The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty

+

MODEL

Journal of the Formosan Medical Association xxx (xxxx) xxx

Available online at www.sciencedirect.com

ScienceDirect journal homepage: www.jfma-online.com

Original Article

The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty Yu-Ting Jeng a, Ching-Yao Tsai a,b, Li-Lin Kuo a,c, Lin-Chung Woung a,d, Shu-Yi Lin e, I-Lun Tsai a,* a

Department of Ophthalmology, Taipei City Hospital, Taipei, Taiwan Institute of Public Health, National Yang-Ming University, Taipei, Taiwan c Department of Health Care Management, National Taipei University of Nursing and Health Sciences, Taipei, Taiwan d Department of Ophthalmology, National Taiwan University Hospital, Taipei, Taiwan e Department of Education and Research, Taipei City Hospital, Taipei, Taiwan b

Received 8 August 2019; received in revised form 29 October 2019; accepted 16 December 2019

KEYWORDS Aqueous humor; Cornea; Graft survival; Penetrating keratoplasty; Simplexvirus

Background/Purpose: Reactivation of herpes viruses poses threat to corneal graft survival. This study evaluated the presence of herpes simplex virus type 1 (HSV-1), HSV type 2 (HSV-2), and cytomegalovirus (CMV) DNA in recipient corneas and the aqueous humor of patients undergoing penetrating keratoplasty (PKP), and the impact on graft survival. Methods: This retrospective study reviewed 90 eyes of 71 patients underwent PKP between 2008 and 2016. Cornea and aqueous humor samples were sent for polymerase chain reaction (PCR) testing for viral DNA. The main outcomes were PCR results and graft survival. Results: Recipient corneas tested positive for HSV-1 in 47 eyes (52.2%), for HSV-2 in 24 eyes (26.7%), and for CMV in seven eyes (7.8%). Aqueous humor tested positive for HSV-1 in 44 eyes (48.9%), for HSV-2 in 25 eyes (27.8%), and for CMV in eight eyes (8.9%). The presence of aqueous HSV-1 DNA was associated with higher risk of graft failure (p Z 0.005), whereas corneal HSV-1 DNA was not. The presence of HSV-2 DNA had no significant impact on graft survival. Aqueous CMV DNA was associated with higher risk of graft failure in univariate model, but not in multivariate model. Conclusion: There were high positive rates of HSV-1, HSV-2, and CMV DNA in recipient corneas and aqueous humor at the time of PKP, even among patients not suspected of latent

* Corresponding author. No.145, Zhengzhou Rd., Datong Dist., Taipei City 10341, Taiwan. E-mail address: [email protected] (I.-L. Tsai). https://doi.org/10.1016/j.jfma.2019.12.009 0929-6646/Copyright ª 2019, Formosan Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Please cite this article as: Jeng Y-T et al., The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.12.009

+

MODEL

2

Y.-T. Jeng et al. viral infection. The presence of aqueous HSV-1 DNA was associated with higher risk of graft failure. Copyright ª 2019, Formosan Medical Association. Published by Elsevier Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/ by-nc-nd/4.0/).

Introduction Herpes viruses are transmitted via direct contact with mucosal surfaces or infectious body fluids. Ocular manifestations include conjunctivitis, keratitis, corneal endotheliitis, anterior uveitis, and retinitis.1 Herpes simplex virus type 1 (HSV-1), HSV type 2 (HSV-2) and cytomegalovirus (CMV) are reported to infect the eye.2,3 Primary infections of herpes viruses are mostly asymptomatic in those affected. After primary infection to the eye, HSV-1 spreads to adjacent neuronal cells, whereas CMV hides within cells of the myeloid lineage.4,5 It is in this way that herpes viruses evade the host immune system to establish lifelong latent infection, even in immunocompetent populations.6 Corneal transplants are the most successful solid organ transplant; however, unfavorable outcomes occur with higher frequency in the presence of local immune responses, such as inflammation.7 The reactivation of herpes viruses with induced antiviral immune response is a threat to the survival of grafts. Previous studies have reported that the risk of graft failure was higher in cases with previous infection of ocular herpes.8 Even among patients with clinically quiescent HSV disease, histopathological inflammation has been observed in excised recipient corneal tissue.9 Polymerase chain reaction (PCR) is an effective tool for the detection of viral DNA even from small samples. However, few studies have investigated the value of screening for infection with the herpes virus in the recipient of PKP, particularly in the aqueous humor. Our primary objective in this study was to investigate the presence of HSV-1, HSV-2, and CMV DNA in the cornea and aqueous humor of patients receiving PKP. Our second objective was to determine whether patients with positive PCR test results for viral DNA are at greater risk of graft failure.

Methods Subjects and study design This study was approved by the Research Ethics Committee (REC) of Taipei City Hospital (case number: TCHIRB10801003-E). The REC waived the requirement of written consent. This single-center, retrospective review began with all patients that underwent PKP between 2008 and 2016 at Taipei City Hospital Zhongxing branch. To exclude surgical bias, only cases performed by one single surgeon were included. Medical records were reviewed until 31 December 2018. The following data were extracted from the patients’ medical records: demographic data, previous ocular

history, surgical indications, results of intraoperative viral PCR of the cornea and aqueous samples, and postoperative follow-up status. History of ocular herpes was identified by clinical finding and history taking. For eyes with multiple preoperative indications, the primary surgical indication was determined in the following order: corneal ulcer threatening perforation, limbal stem cell deficiency (LSCD) after chemical burn, graft failure, Fuchs endothelial corneal dystrophy (FECD), bullous keratopathy, and corneal opacity. Patients with incomplete data were excluded. Specimens obtained during operations were sent for PCR testing for HSV-1, HSV-2, and CMV DNA as a matter of course. During the procedure of PKP, one eighth of the excised recipient cornea and the aspirated aqueous humor were collected separately in two sterile containers and delivered to the laboratory for PCR analysis. Postoperatively, topical dexamethasone 0.1% and ciprofloxacin 0.2% were given four times a day, whereupon the dose was gradually tapered off after six months. Prophylactic antiviral regimen was 500 mg of Valaciclovir twice a day orally for 6 months, then was tapered gradually on an individual basis. It was given preoperatively in the outpatient department if episode of viral-related graft failure was previously observed, given in the day before the PKP surgery if known history of ocular herpes, or given postoperatively if PCR results revealed positive viral DNA. Postoperative therapeutic antiviral regimen also started with 500 mg of valaciclovir twice a day orally. It was given in cases where viral reactivation was observed postoperatively. Ganciclovir eyedrop (0.5% or 2%) was given in addition to oral valaciclovir if viral reactivation was observed in patients with positive CMV PCR results. Graft failure was the primary endpoint, defined as irreversible loss of corneal transparency. Primers for HSV-1, HSV-2, and CMV DNA were adopted from published papers on the subject.10,11 Detection of herpes virus DNA was conducted using seminested PCR for HSV-1 and HSV-2. Primer sequences used for HSV-1 were 50 -CGAAGACGTCCGGAAACAAC (outer and inner sense), 50 -CGGTGC TCCAGGATAAA (outer antisense), and 50 -TCTCCGTCCAGT CGTTTATCTTC (inner antisense).10 Primer sequences used for HSV-2 were 50 -GGACGAGGCCCGAAAGCACA (outer and inner sense), 50 -CGGTGCTCCAGGATAAA (outer antisense), and 50 -TCTCCGTCCAGTCGTTTATCTTC (inner antisense).10 For CMV-specific amplification, we used the primer set CMV-1 (50 -GATCCGACCCATTGTCTAAG) and CMV-2 (50 GGCAGCTATCGTGACTGGGA).11

Statistical analysis The chi-squared test and Fisher’s exact test were used where appropriate to compare the positive virus PCR group

Please cite this article as: Jeng Y-T et al., The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.12.009

+

MODEL

Herpes virus DNA and PKP survival and negative virus PCR group in terms of demographic data and pre-operative conditions. Graft survival rate and standard deviation (SD) were calculated using KaplaneMeier survival analysis. The log rank test was used to determine the significance of the difference between graft survival in the various groups. The Cox proportional hazard model was used to calculate the hazard ratio (HR) and 95% confidence interval (95% CI) for graft failure. Only variables that were statistically significant in univariate analysis were included in multivariate analysis. Crude and adjusted HR were both estimated. In all of the findings, statistical significance was defined as a p value of less than 0.05. Data analysis was conducted using Statistical Product and Service Solutions Version 21.0 (IBM Corp. Released 2012. IBM SPSS Statistics for Windows).

Results A total of 126 PKPs met the inclusion criteria. Thirty-three PKPs missing aqueous PCR result, along with another three PKPs missing both corneas and aqueous PCR results, were excluded. A total of 90 PKPs of 71 patients were eligible for the final analysis. The mean age at the time of surgery was 67.4 years (range 27e96 years). Thirty eyes (33.3%) had a previous history of ocular herpes. Thirty-four eyes (37.8%) had a history of keratoplasty, including 31 PKPs, two deep anterior lamellar keratoplasty (DALK), and one Descemet stripping automated endothelial keratoplasty (DSAEK). Surgical indications included graft failure in 32 eyes (35.6%), bullous keratopathy in 27 eyes (30.0%), corneal opacity in 16 eyes (17.8%), FECD in 10 eyes (11.1%), corneal ulcer threatening perforation in three eyes (3.3%), and LSCD after chemical burn in two eyes (2.2%). There were two cases with a history of keratoplasty in which corneal ulcer were their primary surgical indication. The PCR results of recipient cornea were positive for HSV-1 in 47 eyes (52.2%), for HSV-2 in 24 eyes (26.7%), and for CMV in seven eyes (7.8%). The PCR results of recipient aqueous humor were positive for HSV-1 in 44 eyes (48.9%), for HSV-2 in 25 eyes (27.8%), and for CMV in eight eyes (8.9%). These results are presented in Tables 1e3. Both cornea and aqueous humor samples were tested positive for HSV-1 in 37 PKPs, for HSV-2 in 19 PKPs, for CMV in 5 PKPs. We also present the positive rates of the three viruses among different subgroups. However, viral positive rates did not differ significantly with regard to history of ocular herpes, history of keratoplasty, or surgical indications. Coexistence of viral DNAs was shown in Table 4. Among these three viruses, HSV-1 was relatively free to be present alone. HSV-2 and CMV were tend to be present along with another virus. Table 5 presents the graft survival rates estimated using the KaplaneMeier survival analysis. The overall graft survival rate was 73.0% at two years. The influence of HSV-1 and CMV on graft survival was dependent on the site of viral DNA presence. The 2-year graft survival rate was 71.3% (p Z 0.659) in cases where HSV-1 DNA was present in the cornea and 58.6% (p Z 0.007) when present in aqueous humor. The 2-year graft survival rate was 71.4% (p Z 0.135) in cases where CMV DNA was present in the cornea and 62.5% (p Z 0.036) when present in the aqueous humor. The

3 Table 1 PCR results of HSV-1 DNA on recipient cornea and aqueous humor. Total

Positive PCR results Cornea N %a

Overall History of ocular herpes No Yes History of keratoplasty No Yes Indication FECD Corneal opacity Bullous keratopathy Graft failure Othersb

90

Aqueous humor

p value N %a

47 52.2%

44 48.9% 0.136

60 30

p value

28 46.7% 19 63.3%

0.551 28 46.7% 16 53.3%

0.666

0.830

56 34

28 50.0% 19 55.9%

28 50.0% 16 47.1%

10 16

4 40.0% 5 31.3%

5 50.0% 5 31.3%

27

16 59.3%

15 55.6%

32 5

18 56.3% 4 80.0%

15 46.9% 4 80.0%

0.222

0.347

Abbreviation: FECD, Fuchs endothelial corneal dystrophy; HSV1, herpes simplex virus type 1; PCR, polymerase chain reaction. a % Z positive number/total number. b 3 cases of corneal ulcer threatening perforation and 2 cases of limbal deficiency after chemical burn.

Table 2 PCR results of HSV-2 DNA on recipient cornea and aqueous humor. Total

Positive PCR results Cornea a

N % Overall History of ocular herpes No Yes History of keratoplasty No Yes Indication FECD Corneal opacity Bullous keratopathy Graft failure Othersb

90

Aqueous humor

p value N %a

24 26.7% 0.613

60 30

p value

25 27.8%

15 25.0% 9 30.0%

0.183 14 23.3% 11 36.7%

>0.99

0.475

56 34

15 26.8% 9 26.5%

14 25.0% 11 32.4%

10 16

1 10.0% 5 31.3%

3 30.0% 4 25.0%

27

5 18.5%

4 14.8%

32 5

9 28.1% 2 40.0%

11 34.3% 3 60.0%

0.719

0.229

Abbreviation: FECD, Fuchs endothelial corneal dystrophy; HSV2, herpes simplex virus type 2; PCR, polymerase chain reaction. a % Z positive number/total number. b Three cases of corneal ulcer threatening perforation and two cases of limbal deficiency after chemical burn.

Please cite this article as: Jeng Y-T et al., The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.12.009

+

MODEL

4

Y.-T. Jeng et al. Table 3 PCR results of CMV DNA on recipient cornea and aqueous humor. Total N %a 90

7 7.8%

5 8.3% 2 6.7%

>0.99

c

0.250c 7 12.5% 1 2.9%

0.684 10 16

p value

5 8.3% 3 10.0%

5 8.9% 2 5.9% 0 0.0% 2 12.5%

0.329 0 0.0% 2 12.5%

27

3 11.1%

4 14.8%

32 5

2 6.2% 0 0.0%

1 3.1% 1 20.0%

Abbreviation: CMV, cytomegalovirus; FECD, Fuchs endothelial corneal dystrophy; PCR, polymerase chain reaction. a % Z positive number/total number. b Three cases of corneal ulcer threatening perforation and two cases of limbal deficiency after chemical burn. c Fisher’s exact test.

Table 4

Coexistence of viral DNA.

Total Negative for all viruses HSV-1 HSV-2 CMV HSV-1 & HSV-2 HSV-2 & CMV CMV & HSV-1 HSV-1 & HSV-2 & CMV

Graft survival rate 1-year SD

8 8.9% c

0.706c 56 34

Total

2-year SD

Aqueous humor

p value N %a >0.99

60 30

Graft survival rate at 1 and 2 years.

Positive PCR results Cornea

Overall History of ocular herpes No Yes History of keratoplasty No Yes Indication FECD Corneal opacity Bullous keratopathy Graft failure Othersb

Table 5

Cornea

Aqueous humor

90 37 24 3 3 19 0 2 2

90 39 22 5 1 16 1 3 3

Overall 90 88.7% Recipient corneal HSV-1 HSV-1 () 43 90.3% HSV-1 (þ) 47 87.2% Recipient corneal HSV-2 HSV-2 () 66 92.2% HSV-2 (þ) 24 79.2% Recipient corneal CMV CMV () 82 88.9% CMV (þ) 7 85.7% Recipient aqueous HSV-1 HSV-1 () 46 97.7% HSV-1 (þ) 44 77.3% Recipient aqueous HSV-2 HSV-2 () 65 92.1% HSV-2 (þ) 25 80.0% Recipient aqueous CMV CMV () 82 88.8% CMV (þ) 8 87.5% History of ocular herpes No 60 94.9% Yes 30 76.7% History of keratoplasty No 56 90.9% Yes 34 85.3% Indication FECD 10 100.0% Corneal 16 86.7% opacity Bullous 27 96.3% keratopathy Graft failure 32 87.5% 5 40.0% Othersa

3.4% 73.0%

4.8%

4.6% 74.9% 4.9% 71.3%

6.9% 6.8%

3.3% 72.4% 8.3% 75.0%

5.7% 8.8%

3.5% 73.1% 13.2% 71.4%

5.0% 17.1%

2.2% 88.4% 6.3% 58.6%

4.9% 7.5%

3.4% 71.6% 8.0% 76.0%

5.9% 8.5%

3.5% 74.1% 11.7% 62.5%

5.0% 17.1%

2.8% 78.5% 7.7% 63.2%

5.5% 8.8%

3.9% 79.1% 6.1% 64.0%

5.6% 8.3%

Log rank value 0.659

0.714

0.135

0.007

0.540

0.036

0.085

0.133

0.002 e 100.0% e 8.8% 86.7% 8.8% 3.6% 73.0%

8.7%

5.8% 64.8% 8.6% 21.9% 40.0% 21.9%

Abbreviation: CMV, cytomegalovirus; FECD, Fuchs endothelial corneal dystrophy; HSV, herpes simplex virus; SD, standard deviation. a Three cases of corneal ulcer threatening perforation and two cases of limbal deficiency after chemical burn.

Abbreviation: CMV, cytomegalovirus; HSV-1, herpes simplex virus type 1; HSV-2, herpes simplex virus type 2.

presence of HSV-1 or CMV DNA in aqueous humor was significantly associated with lower graft survival rates. The presence of HSV-2 DNA, history of ocular herpes, and history of keratoplasty were not significantly associated with graft survival rates. Graft survival rates also varied with surgical indications. Patients with FECD had the highest 2year graft survival rate (100.0%, p Z 0.002), whereas patients with corneal ulcer or LSCD after chemical burn had the lowest 2-year graft survival rate (40.0%, p Z 0.002). Table 6 lists the HRs for factors influencing graft survival, using Cox model. The statistically significant factors included positive PCR results for HSV-1 in aqueous humor (HR Z 2.46, p Z 0.009), positive PCR results for CMV in aqueous humor (HR Z 2.49, p Z 0.043), and surgical

indication of corneal ulcer or LSCD after chemical burn (HR Z 21.38, p Z 0.005). These factors were included in multivariate Cox model analysis. After adjusting for these factors, the influence of positive PCR results for HSV-1 in aqueous humor (adjusted HR Z 2.90, p Z 0.005), indication of graft failure (adjusted HR Z 8.57, p Z 0.039), and corneal ulcer or LSCD after chemical burn (adjusted HR Z 23.52, p Z 0.004) still reached statistically significance.

Discussion In our study, we investigate the impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following PKP. PCR tests were conducted on all patients,

Please cite this article as: Jeng Y-T et al., The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.12.009

+

MODEL

Herpes virus DNA and PKP survival Table 6

5

Univariate and multivariate analysis of factors predictive of graft failure. Total

Overall Recipient corneal HSV-1 HSV-1 () HSV-1 (þ) Recipient corneal HSV-2 HSV-2 () HSV-2 (þ) Recipient corneal CMV CMV () CMV (þ) Recipient aqueous HSV-1 HSV-1 () HSV-1 (þ) Recipient aqueous HSV-2 HSV-2 () HSV-2 (þ) Recipient aqueous CMV CMV () CMV (þ) History of ocular herpes No Yes History of keratoplasty No Yes Indication FECD Corneal opacity Bullous keratopathy Graft failure Othersb

Multivariatea

Univariate

N

HR

95% CI

p value

90

e

e

e

43 47

1 1.16

e 0.60e2.22

e 0.659

66 24

1 1.14

e 0.56e2.31

e 0.714

82 7

1 2.03

e 0.79e5.26

e 0.143

46 44

1 2.46

e 1.25e4.86

e 0.009

65 25

1 1.24

e 0.63e2.43

e 0.541

82 8

1 2.49

e 1.03e6.05

e 0.043

60 30

1 1.73

e 0.92e3.25

e 0.089

56 34

1 1.62

e 0.86e3.07

e 0.137

10 16 27 32 5

1 2.70 4.84 6.10 21.38

e 0.28e26.04 0.62e37.62 0.81e45.72 2.48e184.38

e 0.390 0.132 0.079 0.005

HR

95% CI

p value

1 2.90

e 1.39e6.04

e 0.005

1 2.58

e 0.99e6.66

e 0.050

1 3.15 4.55 8.57 23.52

e 0.32e31.53 0.57e36.10 1.12e65.54 2.67e207.47

e 0.328 0.151 0.039 0.004

Abbreviation: CI, confidence interval; CMV, cytomegalovirus; FECD, Fuchs endothelial corneal dystrophy; HR, hazard ratio; HSV, herpes simplex virus. a Adjusted for recipient aqueous HSV-1, recipient aqueous CMV, age, and indication. b Three cases of corneal ulcer threatening perforation and two cases of limbal deficiency after chemical burn.

regardless of whether preoperative risk factors for latent viruses were present. HSV-1 DNA was detected in approximately 50% of the study population, HSV-2 DNA in approximately 26%, and CMV DNA in approximately 8%. None of the parameters (history of ocular herpes, history of keratoplasty, or surgical indications) presented a significant association with the presence of herpes virus DNA. The presence of HSV-1 DNA in recipient aqueous humor was associated with a higher risk of graft failure, even after adjusting for significant factors in the univariate model. Most individuals are infected by herpes viruses at some point in their lives. Overall, the reported seroprevalences of HSV-1, HSV-2, and CMV are 54e90%, 16e78%, and 57e83%, respectively.12e15 In a study by van Gelderen et al., no HSV-1 DNA was detected in the aqueous humor of any patients receiving PKP; however, 32% of the recipient corneas in patients with a previous history of ocular herpes presented positive PCR results for HSV-1 DNA.16 Shimomura et al.17 and Remeijer et al.18 respectively detected HSV-1

DNA in 85.7% and 48% of recipient corneas with a previous history of ocular herpes. Likewise, we observed positive PCR results for HSV-1 DNA in 63.3% of recipient corneas and 53.3% of the aqueous humor in patients with history of ocular herpes. In our study, viral positive rates did not differ significantly with regard to history of ocular herpes. In patients with known history of ocular herpes, the medications they had received may play a role in the control of viral activity, resulting in the failure of detection of viral DNA in the cornea or aqueous humor. The viral activity also varied from time to time, and negative PCR results may imply low viral activity at the moment. In this study, we obtained high positive rates of HSV-1 DNA among patients without a history of ocular herpes. We also observed high positive rates of HSV-1 DNA in surgical indications that are generally not associated with herpes disease, such as FECD. Previous studies have reported the presence of corneal HSV-1 DNA in patients without previous herpetic keratitis.16,19 The PCR positive rate of corneal

Please cite this article as: Jeng Y-T et al., The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.12.009

+

MODEL

6 HSV-1 DNA ranged from 16.7% to 36%. These findings may be associated with infections of less virulent HSV-1 strains or viral latency after an unnoticed primary infection. It is also possible that the many patients referred to us from other medical institutions were more likely to be harboring latent ocular viruses due to the complexity of their ocular conditions. These findings are a strong indication that latent ocular herpes virus is more common than previously imagined. Without clinical signs of disease, latent virus is difficult to confirm without laboratory testing. This all but eliminates the likelihood of using early antiviral treatment to lower the risk of graft failure after PKP. In this study, recipient age did not have a significant impact on graft survival. The influence of recipient age on graft survival varied among studies.20,21 Elderly patients are commonly thought to have a higher incidence of surgical complications and morbidities; however, in corneal transplantation surgery, higher age is associated with a less strenuous immune response to the graft, which may be sufficient to offset the adverse effects of old age. Advancements in surgical techniques and postoperative care help to ensure that the outcomes of elderly patients are comparable to those of their younger counterparts. Our findings coincide with those in previous studies insofar as surgical indications can affect graft survival. We demonstrated that patients with FECD had better survival outcomes, whereas patients with corneal ulcer threatening perforation and LSCD after chemical burn had worse survival outcomes. Reactivation of HSV is often a cause of repeat corneal graft failure requiring multiple surgeries.22 Our study population included a large number of patients with a history of ocular herpes; however, we did not detect a significant link between a history of ocular herpes and graft survival. There are two possible reasons. First, patients without a history of ocular herpes had high positive rate of HSV-1 DNA, indicating viral latency. Second, our postoperative therapeutic strategy (i.e., administering antiviral agents to susceptible patients), may also have played a role. Steroids can be used to control inflammation; however, there have been concerns that they enhance susceptibility to viral reactivation. The combination of topical antivirals and steroids proved effective in reducing the rates of graft rejection and viral recurrence without obvious side effects.23 The Herpetic Eye Disease Study (HEDS) reported that oral antivirals administered as a prophylactic can reduce the recurrence of ocular HSV disease.24 In 2016, the Cochrane Library published a comprehensive review on the efficacy of oral antiviral agents in preventing HSV recurrence in corneal grafts.25 The main insight of that study was the discovery that patients taking oral acyclovir face a lower risk of HSV recurrence and corneal graft failure, compared to a no treatment group. Nonetheless, the optimal dosage and duration of oral acyclovir treatment have yet to be determined. Clinical studies have also reported encouraging results from the administration of antiviral prophylaxis and topical steroid, which is similar to our finding.26 In the current study, prophylactic or therapeutic antiviral agents were administered to all susceptible patients; i.e., we lacked a control group by which to examine precisely the effects of antiviral agents on graft survival following PKP.

Y.-T. Jeng et al. In this study, elevated risk of graft failure was observed in patients with positive aqueous HSV-1 DNA. However, this correlation was not observed regarding corneal HSV-1 DNA. In patients without a history of HSV keratitis, the presence of corneal HSV-1 DNA was reported to be associated with higher rates of late endothelial failure.19 In a study of 450 recipient corneal buttons, Remeijer et al. reported that corneal HSV-1 DNA was associated with a higher risk of graft failure after PKP among patients with a history of herpetic keratitis.18 This correlation was not observed in patients who had not contracted herpetic keratitis. Cases of primary graft failure with concurrent aqueous HSV-1 have been reported.27 The detection of aqueous HSV-1 DNA is commonly considered in the diagnosis of herpetic uveitis, as it is indicative of corneal disease of a more active phase or deeper invasion. Poorer host immunity may also contribute to the presence of virus DNA in aqueous humor. It is possible that surgical trauma and/or postoperative immunosuppressive therapy are stimuli for the reactivation of latent HSV-1. Our result demonstrated that performing PKP at this stage was correlated with a higher incidence of graft failure. A more aggressive regimen of antivirals may be required postoperatively for patents presenting with positive aqueous HSV-1 DNA. There are three possible explanations for the presence of HSV-1 DNA in the cornea: neuronal latency with reactivation, corneal latency, and persistent low-grade infection.28 It is widely accepted that ocular HSV-1 is capable of establishing latency in trigeminal ganglion. There is also evidence supporting the corneal latency of HSV-1. Infectious HSV-1 have been cultured successfully from excised corneas, and there have been reports of the transmission of infectious HSV-1 from donor to host.29,30 Thus, there exists the possibility that HSV-1 can establish corneal as well as neuronal latency. Viral shedding to the anterior chamber from intermittently reactivated viruses may be a source of aqueous viral DNA. However, aqueous humor is not a recognized site of viral latency; therefore, the presence of HSV-1 DNA implies a more aggressive phase of the disease. HSV-2 and CMV DNA were less frequently detected than HSV-1 DNA; however, the rate of HSV-2 DNA detection in this study was higher than in previous reports. The reported prevalence of HSV-2 DNA in the cornea ranged from 0.92% to 2.63%.16,18,31 This may be due to different host susceptibility in our study population. We did not observe any correlation between the presence of HSV-2 DNA and graft survival. Reports of CMV-related graft failure are far more frequent, and the cause of graft failure is generally corneal endotheliitis.32,33 Hsiao et al. demonstrated positive CMV DNA in 11 of 30 patients (36.7%) in either recipient cornea or aqueous humor, with a non-significant risk of developing graft failure.34 In our study, we determined that CMV DNA in aqueous humor, was associated with lower graft survival rates. However, the significance was noted in the univariate model, but not in the multivariate model. The small number of patients with positive CMV may play a role. We also observed the coexistence of CMV with other viruses, which may also mask the impact of CMV. This prevented us from drawing concrete conclusions about the role of CMV on graft survival. The presence of viral DNA segments does not necessarily imply the presence of an infectious virus. The gold standard for the detection of infectious HSV-1 is viral culture.

Please cite this article as: Jeng Y-T et al., The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.12.009

+

MODEL

Herpes virus DNA and PKP survival Immunohistochemistry and in situ hybridization can be used for the detection of viral DNA, but not for the detection of infectious viruses. PCR remains the most sensitive and widely used test for the detection of HSV-1 DNA. Interpretations of these findings should be carried out with the knowledge of the strengths and limitations of these tests. Nevertheless, viral DNA may degrade over time, such that it may be an indication of latent infection or recent viral activity. The pathological influence of viral DNA on the cornea remains unclear; however, our findings demonstrated that the presence of HSV-1 DNA is indicative of postoperative prognosis following PKP. Negative PCR results for HSV-1 DNA do not indicate an absence viral latency, as the virus may hide away from cornea. It can imply that the viral activity around the cornea is low at the moment. A thorough examination should still be performed on every postoperative patient to look for signs of viral reactivation. This study has several limitations. First, we did not exclude patients receiving multiple PKPs. Patients receiving a second PKP are essentially an indication of poor graft outcomes. Limiting our analysis to the selection of one surgical event from the multiple events of a particular patient would have introduced selection bias. Including all PKP-related events is more representative of the real-world conditions with which surgeon must cope. Second, the dosage and duration of postoperative antiviral therapy were given on an individual basis. The more severe the disease, the longer the duration of antivirals would be. This practice theoretically increased the graft survival rate of patients with viral reactivation. In these circumstances, we still found an increased risk of graft failure in the presence of HSV-1 DNA in aqueous humor. Finally, our study population was made up entirely of patients visiting our hospital. As mentioned above, the high rate of referrals during this period means that a review of the underlying patient profiles would be necessary before our results could be applied to other patient groups. In conclusion, we observed the presence of HSV-1, HSV2, and CMV DNA in recipient corneas and aqueous humor at the time of PKP, even among patients who were not suspected of having a latent viral infection. The presence of aqueous HSV-1 DNA was associated with an elevated risk of graft failure. The presence of HSV-2 DNA appeared not to influence graft survival. These findings demonstrate the importance of screening for viral DNA during PKP. Understanding the impact of herpesvirus DNA on graft outcomes could help in the implementation of appropriate postoperative care aimed at reducing the rate of herpes virusrelated graft failure.

Funding/support statement This research was supported by Department of Health, Taipei City Government (10001-62-018). The funders had no role in the study design; in the collection, analysis and interpretation of the data; in the writing of the report; and in the decision to submit the paper for publication.

Declaration of Competing Interest None.

7

References 1. Dawson CR, Togni B. Herpes simplex eye infections: clinical manifestations, pathogenesis and management [Internet]. 1976/09/01 Surv Ophthalmol 1976;21(2):121e35. Available from: https://www.ncbi.nlm.nih.gov/pubmed/988644. 2. Barker NH. Ocular herpes simplex. BMJ Clin Evid 2008 [Internet]. 2008/01/01. 2008:0707. Available from: https:// www.ncbi.nlm.nih.gov/pubmed/19445742. 3. Jabs DA, Ahuja A, VanNatta ML, Lyon AT, Yeh S, Danis R, et al. Long-term outcomes of cytomegalovirus retinitis in the Era of modern antiretroviral therapy: results from a United States cohort [Internet]. 2015/04/22 Ophthalmology 2015;122(7): 1452e63. Available from: https://www.ncbi.nlm.nih.gov/ pubmed/25892019. 4. Melchjorsen J, Matikainen S, Paludan SR. Activation and evasion of innate antiviral immunity by herpes simplex virus [Internet]. 2009/12/01 Viruses 2009;1(3):737e59. Available from: https://www.ncbi.nlm.nih.gov/pubmed/ 21994567. 5. Poole E, Sinclair J. Sleepless latency of human cytomegalovirus [Internet]. 2015/03/17 Med Microbiol Immunol 2015;204(3): 421e9. Available from: https://www.ncbi.nlm.nih.gov/ pubmed/25772624. 6. Voigt V, Andoniou CE, Schuster IS, Oszmiana A, Ong ML, Fleming P, et al. Cytomegalovirus establishes a latent reservoir and triggers long-lasting inflammation in the eye [Internet]. 2018/06/01 PLoS Pathog 2018;14(5):e1007040. Available from: https://www.ncbi.nlm.nih.gov/pubmed/29852019. 7. Bachmann B, Taylor RS, Cursiefen C. Corneal neovascularization as a risk factor for graft failure and rejection after keratoplasty: an evidence-based meta-analysis [Internet]. 2010/07/08 Ophthalmology 2010;117(7): 1300e1305 e7. Available from: https://www.ncbi.nlm.nih. gov/pubmed/20605214. 8. Kuffova L, Knickelbein JE, Yu T, Medina C, Amescua G, Rowe AM, et al. High-risk corneal graft rejection in the setting of previous corneal herpes simplex virus (HSV)-1 infection [Internet]. 2016/04/07 Investig Ophthalmol Vis Sci 2016;57(4): 1578e87. Available from: https://www.ncbi.nlm.nih.gov/ pubmed/27050878. 9. Shtein RM, Garcia DD, Musch DC, Elner VM. Herpes simplex virus keratitis: histopathologic inflammation and corneal allograft rejection [Internet]. 2009/07/07 Ophthalmology 2009; 116(7):1301e5. Available from: https://www.ncbi.nlm.nih. gov/pubmed/19576497. 10. Shyamal G, Sowmya P, Sudha B, Malathi J, Therese LK, Madhavan HN. Application of polymerase chain reaction to differentiate herpes simplex virus 1 and 2 serotypes in culture negative intraocular aspirates [Internet]. 2005/12/06 Indian J Med Microbiol 2005;23(4):239e44. Available from: https:// www.ncbi.nlm.nih.gov/pubmed/16327119. 11. Sun A, Chang JG, Kao CL, Liu BY, Wang JT, Chu CT, et al. Human cytomegalovirus as a potential etiologic agent in recurrent aphthous ulcers and Behcet’s disease [Internet]. 1996/05/01 J Oral Pathol Med 1996;25(5):212e8. Available from: https://www.ncbi.nlm.nih.gov/pubmed/8835817. 12. Bradley H, Markowitz LE, Gibson T, McQuillan GM. Seroprevalence of herpes simplex virus types 1 and 2–United States, 1999-2010 [Internet]. 2013/10/19 J Infect Dis 2014;209(3): 325e33. Available from: https://www.ncbi.nlm.nih.gov/ pubmed/24136792. 13. Rabenau HF, Buxbaum S, Preiser W, Weber B, Doerr HW. Seroprevalence of herpes simplex virus types 1 and type 2 in the Frankfurt am Main area, Germany [Internet]. 2002/05/15 Med Microbiol Immunol 2002;190(4):153e60. Available from: https://www.ncbi.nlm.nih.gov/pubmed/12005327.

Please cite this article as: Jeng Y-T et al., The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.12.009

+

MODEL

8 14. Olsson J, Kok E, Adolfsson R, Lovheim H, Elgh F. Herpes virus seroepidemiology in the adult Swedish population [Internet]. 2017/05/12 Immun Ageing 2017;14:10. Available from: https://www.ncbi.nlm.nih.gov/pubmed/28491117. 15. Lachmann R, Loenenbach A, Waterboer T, Brenner N, Pawlita M, Michel A, et al. Cytomegalovirus (CMV) seroprevalence in the adult population of Germany [Internet]. 2018/07/26 PLoS One 2018;13(7):e0200267. Available from: https://www.ncbi.nlm.nih.gov/pubmed/30044826. 16. VanGelderen BE, Van derLelij A, Treffers WF, Van derGaag R. Detection of herpes simplex virus type 1, 2 and varicella zoster virus DNA in recipient corneal buttons [Internet]. 2000/10/26 Br J Ophthalmol 2000;84(11):1238e43. Available from: https://www.ncbi.nlm.nih.gov/pubmed/11049947. 17. Shimomura Y, Deai T, Fukuda M, Higaki S, Hooper LC, Hayashi K. Corneal buttons obtained from patients with HSK harbor high copy numbers of the HSV genome [Internet]. 2007/01/26 Cornea 2007;26(2):190e3. Available from: https://www.ncbi.nlm.nih.gov/pubmed/17251811. 18. Remeijer L, Duan R, vanDun JM, Wefers Bettink MA, Osterhaus AD, Verjans GM. Prevalence and clinical consequences of herpes simplex virus type 1 DNA in human cornea tissues [Internet]. 2009/05/30 J Infect Dis 2009;200(1):11e9. Available from: https://www.ncbi.nlm.nih.gov/pubmed/ 19476433. 19. Aydemir O, Turkcuoglu P, Bulut Y, Kalkan A. The relationship of graft survival and herpes simplex virus latency in recipient corneal buttons [Internet]. 2007/06/01 Clin Ophthalmol 2007; 1(2):127e31. Available from: https://www.ncbi.nlm.nih.gov/ pubmed/19668501. 20. Inoue K, Amano S, Oshika T, Tsuru T. Risk factors for corneal graft failure and rejection in penetrating keratoplasty [Internet]. 2001/06/13 Acta Ophthalmol Scand 2001;79(3): 251e5. Available from: https://www.ncbi.nlm.nih.gov/ pubmed/11401633. 21. Patel HY, Ormonde S, Brookes NH, Moffatt SL, Sherwin T, Pendergrast DG, et al. The New Zealand National Eye Bank: survival and visual outcome 1 year after penetrating keratoplasty [Internet]. 2011/02/02 Cornea 2011;30(7):760e4. Available from: https://www.ncbi.nlm.nih.gov/pubmed/ 21282990. 22. Lomholt JA, Baggesen K, Ehlers N. Recurrence and rejection rates following corneal transplantation for herpes simplex keratitis [Internet]. 1995/02/01 Acta Ophthalmol Scand 1995; 73(1):29e32. Available from: https://www.ncbi.nlm.nih.gov/ pubmed/7627755. 23. Ficker LA, Kirkness CM, Rice NS, Steele AD. Longterm prognosis for corneal grafting in herpes simplex keratitis [Internet]. 1988/01/01 Eye 1988;2(Pt 4):400e8. Available from: https:// www.ncbi.nlm.nih.gov/pubmed/3075567. 24. Herpetic Eye Disease Study Group. Acyclovir for the prevention of recurrent herpes simplex virus eye disease [Internet].

Y.-T. Jeng et al.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

1998/08/08 N Engl J Med 1998;339(5):300e6. Available from: https://www.ncbi.nlm.nih.gov/pubmed/9696640. Bhatt UK, Abdul Karim MN, Prydal JI, Maharajan SV, Fares U. Oral antivirals for preventing recurrent herpes simplex keratitis in people with corneal grafts [Internet]. 2016/12/03 Cochrane Database Syst Rev 2016;11:CD007824. Available from: https://www.ncbi.nlm.nih.gov/pubmed/ 27902849. Halberstadt M, Machens M, Gahlenbek KA, Bohnke M, Garweg JG. The outcome of corneal grafting in patients with stromal keratitis of herpetic and non-herpetic origin [Internet]. 2002/05/30 Br J Ophthalmol 2002;86(6):646e52. Available from: https://www.ncbi.nlm.nih.gov/pubmed/ 12034687. DeKesel RJ, Koppen C, Ieven M, Zeyen T. Primary graft failure caused by herpes simplex virus type 1 [Internet]. 2001/03/15 Cornea 2001;20(2):187e90. Available from: https://www. ncbi.nlm.nih.gov/pubmed/11248827. Kennedy DP, Clement C, Arceneaux RL, Bhattacharjee PS, Huq TS, Hill JM. Ocular herpes simplex virus type 1: is the cornea a reservoir for viral latency or a fast pit stop? [Internet]. 2011/02/10 Cornea 2011;30(3):251e9. Available from: https://www.ncbi.nlm.nih.gov/pubmed/21304287. Biswas S, Suresh P, Bonshek RE, Corbitt G, Tullo AB, Ridgway AE. Graft failure in human donor corneas due to transmission of herpes simplex virus [Internet]. 2000/06/30 Br J Ophthalmol 2000;84(7):701e5. Available from: https:// www.ncbi.nlm.nih.gov/pubmed/10873977. Remeijer L, Maertzdorf J, Doornenbal P, Verjans GM, Osterhaus AD. Herpes simplex virus 1 transmission through corneal transplantation [Internet]. 2001/03/29 Lancet 2001; 357(9254):442. Available from: https://www.ncbi.nlm.nih. gov/pubmed/11273067. Robert PY, Adenis JP, Denis F, Alain S, Ranger-Rogez S. Herpes simplex virus DNA in corneal transplants: prospective study of 38 recipients [Internet]. 2003/07/15 J Med Virol 2003;71(1): 69e74. Available from: https://www.ncbi.nlm.nih.gov/ pubmed/12858411. Suzuki T, Hara Y, Uno T, Ohashi Y. DNA of cytomegalovirus detected by PCR in aqueous of patient with corneal endotheliitis after penetrating keratoplasty [Internet]. 2007/04/07 Cornea 2007;26(3):370e2. Available from: https://www.ncbi. nlm.nih.gov/pubmed/17413969. Chee SP, Jap A, Ling EC, Ti SE. Cytomegalovirus-positive corneal stromal edema with keratic precipitates after penetrating keratoplasty: a case-control study [Internet]. 2013/03/30 Cornea 2013;32(8):1094e8. Available from: https://www.ncbi.nlm.nih.gov/pubmed/23538617. Hsiao CH, Hwang YS, Chuang WY, Ma DHK, Yeh LK, Chen SY, et al. Prevalence and clinical consequences of cytomegalovirus DNA in the aqueous humour and corneal transplants. Br J Ophthalmol 2019;103(5):666e71.

Please cite this article as: Jeng Y-T et al., The presence and impact of herpes virus DNA in recipient cornea and aqueous humor on graft survival following penetrating keratoplasty, Journal of the Formosan Medical Association, https://doi.org/10.1016/j.jfma.2019.12.009