- Email: [email protected]
The properties of human DNA fingerprints produced by polymeric monocore probes (PMC probes)
Genetic Analysis: Biomolecular Engineering 15 (1999) 19 – 24
The properties of human DNA fingerprints produced by polymeric monocore probes (PMC probes) S.A. Limborska a,*, M.I. Prosnyak a, T.N. Bocharova a, E.M. Smirnova a, A.P. Ryskov b a
Institute of Molecular Genetics, Russian Academy of Sciences, Kurchato6 Sq., 123182 Moscow, Russia Institute of Gene Biology, Russian Academy of Sciences, 34 /5 Va6ilo6 Str., 117984 Moscow, Russia
b
Received 30 July 1998; accepted 15 August 1998
Abstract The properties of human DNA fingerprints detected by multilocus polymeric monocore probes (PMC probes) have been investigated. The PMC probes were produced by the polymerase chain reaction with two partly complementary oligonucleotides homologous to various minisatellite or microsatellite core sequences (Ijdo J, Wells RA, Baldini A, Reeders ST. Nucleic Acids Res 1991;19:4780). It has been shown that these probes possess increased sensitivity, they detect considerably more hypervariable fragments in genomic DNA thus exhibiting advantages over the corresponding oligonucleotides and natural polycore minisatellite probes. Variation in the DNA fingerprints of different individuals produced by these probes indicates that the probability of accidental identity is very low ( B10 − 12). According to the data of cross-hybridization with PMC probes of various specificity, several distinct families can be distinguished among G-rich hypervariable sequences of the human genome. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Human genome; DNA fingerprinting; Hypervariable sequences; Minisatellites and microsatellites; Polymeric monocore (PMC) probes
1. Introduction The most polymorphic loci known in the human genome are tandemly repeated minisatellites (ms) and microsatellites (mcs), hundreds of which have been described and mapped. These highly variable loci appear to be ubiquitous in eukaryotic genomes, which stimulated the wide use of the DNA fingerprinting technique [1,2] for many organisms and in many different fields, such as population genetics, evolutionary biology, plant and animal breeding, and forensic and legal medicine [3–5]. Cloned ms and mcs as well as synthetic oligonucleotides have been widely used as hybridization probes in multilocus DNA fingerprinting * Corresponding author. Tel.: +7 95 1960003; fax: + 7 95 1960221; e-mail: [email protected]
[6–11]. Oligonucleotide probes, being very convenient, are less sensitive in comparison with long chains of cloned ms and mcs. Recently we have demonstrated that chemically modified oligonucleotides with an increased duplex stability are advantageous in their use in eDNA fingerprinting [12]. Here we describe the characteristics of oligonucleotide based polymeric monocore probes (PMC probes) and their use in the DNA fingerprinting technique.
2. Materials and methods
2.1. Synthesis of PMC probes PMC probes were generated by the polymerase chain reaction from a few nanograms of partly complemen-
1050-3862/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII S1050-3862(98)00011-4
20
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
Table 1 The list of probes developed and tested in DNA fingerprinting Probes
Oligonucleotides used in PCR (5%3%)
Core sequences
CA PMC
A: CACACACACACACACACACACACA B: GTGTGTGTGTGTGTGTGTGTGTGT A: AATAATAATAATAATAATAATAATAATAAT B: ATTATTATTATTATTATTATTATTATTATT A: GCTGCTGCTGCTGCTGCTGCTGCT B: AGCAGCAGCAGCAGCAGCAGCAGCAGCAG A: TCCTCCTCCTCCTCCTCCTCCTCCTCC B: GGAGGAGGAGGAGGAGGAGGAGGAGGA A: CACCACCACCACCACCACCACCACCAC B: GTGGTGGTGGTGGTGGTGGTGGTGG A: GGTGGGGTGGGGTGGGGTGGGGTGG B: CCACCCCACCCCACCCCACCCCACC A: GAGGGCGAGGGCGAGGGCGAGGGAGAGG B: GCCCTCTCCCTCGCCCTCGCCCTCGCCC A:TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG B: CCCTAACCCTAACCCTAACCCTAACCCTAA A: CCATCCCCATCCCCATCCCCATCCCC B: GGATGGGGATGGGGATGGGGATGGGG A: GGAGGTGGGCAGGAAGGGAGGTGGGC B: CTTCCTGCCCACCTCCCTTCCTGCCC A: CCACCTGCCCACCTCTCCACCTGCC B: AGAGGTGGGCAGGTGGAGAGGTGGG A: AGCGCTGGAGGAGGGCTGGAGGAGGGCTGG B: CCTCCAGCCCTCCTAGCCCTCCTCCTCCAGCC A: AGAGCCACCACCCTCAGAGCCACC B: GAGGGTGGTGGCTCTGAGGGTGGTGG A: GCTGGTGGGCTGGTGGGCTGGTGG B: CCACCAGCCCACCAGCCCACCAGC
CA
AAT PMC GCT PMC TCC PMC CAC PMC GGTGG PMC GAGGGC PMC TTAGGG PMC C25 PMC Myocore PMC 33.15 PMC 33.6 PMC M13 PMC Chi PMC
AAT GCT TCC CAC
GGTGG GAGGGC TTAGGG GGATGG GGAGGTGGGCAGGAAG AGAGGTGGGCAGGTGG AGGGCTGGAGG
GAGGGTGGTGGCTCT GCTGGTGG
tary oligonucleotides (see Table 1) as previously described [13]. Each PCR mixture contained 10 ng of each oligonucleotide, 200 mM dNTP and 5 ml of 10× PCR buffer (Biomaster, Moscow). The samples were amplified in an Perkin-Elmer thermocycler (Perkin-Emler/ Cetus) for 30–40 cycles consisting of denaturation at 94°C (1 min), annealing at 50 – 55°C (1 min), and extension at 72°C (2 min). Two units of Taq polymerase were added at the beginning and at mid-run. The final extension step was for 10 min. PMC products were purified on Sephadex G-50 (Pharmacia) columns, labeled with [a 32P] dATP or [a 33P] dATP by the random priming method of Feinberg and Vogelstein [14], denatured and used for hybridization.
2.2. DNA isolation, digestion with restriction endonucleases, electrophoresis and Southern blot hybridization Fresh whole blood samples were collected by venipuncture from human unrelated individuals. High molecular weight DNA samples were prepared from blood as described elsewhere [12]. The DNA was digested overnight with a fivefold excess of BspRI endonuclease. The digested DNA was fractionated by
Fig. 1. DNA fingerprints of unrelated human individuals produced by M13 phage DNA (lanes 1 – 9) and M13 PMC (lanes 10 – 18) probes. Two identical blot filters were used in hybridizations. HindIII digested l phage DNA was used as a molecular weight marker.
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
21
Fig. 2. DNA fingerprints of unrelated human individuals produced by [32P] M13 phage DNA (lanes 1 – 12) and [33P] Chi PMC (lanes 13–24) probes. Two identical blot filters were used in hybridizations.
electrophoresis through a 30-cm-long, 0.8% agarose gel. Usually 5–6 mg of genomic DNA was loaded per lane. 32 P-labeled HindIII l phage DNA fragments were used as molecular weight markers. After electrophoresis the DNA was Southern-blotted onto Hybond-C nitrocellulose membranes (0.45 mm, Amersham). Prehybridization was carried out overnight at 42°C in 5 × SSC, 5× Denhardt’s solution, 1% SDS, 1 mM EDTA. The membranes were hybridized overnight at 60°C in 5 ml of the same buffer supplemented with 106 cpm/ml of 32 P- or 33P-labeled PMC probes. The probe solution was denatured by heating at 100°C for 3 min, placed on ice for 5 min and then added to the hybridization solution. After hybridization, the membranes were washed at room temperature in 2 × SSC, 0.2% SDS for 15 min at 60°C (2× 300 ml). A final wash was carried out in 1 × SSC, 0.2% SDS at 60°C. The membranes were then rinsed in 1× SSC and air dried prior to autoradiography. The autoradiographs were exposed at room temperature without intensifying screens. Several exposures varying from 1 to 10 days were made for each membrane to score accurately bands of different intensity. For reprobing the membranes were washed in a shaker water bath for 15 min at 95°C in distilled water containing 0.1% SDS.
2.3. Statistical analysis For each autoradiograph all bands in the size range of 2–20 kb were scored and analyzed. Comigration of DNA fragments of the same molecular mass was considered to take place when the difference in the mobility of the fragments was B 1 mm in two or more duplicate autoradiograms. The mean probability that a fragment in one individual is matched by a band of similar electrophoretic mobility and autoradiographic intensity in a second random person is defined as x. Since almost all fragments are inherited independently, the maximum probability that all n fragments in one individual are present in a second random individual is therefore x n. If coinciding bands always represent identical alleles of the same hypervariable locus, then, assuming that all alleles have equal frequencies, x is related to the allele frequency q as x =2q− q 2. 3. Results
3.1. Synthesis of polymeric monocore (PMC) probes PMC probes were produced by the polymerase chain reaction with two partly complementary oligonucle-
22
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
otides homologous to various minisatellite or microsatellite core sequences as described [13]. PCR was carried out in the absence of template using primers listed in Table 1. Staggerd annealing of the primers provides a single strand template for extension by Taq polymerase. The primers serve as template in the early PCR cycles whereas the newly formed templates serve as primer and template in subsequent stages of the PCR [13]. The synthesized polymeric DNA was heterogeneous in size (from 0.5 up to 10 kb) with a peak value about 3 kb. Small amounts of each probe were labeled with 32P or 33P in a multiprime Klenov reaction and used for hybridization.
3.2. The properties of DNA fingerprints produced by PMC probes
Fig. 3. DNA fingerprints of unrelated human individuals produced by [32P] M13 phage DNA (lanes 1–8) and [33P] 33.6 PMC (lanes 9 – 16) probes.
Fig. 1 shows the results of blot hybridization of human genomic DNA (nine unrelated individuals) with M13 phage DNA (natural polycore probe, lanes 1–9) and M13 PMC probe (synthetic monocore probe, lanes 10–18). The PMC probe hybridized significantly more effectively in comparison with the M13 phage DNA. The latter needs a ten times longer autoradiographic exposure to obtain hybridization intensities similar to those with the M13 PMC probe. An increased sensitiv-
Fig. 4. Application of different PMC probes for DNA fingerprinting. Each blot filter contained two DNA samples of unrelated human individuals. 1, CA PMC; 2, AAT PMC; 3, GCT PMC; 4, TCC PMC; 5, CAC PMC; 6, GGTGG PMC; 7, TTAGGG PMC; 8, C25 PMC; 9, GAGGGC PMC; 10, Myocore PMC; 11, Chi PMC; 12, 33.6 PMC; 13, M13 PMC and 14, 33.15 PMC.
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
23
Table 2 Analysis of DNA fingerprints in random pairs of individuals Probe
DNA fragment size (kb)
M13 phage DNA 9–23 6–9 4–6 2–4 M13 PMC 9–23 6–9 4–6 Chi PMC 9–23 6–9 4–6
No. of fragments per individual ( 9 S.D.)
Probability (x) that fragment in A is present in Ba
Maximum mean Mean level of band frequency heterozygosity
0.1 9 0.09 0.3 9 0.43 3.19 0.72 7.29 2.13 3.3 9 0.79 3.49 1.24 6.5 9 0.90 3.49 0.79 3.59 1.09 6.99 0.88
0.003 0.075 0.153 0.202 0.118 0.200 0.217 0.117 0.192 0.207
0.002 0.038 0.079 0.107 0.061 0.106 0.115 0.060 0.101 0.110
0.999 0.905 0.959 0.944 0.969 0.944 0.939 0.969 0.947 0.942
a
Calculated as the average of all pairwise comparisons D AB =2×no. shared fragments/(no. fragmentsA+no. fragmentsB). S.D., standard deviations.
ity of PMC probes was also obtained with other tandemly repeated motifs (CAC, TCC, 33.6, 33.15, Chi-like). Besides having a high sensitivity, PMC probes detect some additional polymorphic fragments mainly in the 9–23 kb zone of DNA fingerprint patterns (Fig. 1, lanes 10 – 18). This results in an increased individual specificity of such DNA fingerprints, which directly correlates with the number of hybridizing fragments. Fig. 2 shows DNA fingerprints obtained with M13 phage DNA and its another synthetic analog, Chi PMC probe. It is seen that the 33P-labeled Chi PMC probe can generate because of its high sensitivity DNA fingerprint patterns comparable in their intensity with those obtained with [32P] M13 phage DNA. In this case, the hybridization picture is more clear-cut, providing very high resolution patterns and thus improving the information content of DNA fingerprints. Similar properties are characteristic of the 33.6 PMC probe which is a synthetic analog of the polycore Jeffreys’ 33.6 minisatellite probe (Fig. 3). Fig. 4 shows the application of many other PMC probes listed in Table 1 for DNA fingerprinting. It is evident that some probes generate highly informative and polymorphic patterns (lanes 4, 5, 11 – 14) thus
having advantages over all other tested probes. To determine whether these PMC probes can identify different sets of hypervariable loci, all hybridizations were performed with the same samples of unrelated human DNA. It was found that some probes detected highly overlapping sets of DNA fragments and others were more specific (data not shown). According to this criterion, M13 phage DNA, M13 PMC, Chi PMC, CCACC PMC produce similar, significantly overlapping, DNA fingerprints (up to 90% of cross-hybridizing fragments). In contrast, the probes 33.6 PMC, 33.15 PMC generate different sets of hybridizing bands (cross-hybridization of each with Chi PMC was about 10 and 25%, respectively). Some statistical characteristics estimated for DNA fragments hybridizing with Chi-like probes (M13 phage DNA, M13 PMC, Chi PMC) are shown in Table 2. One can see that very similar values of allelic frequencies and heterozygosity for all DNA fingerprint fragments were obtained. Table 3 provides statistical characteristics of most valuable probes based on DNA fingerprinting analysis of 20 unrelated human individuals. It is evident that PMC probes, especially Chi PMC, possess increased individual specificity and therefore can be effectively applied for segregation and identification analysis.
Table 3 Estimation of individual specificity of DNA fingerprints obtained by hybridization with different PMC probes Probe
DNA fragment size (kb)
M13 phage DNA 2–9 M13 PMC 4–9 Chi PMC 4–9 33.15 PMC 4–9 33.6 PMC 4–9 CAC PMC 4–9
No. of fragments per individual (9 S.D.)
Mean bandsharing frequency
Probability that all bands A are present in B
129 2.3 17.1 9 1.9 18.991.7 17.4 9 1.3 14.8 9 1.7 17.99 1.3
0.15 0.19 0.18 0.20 0.16 0.19
1.3×10−10 4.6×10−13 8.4×10−15 6.9×10−13 1.7×10−12 1.2×10−13
All calculations are based on the analysis of DNA fingerprints of 20 unrelated human individuals.
24
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
4. Discussion The results obtained in this study suggest that PMC probes can be effectively used in multilocus DNA fingerprinting. They possess increased sensitivity and thus can detect considerably more hypervariable fragments in genomic DNA in comparison with corresponding oligonucleotides and natural polycore minisatellites such as M13-ms and Jeffreys’-ms. As a result, these probes provide an increased information content in individual DNA fingerprints, and it means that they have a changed DNA fingerprint specificity. Differences in hybridization properties between PMS probes and related polycore ms probes are explained by the fact that noncore sequences in polycore monomers can impede cross-hybridization reducing the band number on Southern blots. High sensitivity of PMC probes allows their use in 33P-labeled form significantly improving the information content of DNA fingerprints. Under standard hybridization conditions such probes reveal over 30 DNA fragments in the area of 2 – 23 kb. Estimation of individual specificity of DNA fingerprints based on only 15–19 fragments in the 4 – 9 kb zone of the gel (Table 3) gave the probability values from 10 − 12 to 10 − 15 depending on the probes used. These values can be increased using for hybridization two or several probes that identify different hypervariable loci. Our data suggest that the most suitable probes for this might be Chi PMC, 33.6 PMC and 33.15 PMC. All other probes studied (including M13 PMC, CAC PMC, CCACC PMC) detected overlapping, Chi-type sets of DNA fragments. Thus, among G-rich hypervariable sequences with an almost invariant motif G---TGGG [15] several distinct types can be distinguished.
complementary oligonucleotides of various G-rich core specificity. The PMC probes possess increased sensitivity and can detect considerably more hypervariable loci in genomic DNA providing advantages over homologous oligonucleotides and natural polycore minisatellite probes.
Acknowledgements We thank Prof. E.D. Sverdlov for helpful discussions. This work was partly supported by grants from the Russian Basic Research Foundation (N 96-04488808, N 98-21198-04), Human Genome (N 19/98), Frontiers in Genetics (N 098a, N 122/3), Biodiversity (N 41) programs.
References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12]
[13]
5. Conclusion A number of long monocore polymeric sequences (PMC probes) were synthesized using PCR with partly
[14] [15]
Jeffreys AJ, Wilson V, Thein SL. Nature 1985;314:67 –73. Jeffreys AJ, Wilson V, Thein SL. Nature 1985;316:76 –9. Jeffreys AJ. Biochem Soc Trans 1987;15:309 – 17. Ryskov AP, Jincharadze AG, Prosnyak MI, Ivanov PL, Limborska SA. FEBS Lett 1988;233:388 – 92. Ryskov AP, Gordon IO. Biotechnology (Russia) 1992;3:3–12. Ali S, Muller CR, Epplen JT. Hum Genet 1986;74:239–43. Schafer R, Zischler H, Epplen JT. Nucleic Acids Res 1988;16:5196. Tautz D. Nucleic Acids Res 1989;17:6463 – 71. Wells RA, Green P, Reeders ST. Genomics 1989;5:761–72. Zischler H, Kammerbauer C, Studer R, Grzeschik K-H, Epplen JT. Genomics 1992;13:983 – 90. Hundrieser J, Nurnberg P, Czeizel AE, Metneki J, Rothganger S, Zischler H, Epplen JT. Hum Genet 1992;90:27 – 33. Prosnyak MI, Veselovskaya SI, Myasnikov VA, Efremova EJ, Potapov VK, Limborska SA, Sverdlov ED. Genomics 1994;21:490 – 4. Ijdo JW, Wells RA, Baldini A, Reeders ST. Nucleic Acids Res 1991;19:4780. Feinberg AP, Vogelstein B. Anal Biochem 1983;132:6 –13. Nakamura Y, Leppert M, O’Connell P, Wolff R, Holm T, Culver M, Martin C, Fujimoto E, Hoff M, Kumlin E, White R. Science 1987;235:1616– 22.
. .
The properties of human DNA fingerprints produced by polymeric monocore probes (PMC probes) S.A. Limborska a,*, M.I. Prosnyak a, T.N. Bocharova a, E.M. Smirnova a, A.P. Ryskov b a
Institute of Molecular Genetics, Russian Academy of Sciences, Kurchato6 Sq., 123182 Moscow, Russia Institute of Gene Biology, Russian Academy of Sciences, 34 /5 Va6ilo6 Str., 117984 Moscow, Russia
b
Received 30 July 1998; accepted 15 August 1998
Abstract The properties of human DNA fingerprints detected by multilocus polymeric monocore probes (PMC probes) have been investigated. The PMC probes were produced by the polymerase chain reaction with two partly complementary oligonucleotides homologous to various minisatellite or microsatellite core sequences (Ijdo J, Wells RA, Baldini A, Reeders ST. Nucleic Acids Res 1991;19:4780). It has been shown that these probes possess increased sensitivity, they detect considerably more hypervariable fragments in genomic DNA thus exhibiting advantages over the corresponding oligonucleotides and natural polycore minisatellite probes. Variation in the DNA fingerprints of different individuals produced by these probes indicates that the probability of accidental identity is very low ( B10 − 12). According to the data of cross-hybridization with PMC probes of various specificity, several distinct families can be distinguished among G-rich hypervariable sequences of the human genome. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Human genome; DNA fingerprinting; Hypervariable sequences; Minisatellites and microsatellites; Polymeric monocore (PMC) probes
1. Introduction The most polymorphic loci known in the human genome are tandemly repeated minisatellites (ms) and microsatellites (mcs), hundreds of which have been described and mapped. These highly variable loci appear to be ubiquitous in eukaryotic genomes, which stimulated the wide use of the DNA fingerprinting technique [1,2] for many organisms and in many different fields, such as population genetics, evolutionary biology, plant and animal breeding, and forensic and legal medicine [3–5]. Cloned ms and mcs as well as synthetic oligonucleotides have been widely used as hybridization probes in multilocus DNA fingerprinting * Corresponding author. Tel.: +7 95 1960003; fax: + 7 95 1960221; e-mail: [email protected]
[6–11]. Oligonucleotide probes, being very convenient, are less sensitive in comparison with long chains of cloned ms and mcs. Recently we have demonstrated that chemically modified oligonucleotides with an increased duplex stability are advantageous in their use in eDNA fingerprinting [12]. Here we describe the characteristics of oligonucleotide based polymeric monocore probes (PMC probes) and their use in the DNA fingerprinting technique.
2. Materials and methods
2.1. Synthesis of PMC probes PMC probes were generated by the polymerase chain reaction from a few nanograms of partly complemen-
1050-3862/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII S1050-3862(98)00011-4
20
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
Table 1 The list of probes developed and tested in DNA fingerprinting Probes
Oligonucleotides used in PCR (5%3%)
Core sequences
CA PMC
A: CACACACACACACACACACACACA B: GTGTGTGTGTGTGTGTGTGTGTGT A: AATAATAATAATAATAATAATAATAATAAT B: ATTATTATTATTATTATTATTATTATTATT A: GCTGCTGCTGCTGCTGCTGCTGCT B: AGCAGCAGCAGCAGCAGCAGCAGCAGCAG A: TCCTCCTCCTCCTCCTCCTCCTCCTCC B: GGAGGAGGAGGAGGAGGAGGAGGAGGA A: CACCACCACCACCACCACCACCACCAC B: GTGGTGGTGGTGGTGGTGGTGGTGG A: GGTGGGGTGGGGTGGGGTGGGGTGG B: CCACCCCACCCCACCCCACCCCACC A: GAGGGCGAGGGCGAGGGCGAGGGAGAGG B: GCCCTCTCCCTCGCCCTCGCCCTCGCCC A:TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG B: CCCTAACCCTAACCCTAACCCTAACCCTAA A: CCATCCCCATCCCCATCCCCATCCCC B: GGATGGGGATGGGGATGGGGATGGGG A: GGAGGTGGGCAGGAAGGGAGGTGGGC B: CTTCCTGCCCACCTCCCTTCCTGCCC A: CCACCTGCCCACCTCTCCACCTGCC B: AGAGGTGGGCAGGTGGAGAGGTGGG A: AGCGCTGGAGGAGGGCTGGAGGAGGGCTGG B: CCTCCAGCCCTCCTAGCCCTCCTCCTCCAGCC A: AGAGCCACCACCCTCAGAGCCACC B: GAGGGTGGTGGCTCTGAGGGTGGTGG A: GCTGGTGGGCTGGTGGGCTGGTGG B: CCACCAGCCCACCAGCCCACCAGC
CA
AAT PMC GCT PMC TCC PMC CAC PMC GGTGG PMC GAGGGC PMC TTAGGG PMC C25 PMC Myocore PMC 33.15 PMC 33.6 PMC M13 PMC Chi PMC
AAT GCT TCC CAC
GGTGG GAGGGC TTAGGG GGATGG GGAGGTGGGCAGGAAG AGAGGTGGGCAGGTGG AGGGCTGGAGG
GAGGGTGGTGGCTCT GCTGGTGG
tary oligonucleotides (see Table 1) as previously described [13]. Each PCR mixture contained 10 ng of each oligonucleotide, 200 mM dNTP and 5 ml of 10× PCR buffer (Biomaster, Moscow). The samples were amplified in an Perkin-Elmer thermocycler (Perkin-Emler/ Cetus) for 30–40 cycles consisting of denaturation at 94°C (1 min), annealing at 50 – 55°C (1 min), and extension at 72°C (2 min). Two units of Taq polymerase were added at the beginning and at mid-run. The final extension step was for 10 min. PMC products were purified on Sephadex G-50 (Pharmacia) columns, labeled with [a 32P] dATP or [a 33P] dATP by the random priming method of Feinberg and Vogelstein [14], denatured and used for hybridization.
2.2. DNA isolation, digestion with restriction endonucleases, electrophoresis and Southern blot hybridization Fresh whole blood samples were collected by venipuncture from human unrelated individuals. High molecular weight DNA samples were prepared from blood as described elsewhere [12]. The DNA was digested overnight with a fivefold excess of BspRI endonuclease. The digested DNA was fractionated by
Fig. 1. DNA fingerprints of unrelated human individuals produced by M13 phage DNA (lanes 1 – 9) and M13 PMC (lanes 10 – 18) probes. Two identical blot filters were used in hybridizations. HindIII digested l phage DNA was used as a molecular weight marker.
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
21
Fig. 2. DNA fingerprints of unrelated human individuals produced by [32P] M13 phage DNA (lanes 1 – 12) and [33P] Chi PMC (lanes 13–24) probes. Two identical blot filters were used in hybridizations.
electrophoresis through a 30-cm-long, 0.8% agarose gel. Usually 5–6 mg of genomic DNA was loaded per lane. 32 P-labeled HindIII l phage DNA fragments were used as molecular weight markers. After electrophoresis the DNA was Southern-blotted onto Hybond-C nitrocellulose membranes (0.45 mm, Amersham). Prehybridization was carried out overnight at 42°C in 5 × SSC, 5× Denhardt’s solution, 1% SDS, 1 mM EDTA. The membranes were hybridized overnight at 60°C in 5 ml of the same buffer supplemented with 106 cpm/ml of 32 P- or 33P-labeled PMC probes. The probe solution was denatured by heating at 100°C for 3 min, placed on ice for 5 min and then added to the hybridization solution. After hybridization, the membranes were washed at room temperature in 2 × SSC, 0.2% SDS for 15 min at 60°C (2× 300 ml). A final wash was carried out in 1 × SSC, 0.2% SDS at 60°C. The membranes were then rinsed in 1× SSC and air dried prior to autoradiography. The autoradiographs were exposed at room temperature without intensifying screens. Several exposures varying from 1 to 10 days were made for each membrane to score accurately bands of different intensity. For reprobing the membranes were washed in a shaker water bath for 15 min at 95°C in distilled water containing 0.1% SDS.
2.3. Statistical analysis For each autoradiograph all bands in the size range of 2–20 kb were scored and analyzed. Comigration of DNA fragments of the same molecular mass was considered to take place when the difference in the mobility of the fragments was B 1 mm in two or more duplicate autoradiograms. The mean probability that a fragment in one individual is matched by a band of similar electrophoretic mobility and autoradiographic intensity in a second random person is defined as x. Since almost all fragments are inherited independently, the maximum probability that all n fragments in one individual are present in a second random individual is therefore x n. If coinciding bands always represent identical alleles of the same hypervariable locus, then, assuming that all alleles have equal frequencies, x is related to the allele frequency q as x =2q− q 2. 3. Results
3.1. Synthesis of polymeric monocore (PMC) probes PMC probes were produced by the polymerase chain reaction with two partly complementary oligonucle-
22
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
otides homologous to various minisatellite or microsatellite core sequences as described [13]. PCR was carried out in the absence of template using primers listed in Table 1. Staggerd annealing of the primers provides a single strand template for extension by Taq polymerase. The primers serve as template in the early PCR cycles whereas the newly formed templates serve as primer and template in subsequent stages of the PCR [13]. The synthesized polymeric DNA was heterogeneous in size (from 0.5 up to 10 kb) with a peak value about 3 kb. Small amounts of each probe were labeled with 32P or 33P in a multiprime Klenov reaction and used for hybridization.
3.2. The properties of DNA fingerprints produced by PMC probes
Fig. 3. DNA fingerprints of unrelated human individuals produced by [32P] M13 phage DNA (lanes 1–8) and [33P] 33.6 PMC (lanes 9 – 16) probes.
Fig. 1 shows the results of blot hybridization of human genomic DNA (nine unrelated individuals) with M13 phage DNA (natural polycore probe, lanes 1–9) and M13 PMC probe (synthetic monocore probe, lanes 10–18). The PMC probe hybridized significantly more effectively in comparison with the M13 phage DNA. The latter needs a ten times longer autoradiographic exposure to obtain hybridization intensities similar to those with the M13 PMC probe. An increased sensitiv-
Fig. 4. Application of different PMC probes for DNA fingerprinting. Each blot filter contained two DNA samples of unrelated human individuals. 1, CA PMC; 2, AAT PMC; 3, GCT PMC; 4, TCC PMC; 5, CAC PMC; 6, GGTGG PMC; 7, TTAGGG PMC; 8, C25 PMC; 9, GAGGGC PMC; 10, Myocore PMC; 11, Chi PMC; 12, 33.6 PMC; 13, M13 PMC and 14, 33.15 PMC.
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
23
Table 2 Analysis of DNA fingerprints in random pairs of individuals Probe
DNA fragment size (kb)
M13 phage DNA 9–23 6–9 4–6 2–4 M13 PMC 9–23 6–9 4–6 Chi PMC 9–23 6–9 4–6
No. of fragments per individual ( 9 S.D.)
Probability (x) that fragment in A is present in Ba
Maximum mean Mean level of band frequency heterozygosity
0.1 9 0.09 0.3 9 0.43 3.19 0.72 7.29 2.13 3.3 9 0.79 3.49 1.24 6.5 9 0.90 3.49 0.79 3.59 1.09 6.99 0.88
0.003 0.075 0.153 0.202 0.118 0.200 0.217 0.117 0.192 0.207
0.002 0.038 0.079 0.107 0.061 0.106 0.115 0.060 0.101 0.110
0.999 0.905 0.959 0.944 0.969 0.944 0.939 0.969 0.947 0.942
a
Calculated as the average of all pairwise comparisons D AB =2×no. shared fragments/(no. fragmentsA+no. fragmentsB). S.D., standard deviations.
ity of PMC probes was also obtained with other tandemly repeated motifs (CAC, TCC, 33.6, 33.15, Chi-like). Besides having a high sensitivity, PMC probes detect some additional polymorphic fragments mainly in the 9–23 kb zone of DNA fingerprint patterns (Fig. 1, lanes 10 – 18). This results in an increased individual specificity of such DNA fingerprints, which directly correlates with the number of hybridizing fragments. Fig. 2 shows DNA fingerprints obtained with M13 phage DNA and its another synthetic analog, Chi PMC probe. It is seen that the 33P-labeled Chi PMC probe can generate because of its high sensitivity DNA fingerprint patterns comparable in their intensity with those obtained with [32P] M13 phage DNA. In this case, the hybridization picture is more clear-cut, providing very high resolution patterns and thus improving the information content of DNA fingerprints. Similar properties are characteristic of the 33.6 PMC probe which is a synthetic analog of the polycore Jeffreys’ 33.6 minisatellite probe (Fig. 3). Fig. 4 shows the application of many other PMC probes listed in Table 1 for DNA fingerprinting. It is evident that some probes generate highly informative and polymorphic patterns (lanes 4, 5, 11 – 14) thus
having advantages over all other tested probes. To determine whether these PMC probes can identify different sets of hypervariable loci, all hybridizations were performed with the same samples of unrelated human DNA. It was found that some probes detected highly overlapping sets of DNA fragments and others were more specific (data not shown). According to this criterion, M13 phage DNA, M13 PMC, Chi PMC, CCACC PMC produce similar, significantly overlapping, DNA fingerprints (up to 90% of cross-hybridizing fragments). In contrast, the probes 33.6 PMC, 33.15 PMC generate different sets of hybridizing bands (cross-hybridization of each with Chi PMC was about 10 and 25%, respectively). Some statistical characteristics estimated for DNA fragments hybridizing with Chi-like probes (M13 phage DNA, M13 PMC, Chi PMC) are shown in Table 2. One can see that very similar values of allelic frequencies and heterozygosity for all DNA fingerprint fragments were obtained. Table 3 provides statistical characteristics of most valuable probes based on DNA fingerprinting analysis of 20 unrelated human individuals. It is evident that PMC probes, especially Chi PMC, possess increased individual specificity and therefore can be effectively applied for segregation and identification analysis.
Table 3 Estimation of individual specificity of DNA fingerprints obtained by hybridization with different PMC probes Probe
DNA fragment size (kb)
M13 phage DNA 2–9 M13 PMC 4–9 Chi PMC 4–9 33.15 PMC 4–9 33.6 PMC 4–9 CAC PMC 4–9
No. of fragments per individual (9 S.D.)
Mean bandsharing frequency
Probability that all bands A are present in B
129 2.3 17.1 9 1.9 18.991.7 17.4 9 1.3 14.8 9 1.7 17.99 1.3
0.15 0.19 0.18 0.20 0.16 0.19
1.3×10−10 4.6×10−13 8.4×10−15 6.9×10−13 1.7×10−12 1.2×10−13
All calculations are based on the analysis of DNA fingerprints of 20 unrelated human individuals.
24
S.A. Limborska et al. / Genetic Analysis: Biomolecular Engineering 15 (1999) 19–24
4. Discussion The results obtained in this study suggest that PMC probes can be effectively used in multilocus DNA fingerprinting. They possess increased sensitivity and thus can detect considerably more hypervariable fragments in genomic DNA in comparison with corresponding oligonucleotides and natural polycore minisatellites such as M13-ms and Jeffreys’-ms. As a result, these probes provide an increased information content in individual DNA fingerprints, and it means that they have a changed DNA fingerprint specificity. Differences in hybridization properties between PMS probes and related polycore ms probes are explained by the fact that noncore sequences in polycore monomers can impede cross-hybridization reducing the band number on Southern blots. High sensitivity of PMC probes allows their use in 33P-labeled form significantly improving the information content of DNA fingerprints. Under standard hybridization conditions such probes reveal over 30 DNA fragments in the area of 2 – 23 kb. Estimation of individual specificity of DNA fingerprints based on only 15–19 fragments in the 4 – 9 kb zone of the gel (Table 3) gave the probability values from 10 − 12 to 10 − 15 depending on the probes used. These values can be increased using for hybridization two or several probes that identify different hypervariable loci. Our data suggest that the most suitable probes for this might be Chi PMC, 33.6 PMC and 33.15 PMC. All other probes studied (including M13 PMC, CAC PMC, CCACC PMC) detected overlapping, Chi-type sets of DNA fragments. Thus, among G-rich hypervariable sequences with an almost invariant motif G---TGGG [15] several distinct types can be distinguished.
complementary oligonucleotides of various G-rich core specificity. The PMC probes possess increased sensitivity and can detect considerably more hypervariable loci in genomic DNA providing advantages over homologous oligonucleotides and natural polycore minisatellite probes.
Acknowledgements We thank Prof. E.D. Sverdlov for helpful discussions. This work was partly supported by grants from the Russian Basic Research Foundation (N 96-04488808, N 98-21198-04), Human Genome (N 19/98), Frontiers in Genetics (N 098a, N 122/3), Biodiversity (N 41) programs.
References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12]
[13]
5. Conclusion A number of long monocore polymeric sequences (PMC probes) were synthesized using PCR with partly
[14] [15]
Jeffreys AJ, Wilson V, Thein SL. Nature 1985;314:67 –73. Jeffreys AJ, Wilson V, Thein SL. Nature 1985;316:76 –9. Jeffreys AJ. Biochem Soc Trans 1987;15:309 – 17. Ryskov AP, Jincharadze AG, Prosnyak MI, Ivanov PL, Limborska SA. FEBS Lett 1988;233:388 – 92. Ryskov AP, Gordon IO. Biotechnology (Russia) 1992;3:3–12. Ali S, Muller CR, Epplen JT. Hum Genet 1986;74:239–43. Schafer R, Zischler H, Epplen JT. Nucleic Acids Res 1988;16:5196. Tautz D. Nucleic Acids Res 1989;17:6463 – 71. Wells RA, Green P, Reeders ST. Genomics 1989;5:761–72. Zischler H, Kammerbauer C, Studer R, Grzeschik K-H, Epplen JT. Genomics 1992;13:983 – 90. Hundrieser J, Nurnberg P, Czeizel AE, Metneki J, Rothganger S, Zischler H, Epplen JT. Hum Genet 1992;90:27 – 33. Prosnyak MI, Veselovskaya SI, Myasnikov VA, Efremova EJ, Potapov VK, Limborska SA, Sverdlov ED. Genomics 1994;21:490 – 4. Ijdo JW, Wells RA, Baldini A, Reeders ST. Nucleic Acids Res 1991;19:4780. Feinberg AP, Vogelstein B. Anal Biochem 1983;132:6 –13. Nakamura Y, Leppert M, O’Connell P, Wolff R, Holm T, Culver M, Martin C, Fujimoto E, Hoff M, Kumlin E, White R. Science 1987;235:1616– 22.
. .