleck, B.K., Blaschak, C.J., Wang, J.B., Uhl, G.R., 1994. m-opiate receptor. J. Biol. Chem. 269, 20548–20553. Thomas, P.T., Bhargava, H.N., House, R.V., 1995. Immunomodulatory effects of in vitro exposure to morphine and its metabolites. Pharmacology 50, 51–62. Thompson, R.C., Mansour, A., Akil, H., Watson, S.J., 1993. Cloning and pharmacological characterization of a rat m-opioid receptor. Neuron 11, 903–913.
Wang, W.W., Shahrestanifar, M., Jin, J., Howells, R.D., 1995. Studies on m and d opioid receptor selectivity utilizing chimeric and site-mutagenized receptors. Proc. Natl. Acad. Sci., U.S.A. 92, 12436–12440. Weber, R.J., Pert, A., 1989. The periaqueductal gray matter mediates opiate-induced immunosuppression. Science 245, 188–190. Wick, M.J., Minnerath, S.R., Roy, S., Ramakrishnan, S., Loh, H.H., 1996. Differential expression of opioid receptor genes in human lymphoid cell lines and peripheral blood lymphocytes. J. Neuroimmunol. 64, 29–36. Wittert, G., Hope, P., Pyle, D., 1996. Tissue distribution of opioid receptor gene expression in the rat. Biochem. Biophys. Res. Comm. 218, 877–881. Xue, J.-C., Chen, C., Zhu, J., Kunapuli, S.P., de Riel, J.K., Yu, L., Liu-Chen, L.-Y., 1995. The third extracellular loop of the m opioid receptor is important for agonist selectivity. J. Biol. Chem. 270, 12977–12979.