- Email: [email protected]
The protective roles of mitochondrial ATP-sensitive potassium channels during hypoxia–ischemia–reperfusion in brain
Neuroscience Letters 491 (2011) 63–67
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
The protective roles of mitochondrial ATP-sensitive potassium channels during hypoxia–ischemia–reperfusion in brain Lin Wang a , Qing-Lei Zhu a,∗ , Guo-Zheng Wang b , Tian-Zheng Deng c , Rui Chen a , Mo-Han Liu a , Shi-Wen Wang a a b c
Institute of Geriatric Cardiology, Chinese PLA General Hospital, Fuxing Road 28, Beijing 100853, China The 117 Hospital of PLA, Hangzhou 310013, China General Hospital of the Air Force of the Chinese People’s Liberation Army, Beijing 100142, China
a r t i c l e
i n f o
Article history: Received 3 November 2010 Received in revised form 14 December 2010 Accepted 31 December 2010 Keywords: ATP sensitive potassium channel Hypoxia–ischemia–reperfusion Oxygen-glucose deprivation Pharmacologic preconditioning
a b s t r a c t The role of ATP-sensitive potassium (KATP ) channels in cerebral ischemia–reperfusion has been well documented. KATP channel openers protect neuron by mimicking ischemic preconditioning. However, the different protection between the mitochondrial and sarcolemma KATP openers has been seldom studied. In the experiment, we investigated the effects of KATP channel openers diazoxide and pinacidil on the hypoxia–ischemia–reperfusion in cultured hippocampal neurons and gerbil brain. The cultured hippocampal neurons and gerbil brain were pretreated with diazoxide or pinacidil before oxygen-glucose deprivation (OGD) and cerebral ischemia–reperfusion, respectively. Survival rate, apoptosis rate and lactate dehydrogenase (LDH) releasing after the reperfusion were subsequently detected. Then the subunits mRNA was detected by RT-PCR. The survival rate and LDH content in diazoxide group increased more than that in pinacidil group (86.21 ± 2.73% vs. 78.59 ± 1.94%, P < 0.05; 133.29 ± 15.00 U/L vs. 193.47 ± 3.39 U/L, P < 0.01). The apoptosis rate in diazoxide group decreased significantly more than that in pinacidil group (23.82 ± 0.14% vs. 37.05 ± 0.67%, P < 0.01). Diazoxide pretreatment increased the expression of Kir6.1 mRNA obviously. The results suggested that mitoKATP channels opener diazoxide played a major protective role on cerebral ischemia–reperfusion. Furthermore, diazoxide might become a new treatment for cerebral ischemia diseases through increasing the expression of Kir6.1 mRNA. Crown Copyright © 2011 Published by Elsevier Ireland Ltd. All rights reserved.
‘Ischemic tolerance’ is a phenomenon in which preconditioning with sublethal stresses or stimuli, such as brief ischemia, spreading depression, or pharmacological agents, can induce resistance to subsequent lethal ischemia [14]. Although the precise mechanism of ‘ischemic tolerance’ remains elusive, much attention has been focused on the potential role of ATP-sensitive potassium channels (KATP ) as the effectors of protection. There are two populations of KATP channels: the mitochondrial (mitoKATP ) channel locates in the inner mitochondrial membrane and the sarcolemmal (sarcKATP ) channel locates in the plasma membrane, which has different pharmacological and functional properties. KATP channels are formed as an octomeric complex of four por-forming Kir6.x and four sulphonylurea receptors. Two subunits of Kir (Kir6.1 and Kir6.2) and three subunits of SUR (SUR1, SUR2A, and SUR2B) have been identified [18]. It has been shown that Kir6.1 and SUR2 were enriched in rat brain mitochondria compared to whole brain [10]. Brain mitochondria contained seven times more mitoKATP channels than liver or heart mitochondria, which indicated the importance of these
∗ Corresponding author. Tel.: +86 10 66936762; fax: +86 10 68188906. E-mail addresses: [email protected], [email protected] (Q.-L. Zhu).
channels in neurons [2]. Selective opening of mitoKATP channels had neuroprotective effects against ischemia–reperfusion injury in the brain, activation of mitoKATP channels could protect neurons against injury and death [20]. However, the detailed effect of KATP channel openers and their antagonist on neuronal death and apoptosis in cerebral ischemia–reperfusion-induce injury has not been fully studied, and whether mitoKATP channels play a more important protective role than sarcKATP channels in the brain remains unclear. In this study, we observed the morphology of cultured neurons, evaluated the survival and apoptosis rates, determined LDH release, and compared expression of the mitoKATP channels subunits Kir6.1 in gerbils to discuss the protective roles of mitochondrial ATPsensitive potassium channels. Hippocampal neurons were cultured as described previously [4]. Cultures were maintained in a 5% CO2 atmosphere at 37 ◦ C, and incubated for 9–13 days. At least 90% neurons were observed by staining with neuron-specific enolase. The medium was thoroughly exchanged with deoxygenated, glucose-free Earle’s balanced salt solution (BSSo). Cultures were transferred to an anaerobic chamber containing 5% CO2 and 95% N2 for 4 h [12]. Oxygen-glucose deprivation was terminated by oxy-
0304-3940/$ – see front matter. Crown Copyright © 2011 Published by Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2010.12.065
64
L. Wang et al. / Neuroscience Letters 491 (2011) 63–67
Fig. 1. The experimental protocol. (A) The protocol for evaluation of the capacity of the KATP channel openers (diazoxide and pinacidil) and the KATP channel blockers (5HD and glibenclamide) to confer protection. (B) The protocol for the study of the effect of the KATP channel blockers, 5HD and glibenclamide, on the capacity of KATP channel openers (diazoxide and pinacidil) to induce protection.
genated neurobasal medium. Then cultures were returned to the normoxic incubator for 24 h. Male Mongolian gerbils weighing 50–70 g were used for animal models. Cerebral ischemia was induced by the method of Carroll and Beek [6]. All procedures were conducted in compliance with Regulations for the Administration of Affairs Concerning Experimental Animals. Both common carotid arteries were occluded for 10 min by means of micro-aneurysm clips. After clip removal for 60 min, gerbils were decapitated to get the brain tissues. Shamoperated animals received the same surgical procedure except the carotid arteries occluded. Neurons cultured were initially exposed to the KATP channel regulators for 15 min [diazoxide (D, 50 M); pinacidil (P, 50 M); 5hydroxydecanoate (5HD, 100 M); glibenclamide (G, 2 M); final concentration, prepared by addition of concentrated stock solutions, prepared in dimethyl sulphoxide (DMSO)/ethanol mixed liquor, to 1 ml fresh culture medium] (Fig. 1A). Vehicle of the drugs (1% DMSO) had no effect on neuron. The KATP channel blockers were given 15 min before the KATP channel openers were administered (Fig. 1B). Control cultures were incubated for 15 min in regular medium [17]. In gerbils, diazoxide (40 mg/kg) and pinacidil (40 mg/kg) were given intraperitoneally (i.p.), 30 min before global cerebral ischemia, 5HD (40 mg/kg) and glibenclamide (0.1 mg/kg) were given 15 min before the openers administered. Sham-operated group and ischemia–reperfusion group were given normal saline. The survival rate was assessed by the Trypan blue exclusion test [7]. The percentage of injured (dead) cells was determined under an inverted phase contrast microscope (200× magnification). The apoptosis rate was detected by Flow Cytometer (FCM). Analysis was performed using dual staining with annexin V and propidium iodide [19]. The apoptosis morphology of cultured neurons was assessed by Hoechst 33342 for 15 min at 37 ◦ C. Cell viability was measured by the LDH release assay, which was based on measurement of LDH activity in culture medium. Standard techniques using commercialized assay kits according to the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, China) were performed for analyses. After killing the gerbils, the brain tissues were rapidly removed and flash-frozen in liquid N2 to avoid RNA degradation. Then the tissues were homogenized, and total RNA was prepared using a guanidine thiocyanate method (Trizol solution). The primers had the following sequences. Kir6.1: up5 -ACCAGAATTCTCTGCGGAAG, low GCCCTGAACTGGTGATGAGT, amplicon size 297 bp; SUR1: up5 GGAGCAATCCAGACCAAGAT, low AGCCAGCAGAATGATGACAG, amplicon size 249 bp; SUR2: up5 -CCATCATCAGTGTTCAAAAGC, low GGCTGCTTCCTGTTTATTGG, amplicon size 148 bp; -actin: up5 -AAGTACCCCATTGAACACGG, low ATCACAATGCCAGTGGTACG, amplicon size 257 bp. -Actin was used as a standard for constitutive expression. The PCR products were analyzed by AlphaImager2200 after ethidium staining.
All values were expressed as mean ± SD. Data were analyzed using a one-way ANOVA. When the F value was significant, pairwise comparisons were made using Dunnet’s t test. A value of P < 0.05 was considered statistically significant. Exposure of the cultured neurons to the hypoxia–reperfusion (H–R) injury resulted in severe damage, including dendritic spine loss and diminished dendritic complexity. Decreased dendritic branches and spine density in D group were not much higher than that in P group. To assess the damage to the neurons, we stained them with Trypan blue exclusion test. Comparing with the control group (94.72 ± 2.28%), the survival rate in H–R group (72.09 ± 1.51%) and groups pretreated with regulators decreased significantly (P < 0.01). The survival rate in D group was higher than P group (86.21 ± 2.74% vs. 78.59 ± 1.94%, P < 0.05) (Fig. 2). It could be conclusion that diazoxide and pinacidil could protect neurons. The protective role of diazoxide was slightly better than pinacidil, and it could be blocked by adding the blocker 5HD and glibenclamide, respectively. We thought that the survival rate of KATP channel openers might increase through triggering an apoptosis pathway. The cultures were detected by Hoechst staining and FCM. In control group, neurons contained intact nuclei with well-preserved cell membranes. However, condensed nuclei and fragmented nuclei could be observed in H–R group and pretreated groups. Compared with the control group (12.40 ± 0.07%), the apoptosis rate in H–R group (49.51 ± 2.58%) and pretreated groups increased significantly (P < 0.01). We also found that the apoptosis rate in the D group and P group decreased to 23.82 ± 0.14% and 37.05 ± 0.67%, lower than H–R group (P < 0.01) (Fig. 2). And the diazoxide could not only reduce the apoptosis rate more extent, but also play a more significant role in protecting neuron than pinacidil. It was found that LDH content, used as detecting cell injury, had a similar trend to the apoptosis rate. LDH contents in H–R group and pretreated groups increased much more than those in control group (76.84 ± 10.53 U/L) (P < 0.01). Compared with the H–R group (255.45 ± 26.23 U/L), both the D and P groups were decreased (133.29 ± 15.00 U/L and 193.47 ± 3.39 U/L) (P < 0.01). The mitoKATP channel opener diazoxide resulted in lower LDH contents than KATP channel opener pinacidil, which indicated that opening the mitoKATP channel played a major neuroprotective role. The results indicated that the protected role of mitoKATP channel opener diazoxide was better than the sarcKATP channel opener pinacidil. We thought it might take effect through increasing the expression of subunits mRNA, which induced more KATP opening. To illustrate this, we experimented on gerbils’ brain undergoing the ischemia–reperfusion (I–R) insult. Compared with I–R group and P group, the expression of Kir6.1 mRNA in D group was increased obviously; whereas there was no difference between pretreated group and unpretreated group in the expression of SUR1 mRNA. It was also found that the expression of SUR2 mRNA was with a corresponding enhancement to damage between I–R group and pretreated groups; however, there was no difference between D group and P group (Figs. 3 and 4). Therefore, KATP openers might mainly act on Kir6.1mRNA to induce protective role. The major finding in this study was that both pretreatment with the mitoKATP channel opener diazoxide and the sarcKATP channel opener pinacidil had neuroprotective effects against hypoxia–reperfusion insults in cultured neurons. It was shown that the survival rate of neurons pretreated with diazoxide and pinacidil increased. Specifically, the mitoKATP channel opener diazoxide could distinctly reduce the apoptosis rate and LDH release in neurons. This protective role of diazoxide was rather obvious than pinacidil. Thus, the selective targeting of the mitoKATP channel appeared to lessen the impact of hypoxic–ischemic injury to neurons.
L. Wang et al. / Neuroscience Letters 491 (2011) 63–67
65
Fig. 2. (A) Effect of KATP channel regulators on the morphology of hippocampal neurons after H–R injury (200×). Decreased dendritic branches and spine density in D group were not much higher than that in P group. (B) Effect of KATP channel regulators on the survival rate of the hippocampal neurons after H–R injury. **P < 0.01, compared with control group; ## P < 0.01, compared with H–R group. Compared with H–R group, the survival rates of D and P groups were significantly increased (P < 0.01); the survival rate of D group was higher than P group (P < 0.05). These protective roles were blocked by 5HD and glibenclamide, respectively. H–R: hypoxia–reperfusion, D: diazoxide, 5HD: 5-hydroxydecanoate, P: pinacidil, and G: glibenclamide.
Initially, the cardioprotective effects of preconditioning were attributed to the sarcKATP channels; however, subsequent evidence suggested that mitoKATP channels rather than the sarcKATP channels played a more important role in cardioprotection [1]. During
Fig. 3. Effects of KATP channel regulators on apoptosis rate detected by flow cytometry. The results indicated that the early apoptosis rate was influenced significantly by pharmacological pretreatment. **P < 0.01, compared with control group; ## P < 0.01, compared with H–R group; $ P < 0.01, compared with D group. The apoptosis rate of diazoxide was lower than pinacidil (P < 0.01). H–R: hypoxia–reperfusion, D: diazoxide, 5HD: 5-hydroxydecanoate, P: pinacidil, and G: glibenclamide.
our research, we also verified the same trend in neuroprotection. It can be concluded that diazoxide treatment given 30 min before systemic ischemia can protect against ischemia–reperfusion in gerbil brains. The research in the histomorphology of gerbil brains showed that pretreatment with diazoxide and pinacidil inhibited neuron swelling and lessened the degree of disorder, resulting in cerebral protection. Recent research on cerebral ischemia–reperfusion reported that mice given diazoxide exhibited a large (60–70%) decrease in cortical infarct size after permanent occlusion of the middle cerebral artery, and the protective effect of diazoxide was completely prevented by pretreatment with 5HD [21]. Opening the mitoKATP channel acted a significant role in decreasing the injury of the cerebral ischemia–reperfusion. Although other investigators also has confirmed the protective effects of the sarcKATP channel opener pinacidil [22], the novel evidence showed that opening of the sarcKATP channels, through a specific Ca2+ -related interaction with mitochondria, played an important role in preventing apoptosis and mitochondrial damage during stress [15]. Therefore, the sarcKATP channels might prevent apoptosis through partially opening the mitoKATP channels. Furthermore the mitoKATP channel opener demonstrated a more protective effect than the KATP channel opener on decreasing the apoptosis rate. Neuronal injury was assessed by measuring the LDH efflux into the medium. Pretreatment with ischemia, diazoxide, and isoflurane resulted in a significant decrease in LDH activity, and maintained neuronal
66
L. Wang et al. / Neuroscience Letters 491 (2011) 63–67
Fig. 4. Effect on the expression of mRNA on the I–R injury in gerbils’ brain. The expression of Kir6.1 mRNA in I–R group was increased obviously, compared with control group, **P < 0.01; and the expression of Kir6.1 mRNA in D group was also increased significantly, compared with I–R group, # P < 0.05, ## P < 0.01. Furthermore, the expression of Kir6.1 mRNA in D group was increased more than in P group, $ P < 0.01. There was no difference between pretreated group and unpretreated group in the expression of SUR1 mRNA. The expression of SUR2 mRNA was with a corresponding enhancement to damage between I–R group and pretreated groups, **P < 0.01; however, there was no difference between D group and P group.
viability [13]. In this study, LDH activity had a similar tendency. One reason for the protective effect of diazoxide in the brain was that diazoxide was 1000–2000 times more potent in opening the mitoKATP channel as compared to the sarcKATP channel [11]. It was apparent that at relatively low doses diazoxide was very selective for mitoKATP channels but even at relatively high doses diazoxide was selective for mitochondria, and brain mitochondria contained mitoKATP per milligram of mitochondrial protein 6–7 times more than that in liver or heart [2]. So the role of the mitoKATP channel was more important in the brain. Diazoxide and pinacidil could decrease neuronal apoptosis; neuronal apoptosis might be decreased by the inhibition of both mitochondrial and death-receptor signal pathways [9]. The current study reported that necrosis was mainly performance after the acute hypoxia, while apoptosis was mainly performance after hypoxia–reperfusion [16]. Similarly, we found that the early apoptosis rates induced by hypoxia–reperfusion increased visibly, while diazoxide and pinacidil decreased the early apoptosis rates definitely. 5HD inhibited the effect of diazoxide in this study, which indicated that mitoKATP channels predominantly contributed to neuroprotection. It seemed that immediate preconditioning primarily involved cellular changes relating to the activity or function of enzymes, second messengers, and ion channels. Some results indicated that brain mitoKATP was a redox-sensitive channel that controlled mitochondrial reactive oxygen species (ROS) release [8]. Our experiments indicated that pharmacological preconditioning ultimately resulted in increasing expression of the KATP channel subunit Kir6.1 in mitochondrial fractions. The Kir subunits were
more concentrated in mitochondria compared to whole brain tissue, it seemed that Kir6.1 might form the pore of mitoKATP channels in the brain [3], thereby emphasizing the functional importance of mitoKATP channels in neurons. The identification of SUR subunits has been more problematic and their exact nature was unclear. The results demonstrated that Kir6.1mRNA in the diazoxide group was increased significantly rather than in the pinacidil group (P < 0.01), whereas there were no differences in the expression of SUR1 and SUR2 in the KATP opener groups (P > 0.05), which suggested that it might be responsible for improved mitochondrial function and resistance to cerebral ischemic damage. While the mechanisms involved were not known with certainty, the results of preconditioning were the enhanced neuronal viability, the attenuated influx of intracellular calcium, the suppression of apoptosis, and the maintenance of ATP levels during and following stress [5]. The mechanisms of mitoKATP channels required further investigation. In conclusion, targeting mitochondrial-centered mechanisms was an effective means of protecting neurons against potentially lethal stimuli. The present study had provided the evidence that selective opener of the mitoKATP channel provided neuroprotection effect against ischemia–reperfusion in the rat brain. Clearly, more work should be done to determine the mechanisms, by which preconditioning mechanisms in the brain could be restored in sick patients. Acknowledgement The present study was financed from the National Natural Science Foundation of China, No. 30400549.
L. Wang et al. / Neuroscience Letters 491 (2011) 63–67
References [1] H. Ardehali, B. O’Rourke, Mitochondrial K(ATP) channels in cell survival and death, J. Mol. Cell Cardiol. 39 (2005) 7–16. [2] R. Bajgar, S. Seetharaman, A.J. Kowaltowski, K.D. Garlid, P. Paucek, Identification and properties of a novel intracellular (mitochondrial) ATP-sensitive potassium channel in brain, J. Biol. Chem. 276 (2001) 33369–33374. [3] L. Birgit, R. Jochen, Molecular physiology of neuronal K-ATP channels, Mol. Membr. Biol. 18 (2001) 117–127. [4] S. Brosh, O. Sperling, E. Dantziger, Y. Sidi, Metabolism of guanine and guanine nucleotides in primary rat neuronal cultures, J. Neurochem. 58 (1992) 1485–1490. [5] D.W. Busija, T. Gaspar, F. Domoki, P.V. Katakam, F. Bari, Mitochondrial-mediated suppression of ROS production upon exposure of neurons to lethal stress: mitochondrial targeted preconditioning, Adv. Drug Deliv. Rev. 60 (13–14) (2008) 1471–1477. [6] M. Carroll, O. Beek, Protection against hippocampal CA1 cell loss by postischemic hypothermia is dependent on delay of initiation and duration, Metab. Brain Dis. 7 (1992) 45–50. [7] F. Dessi, C. Charriaut-Marlangue, M. Khrestchatisky, Y. Ben-Ari, Glutamateinduced neuronal death is not a programmed cell death in cerebellar culture, J. Neurochem. 60 (1993) 1953–1955. [8] M. Fornazari, J.G. de Paula, R.F. Castilho, A.J. Kowaltowski, Redox properties of the adenoside triphosphate-sensitive K+ channel in brain mitochondria, J. Neurosci. Res. 86 (2008) 1548–1556. [9] K.A. Foster, F. Galeffi, F.J. Gerich, D.A. Turner, M. Müller, Optical and pharmacological tools to investigate the role of mitochondria during oxidative stress and neurodegeneration, Prog. Neurobiol. 79 (2006) 136–171. [10] D.B. Foster, J.J. Rucker, E. Marbán, Is Kir6.1 a subunit of mitoK(ATP)? Biochem. Biophys. Res. Commun. 366 (2008) 649–656. [11] K.D. Garlid, P. Paucek, V. Yarov-Yarovoy, H.N. Murray, R.B. Darbenzio, A.J. D’Alonzo, N.J. Lodge, M.A. Smith, G.J. Grover, Cardioprotective effect of diazoxide and its interaction with mitochondrial ATP-sensitive K+ channels. Possible mechanism of cardioprotection, Circ. Res. 81 (1997) 1072– 1082.
67
[12] W. Hamabe, R. Fujita, H. Ueda, Insulin receptor-protein kinase C-gamma signaling mediates inhibition of hypoxia-induced necrosis of cortical neurons, J. Pharmacol. Exp. Ther. 313 (2005) 1027–1034. [13] T. Kaneko, K. Yokoyama, K. Makita, Late preconditioning with isoflurane in cultured rat cortical neurons, Br. J. Anaesth. 95 (2005) 662–668. [14] K. Kitagawa, M. Matsumoto, M. Tagaya, R. Hata, H. Ueda, M. Niinob, N. Handa, R. Fukunaga, K. Kimura, K. Mikoshiba, ‘Ischemic tolerance’ phenomenon found in the brain, Brain Res. 528 (1990) 21–24. [15] J. Marinovic, M. Ljubkovic, A. Stadnicka, Z.J. Bosnjak, M. Bienengraeber, Role of sarcolemmal ATP-sensitive potassium channel in oxidative stress-induced apoptosis: mitochondrial connection, Am. J. Physiol. Heart Circ. Physiol. 294 (2008) H1317–H1325. [16] A.S. Pagnussat, M.C. Faccioni-Heuser, C.A. Netto, M. Achaval, An ultrastructural study of cell death in the CA1 pyramidal field of the hippocapmus in rats submitted to transient global ischemia followed by reperfusion, J. Anat. 211 (2007) 589–599. [17] A. Reshef, O. Sperling, E. Zoref-Shani, Opening of ATP-sensitive potassium channels by cromakalim confers tolerance against chemical ischemia in rat neuronal cultures, Neurosci. Lett. 250 (1998) 111–114. [18] A. Thomzig, G. Laube, H. Prüss, R.W. Veh, Pore-forming subunits of K-ATP channels, Kir6.1 and Kir6.2, display prominent differences in regional and cellular distribution in the rat brain, J. Comp. Neurol. 484 (2005) 313–330. [19] I. Vermes, C. Haanen, H. Steffens-Nakken, C. Reutelingsperger, A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labeled annexin V, J. Immunol. Methods 184 (1995) 39–51. [20] M. Watanabe, K. Katsura, I. Ohsawa, G. Mizukoshi, K. Takahashi, S. Asoh, S. Ohta, Y. Katayama, Involvement of mitoKATP channel in protective mechanisms of cerebral ischemic tolerance, Brain Res. 1238 (2008) 199–207. [21] A.V. Zarch, H.P. Toroudi, M. Soleimani, A. Bakhtiarian, M. Katebi, B. Djahanguiri, Neuroprotective effects of diazoxide and its antagonism by glibenclamide in pyramidal neurons of rat hippocampus subjected to ischemia–reperfusioninduced injury, Int. J. Neurosci. 119 (2009) 1346–1361. [22] H. Zhang, L.C. Song, Y.Y. Liu, Y. Ma, Y.L. Lu, Pinacidil reduces neuronal apoptosis following cerebral ischemia–reperfusion in rats through both mitochondrial and death-receptor signal pathways, Neurosci. Bull. 23 (2007) 145–150.
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
The protective roles of mitochondrial ATP-sensitive potassium channels during hypoxia–ischemia–reperfusion in brain Lin Wang a , Qing-Lei Zhu a,∗ , Guo-Zheng Wang b , Tian-Zheng Deng c , Rui Chen a , Mo-Han Liu a , Shi-Wen Wang a a b c
Institute of Geriatric Cardiology, Chinese PLA General Hospital, Fuxing Road 28, Beijing 100853, China The 117 Hospital of PLA, Hangzhou 310013, China General Hospital of the Air Force of the Chinese People’s Liberation Army, Beijing 100142, China
a r t i c l e
i n f o
Article history: Received 3 November 2010 Received in revised form 14 December 2010 Accepted 31 December 2010 Keywords: ATP sensitive potassium channel Hypoxia–ischemia–reperfusion Oxygen-glucose deprivation Pharmacologic preconditioning
a b s t r a c t The role of ATP-sensitive potassium (KATP ) channels in cerebral ischemia–reperfusion has been well documented. KATP channel openers protect neuron by mimicking ischemic preconditioning. However, the different protection between the mitochondrial and sarcolemma KATP openers has been seldom studied. In the experiment, we investigated the effects of KATP channel openers diazoxide and pinacidil on the hypoxia–ischemia–reperfusion in cultured hippocampal neurons and gerbil brain. The cultured hippocampal neurons and gerbil brain were pretreated with diazoxide or pinacidil before oxygen-glucose deprivation (OGD) and cerebral ischemia–reperfusion, respectively. Survival rate, apoptosis rate and lactate dehydrogenase (LDH) releasing after the reperfusion were subsequently detected. Then the subunits mRNA was detected by RT-PCR. The survival rate and LDH content in diazoxide group increased more than that in pinacidil group (86.21 ± 2.73% vs. 78.59 ± 1.94%, P < 0.05; 133.29 ± 15.00 U/L vs. 193.47 ± 3.39 U/L, P < 0.01). The apoptosis rate in diazoxide group decreased significantly more than that in pinacidil group (23.82 ± 0.14% vs. 37.05 ± 0.67%, P < 0.01). Diazoxide pretreatment increased the expression of Kir6.1 mRNA obviously. The results suggested that mitoKATP channels opener diazoxide played a major protective role on cerebral ischemia–reperfusion. Furthermore, diazoxide might become a new treatment for cerebral ischemia diseases through increasing the expression of Kir6.1 mRNA. Crown Copyright © 2011 Published by Elsevier Ireland Ltd. All rights reserved.
‘Ischemic tolerance’ is a phenomenon in which preconditioning with sublethal stresses or stimuli, such as brief ischemia, spreading depression, or pharmacological agents, can induce resistance to subsequent lethal ischemia [14]. Although the precise mechanism of ‘ischemic tolerance’ remains elusive, much attention has been focused on the potential role of ATP-sensitive potassium channels (KATP ) as the effectors of protection. There are two populations of KATP channels: the mitochondrial (mitoKATP ) channel locates in the inner mitochondrial membrane and the sarcolemmal (sarcKATP ) channel locates in the plasma membrane, which has different pharmacological and functional properties. KATP channels are formed as an octomeric complex of four por-forming Kir6.x and four sulphonylurea receptors. Two subunits of Kir (Kir6.1 and Kir6.2) and three subunits of SUR (SUR1, SUR2A, and SUR2B) have been identified [18]. It has been shown that Kir6.1 and SUR2 were enriched in rat brain mitochondria compared to whole brain [10]. Brain mitochondria contained seven times more mitoKATP channels than liver or heart mitochondria, which indicated the importance of these
∗ Corresponding author. Tel.: +86 10 66936762; fax: +86 10 68188906. E-mail addresses: [email protected], [email protected] (Q.-L. Zhu).
channels in neurons [2]. Selective opening of mitoKATP channels had neuroprotective effects against ischemia–reperfusion injury in the brain, activation of mitoKATP channels could protect neurons against injury and death [20]. However, the detailed effect of KATP channel openers and their antagonist on neuronal death and apoptosis in cerebral ischemia–reperfusion-induce injury has not been fully studied, and whether mitoKATP channels play a more important protective role than sarcKATP channels in the brain remains unclear. In this study, we observed the morphology of cultured neurons, evaluated the survival and apoptosis rates, determined LDH release, and compared expression of the mitoKATP channels subunits Kir6.1 in gerbils to discuss the protective roles of mitochondrial ATPsensitive potassium channels. Hippocampal neurons were cultured as described previously [4]. Cultures were maintained in a 5% CO2 atmosphere at 37 ◦ C, and incubated for 9–13 days. At least 90% neurons were observed by staining with neuron-specific enolase. The medium was thoroughly exchanged with deoxygenated, glucose-free Earle’s balanced salt solution (BSSo). Cultures were transferred to an anaerobic chamber containing 5% CO2 and 95% N2 for 4 h [12]. Oxygen-glucose deprivation was terminated by oxy-
0304-3940/$ – see front matter. Crown Copyright © 2011 Published by Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2010.12.065
64
L. Wang et al. / Neuroscience Letters 491 (2011) 63–67
Fig. 1. The experimental protocol. (A) The protocol for evaluation of the capacity of the KATP channel openers (diazoxide and pinacidil) and the KATP channel blockers (5HD and glibenclamide) to confer protection. (B) The protocol for the study of the effect of the KATP channel blockers, 5HD and glibenclamide, on the capacity of KATP channel openers (diazoxide and pinacidil) to induce protection.
genated neurobasal medium. Then cultures were returned to the normoxic incubator for 24 h. Male Mongolian gerbils weighing 50–70 g were used for animal models. Cerebral ischemia was induced by the method of Carroll and Beek [6]. All procedures were conducted in compliance with Regulations for the Administration of Affairs Concerning Experimental Animals. Both common carotid arteries were occluded for 10 min by means of micro-aneurysm clips. After clip removal for 60 min, gerbils were decapitated to get the brain tissues. Shamoperated animals received the same surgical procedure except the carotid arteries occluded. Neurons cultured were initially exposed to the KATP channel regulators for 15 min [diazoxide (D, 50 M); pinacidil (P, 50 M); 5hydroxydecanoate (5HD, 100 M); glibenclamide (G, 2 M); final concentration, prepared by addition of concentrated stock solutions, prepared in dimethyl sulphoxide (DMSO)/ethanol mixed liquor, to 1 ml fresh culture medium] (Fig. 1A). Vehicle of the drugs (1% DMSO) had no effect on neuron. The KATP channel blockers were given 15 min before the KATP channel openers were administered (Fig. 1B). Control cultures were incubated for 15 min in regular medium [17]. In gerbils, diazoxide (40 mg/kg) and pinacidil (40 mg/kg) were given intraperitoneally (i.p.), 30 min before global cerebral ischemia, 5HD (40 mg/kg) and glibenclamide (0.1 mg/kg) were given 15 min before the openers administered. Sham-operated group and ischemia–reperfusion group were given normal saline. The survival rate was assessed by the Trypan blue exclusion test [7]. The percentage of injured (dead) cells was determined under an inverted phase contrast microscope (200× magnification). The apoptosis rate was detected by Flow Cytometer (FCM). Analysis was performed using dual staining with annexin V and propidium iodide [19]. The apoptosis morphology of cultured neurons was assessed by Hoechst 33342 for 15 min at 37 ◦ C. Cell viability was measured by the LDH release assay, which was based on measurement of LDH activity in culture medium. Standard techniques using commercialized assay kits according to the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, China) were performed for analyses. After killing the gerbils, the brain tissues were rapidly removed and flash-frozen in liquid N2 to avoid RNA degradation. Then the tissues were homogenized, and total RNA was prepared using a guanidine thiocyanate method (Trizol solution). The primers had the following sequences. Kir6.1: up5 -ACCAGAATTCTCTGCGGAAG, low GCCCTGAACTGGTGATGAGT, amplicon size 297 bp; SUR1: up5 GGAGCAATCCAGACCAAGAT, low AGCCAGCAGAATGATGACAG, amplicon size 249 bp; SUR2: up5 -CCATCATCAGTGTTCAAAAGC, low GGCTGCTTCCTGTTTATTGG, amplicon size 148 bp; -actin: up5 -AAGTACCCCATTGAACACGG, low ATCACAATGCCAGTGGTACG, amplicon size 257 bp. -Actin was used as a standard for constitutive expression. The PCR products were analyzed by AlphaImager2200 after ethidium staining.
All values were expressed as mean ± SD. Data were analyzed using a one-way ANOVA. When the F value was significant, pairwise comparisons were made using Dunnet’s t test. A value of P < 0.05 was considered statistically significant. Exposure of the cultured neurons to the hypoxia–reperfusion (H–R) injury resulted in severe damage, including dendritic spine loss and diminished dendritic complexity. Decreased dendritic branches and spine density in D group were not much higher than that in P group. To assess the damage to the neurons, we stained them with Trypan blue exclusion test. Comparing with the control group (94.72 ± 2.28%), the survival rate in H–R group (72.09 ± 1.51%) and groups pretreated with regulators decreased significantly (P < 0.01). The survival rate in D group was higher than P group (86.21 ± 2.74% vs. 78.59 ± 1.94%, P < 0.05) (Fig. 2). It could be conclusion that diazoxide and pinacidil could protect neurons. The protective role of diazoxide was slightly better than pinacidil, and it could be blocked by adding the blocker 5HD and glibenclamide, respectively. We thought that the survival rate of KATP channel openers might increase through triggering an apoptosis pathway. The cultures were detected by Hoechst staining and FCM. In control group, neurons contained intact nuclei with well-preserved cell membranes. However, condensed nuclei and fragmented nuclei could be observed in H–R group and pretreated groups. Compared with the control group (12.40 ± 0.07%), the apoptosis rate in H–R group (49.51 ± 2.58%) and pretreated groups increased significantly (P < 0.01). We also found that the apoptosis rate in the D group and P group decreased to 23.82 ± 0.14% and 37.05 ± 0.67%, lower than H–R group (P < 0.01) (Fig. 2). And the diazoxide could not only reduce the apoptosis rate more extent, but also play a more significant role in protecting neuron than pinacidil. It was found that LDH content, used as detecting cell injury, had a similar trend to the apoptosis rate. LDH contents in H–R group and pretreated groups increased much more than those in control group (76.84 ± 10.53 U/L) (P < 0.01). Compared with the H–R group (255.45 ± 26.23 U/L), both the D and P groups were decreased (133.29 ± 15.00 U/L and 193.47 ± 3.39 U/L) (P < 0.01). The mitoKATP channel opener diazoxide resulted in lower LDH contents than KATP channel opener pinacidil, which indicated that opening the mitoKATP channel played a major neuroprotective role. The results indicated that the protected role of mitoKATP channel opener diazoxide was better than the sarcKATP channel opener pinacidil. We thought it might take effect through increasing the expression of subunits mRNA, which induced more KATP opening. To illustrate this, we experimented on gerbils’ brain undergoing the ischemia–reperfusion (I–R) insult. Compared with I–R group and P group, the expression of Kir6.1 mRNA in D group was increased obviously; whereas there was no difference between pretreated group and unpretreated group in the expression of SUR1 mRNA. It was also found that the expression of SUR2 mRNA was with a corresponding enhancement to damage between I–R group and pretreated groups; however, there was no difference between D group and P group (Figs. 3 and 4). Therefore, KATP openers might mainly act on Kir6.1mRNA to induce protective role. The major finding in this study was that both pretreatment with the mitoKATP channel opener diazoxide and the sarcKATP channel opener pinacidil had neuroprotective effects against hypoxia–reperfusion insults in cultured neurons. It was shown that the survival rate of neurons pretreated with diazoxide and pinacidil increased. Specifically, the mitoKATP channel opener diazoxide could distinctly reduce the apoptosis rate and LDH release in neurons. This protective role of diazoxide was rather obvious than pinacidil. Thus, the selective targeting of the mitoKATP channel appeared to lessen the impact of hypoxic–ischemic injury to neurons.
L. Wang et al. / Neuroscience Letters 491 (2011) 63–67
65
Fig. 2. (A) Effect of KATP channel regulators on the morphology of hippocampal neurons after H–R injury (200×). Decreased dendritic branches and spine density in D group were not much higher than that in P group. (B) Effect of KATP channel regulators on the survival rate of the hippocampal neurons after H–R injury. **P < 0.01, compared with control group; ## P < 0.01, compared with H–R group. Compared with H–R group, the survival rates of D and P groups were significantly increased (P < 0.01); the survival rate of D group was higher than P group (P < 0.05). These protective roles were blocked by 5HD and glibenclamide, respectively. H–R: hypoxia–reperfusion, D: diazoxide, 5HD: 5-hydroxydecanoate, P: pinacidil, and G: glibenclamide.
Initially, the cardioprotective effects of preconditioning were attributed to the sarcKATP channels; however, subsequent evidence suggested that mitoKATP channels rather than the sarcKATP channels played a more important role in cardioprotection [1]. During
Fig. 3. Effects of KATP channel regulators on apoptosis rate detected by flow cytometry. The results indicated that the early apoptosis rate was influenced significantly by pharmacological pretreatment. **P < 0.01, compared with control group; ## P < 0.01, compared with H–R group; $ P < 0.01, compared with D group. The apoptosis rate of diazoxide was lower than pinacidil (P < 0.01). H–R: hypoxia–reperfusion, D: diazoxide, 5HD: 5-hydroxydecanoate, P: pinacidil, and G: glibenclamide.
our research, we also verified the same trend in neuroprotection. It can be concluded that diazoxide treatment given 30 min before systemic ischemia can protect against ischemia–reperfusion in gerbil brains. The research in the histomorphology of gerbil brains showed that pretreatment with diazoxide and pinacidil inhibited neuron swelling and lessened the degree of disorder, resulting in cerebral protection. Recent research on cerebral ischemia–reperfusion reported that mice given diazoxide exhibited a large (60–70%) decrease in cortical infarct size after permanent occlusion of the middle cerebral artery, and the protective effect of diazoxide was completely prevented by pretreatment with 5HD [21]. Opening the mitoKATP channel acted a significant role in decreasing the injury of the cerebral ischemia–reperfusion. Although other investigators also has confirmed the protective effects of the sarcKATP channel opener pinacidil [22], the novel evidence showed that opening of the sarcKATP channels, through a specific Ca2+ -related interaction with mitochondria, played an important role in preventing apoptosis and mitochondrial damage during stress [15]. Therefore, the sarcKATP channels might prevent apoptosis through partially opening the mitoKATP channels. Furthermore the mitoKATP channel opener demonstrated a more protective effect than the KATP channel opener on decreasing the apoptosis rate. Neuronal injury was assessed by measuring the LDH efflux into the medium. Pretreatment with ischemia, diazoxide, and isoflurane resulted in a significant decrease in LDH activity, and maintained neuronal
66
L. Wang et al. / Neuroscience Letters 491 (2011) 63–67
Fig. 4. Effect on the expression of mRNA on the I–R injury in gerbils’ brain. The expression of Kir6.1 mRNA in I–R group was increased obviously, compared with control group, **P < 0.01; and the expression of Kir6.1 mRNA in D group was also increased significantly, compared with I–R group, # P < 0.05, ## P < 0.01. Furthermore, the expression of Kir6.1 mRNA in D group was increased more than in P group, $ P < 0.01. There was no difference between pretreated group and unpretreated group in the expression of SUR1 mRNA. The expression of SUR2 mRNA was with a corresponding enhancement to damage between I–R group and pretreated groups, **P < 0.01; however, there was no difference between D group and P group.
viability [13]. In this study, LDH activity had a similar tendency. One reason for the protective effect of diazoxide in the brain was that diazoxide was 1000–2000 times more potent in opening the mitoKATP channel as compared to the sarcKATP channel [11]. It was apparent that at relatively low doses diazoxide was very selective for mitoKATP channels but even at relatively high doses diazoxide was selective for mitochondria, and brain mitochondria contained mitoKATP per milligram of mitochondrial protein 6–7 times more than that in liver or heart [2]. So the role of the mitoKATP channel was more important in the brain. Diazoxide and pinacidil could decrease neuronal apoptosis; neuronal apoptosis might be decreased by the inhibition of both mitochondrial and death-receptor signal pathways [9]. The current study reported that necrosis was mainly performance after the acute hypoxia, while apoptosis was mainly performance after hypoxia–reperfusion [16]. Similarly, we found that the early apoptosis rates induced by hypoxia–reperfusion increased visibly, while diazoxide and pinacidil decreased the early apoptosis rates definitely. 5HD inhibited the effect of diazoxide in this study, which indicated that mitoKATP channels predominantly contributed to neuroprotection. It seemed that immediate preconditioning primarily involved cellular changes relating to the activity or function of enzymes, second messengers, and ion channels. Some results indicated that brain mitoKATP was a redox-sensitive channel that controlled mitochondrial reactive oxygen species (ROS) release [8]. Our experiments indicated that pharmacological preconditioning ultimately resulted in increasing expression of the KATP channel subunit Kir6.1 in mitochondrial fractions. The Kir subunits were
more concentrated in mitochondria compared to whole brain tissue, it seemed that Kir6.1 might form the pore of mitoKATP channels in the brain [3], thereby emphasizing the functional importance of mitoKATP channels in neurons. The identification of SUR subunits has been more problematic and their exact nature was unclear. The results demonstrated that Kir6.1mRNA in the diazoxide group was increased significantly rather than in the pinacidil group (P < 0.01), whereas there were no differences in the expression of SUR1 and SUR2 in the KATP opener groups (P > 0.05), which suggested that it might be responsible for improved mitochondrial function and resistance to cerebral ischemic damage. While the mechanisms involved were not known with certainty, the results of preconditioning were the enhanced neuronal viability, the attenuated influx of intracellular calcium, the suppression of apoptosis, and the maintenance of ATP levels during and following stress [5]. The mechanisms of mitoKATP channels required further investigation. In conclusion, targeting mitochondrial-centered mechanisms was an effective means of protecting neurons against potentially lethal stimuli. The present study had provided the evidence that selective opener of the mitoKATP channel provided neuroprotection effect against ischemia–reperfusion in the rat brain. Clearly, more work should be done to determine the mechanisms, by which preconditioning mechanisms in the brain could be restored in sick patients. Acknowledgement The present study was financed from the National Natural Science Foundation of China, No. 30400549.
L. Wang et al. / Neuroscience Letters 491 (2011) 63–67
References [1] H. Ardehali, B. O’Rourke, Mitochondrial K(ATP) channels in cell survival and death, J. Mol. Cell Cardiol. 39 (2005) 7–16. [2] R. Bajgar, S. Seetharaman, A.J. Kowaltowski, K.D. Garlid, P. Paucek, Identification and properties of a novel intracellular (mitochondrial) ATP-sensitive potassium channel in brain, J. Biol. Chem. 276 (2001) 33369–33374. [3] L. Birgit, R. Jochen, Molecular physiology of neuronal K-ATP channels, Mol. Membr. Biol. 18 (2001) 117–127. [4] S. Brosh, O. Sperling, E. Dantziger, Y. Sidi, Metabolism of guanine and guanine nucleotides in primary rat neuronal cultures, J. Neurochem. 58 (1992) 1485–1490. [5] D.W. Busija, T. Gaspar, F. Domoki, P.V. Katakam, F. Bari, Mitochondrial-mediated suppression of ROS production upon exposure of neurons to lethal stress: mitochondrial targeted preconditioning, Adv. Drug Deliv. Rev. 60 (13–14) (2008) 1471–1477. [6] M. Carroll, O. Beek, Protection against hippocampal CA1 cell loss by postischemic hypothermia is dependent on delay of initiation and duration, Metab. Brain Dis. 7 (1992) 45–50. [7] F. Dessi, C. Charriaut-Marlangue, M. Khrestchatisky, Y. Ben-Ari, Glutamateinduced neuronal death is not a programmed cell death in cerebellar culture, J. Neurochem. 60 (1993) 1953–1955. [8] M. Fornazari, J.G. de Paula, R.F. Castilho, A.J. Kowaltowski, Redox properties of the adenoside triphosphate-sensitive K+ channel in brain mitochondria, J. Neurosci. Res. 86 (2008) 1548–1556. [9] K.A. Foster, F. Galeffi, F.J. Gerich, D.A. Turner, M. Müller, Optical and pharmacological tools to investigate the role of mitochondria during oxidative stress and neurodegeneration, Prog. Neurobiol. 79 (2006) 136–171. [10] D.B. Foster, J.J. Rucker, E. Marbán, Is Kir6.1 a subunit of mitoK(ATP)? Biochem. Biophys. Res. Commun. 366 (2008) 649–656. [11] K.D. Garlid, P. Paucek, V. Yarov-Yarovoy, H.N. Murray, R.B. Darbenzio, A.J. D’Alonzo, N.J. Lodge, M.A. Smith, G.J. Grover, Cardioprotective effect of diazoxide and its interaction with mitochondrial ATP-sensitive K+ channels. Possible mechanism of cardioprotection, Circ. Res. 81 (1997) 1072– 1082.
67
[12] W. Hamabe, R. Fujita, H. Ueda, Insulin receptor-protein kinase C-gamma signaling mediates inhibition of hypoxia-induced necrosis of cortical neurons, J. Pharmacol. Exp. Ther. 313 (2005) 1027–1034. [13] T. Kaneko, K. Yokoyama, K. Makita, Late preconditioning with isoflurane in cultured rat cortical neurons, Br. J. Anaesth. 95 (2005) 662–668. [14] K. Kitagawa, M. Matsumoto, M. Tagaya, R. Hata, H. Ueda, M. Niinob, N. Handa, R. Fukunaga, K. Kimura, K. Mikoshiba, ‘Ischemic tolerance’ phenomenon found in the brain, Brain Res. 528 (1990) 21–24. [15] J. Marinovic, M. Ljubkovic, A. Stadnicka, Z.J. Bosnjak, M. Bienengraeber, Role of sarcolemmal ATP-sensitive potassium channel in oxidative stress-induced apoptosis: mitochondrial connection, Am. J. Physiol. Heart Circ. Physiol. 294 (2008) H1317–H1325. [16] A.S. Pagnussat, M.C. Faccioni-Heuser, C.A. Netto, M. Achaval, An ultrastructural study of cell death in the CA1 pyramidal field of the hippocapmus in rats submitted to transient global ischemia followed by reperfusion, J. Anat. 211 (2007) 589–599. [17] A. Reshef, O. Sperling, E. Zoref-Shani, Opening of ATP-sensitive potassium channels by cromakalim confers tolerance against chemical ischemia in rat neuronal cultures, Neurosci. Lett. 250 (1998) 111–114. [18] A. Thomzig, G. Laube, H. Prüss, R.W. Veh, Pore-forming subunits of K-ATP channels, Kir6.1 and Kir6.2, display prominent differences in regional and cellular distribution in the rat brain, J. Comp. Neurol. 484 (2005) 313–330. [19] I. Vermes, C. Haanen, H. Steffens-Nakken, C. Reutelingsperger, A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labeled annexin V, J. Immunol. Methods 184 (1995) 39–51. [20] M. Watanabe, K. Katsura, I. Ohsawa, G. Mizukoshi, K. Takahashi, S. Asoh, S. Ohta, Y. Katayama, Involvement of mitoKATP channel in protective mechanisms of cerebral ischemic tolerance, Brain Res. 1238 (2008) 199–207. [21] A.V. Zarch, H.P. Toroudi, M. Soleimani, A. Bakhtiarian, M. Katebi, B. Djahanguiri, Neuroprotective effects of diazoxide and its antagonism by glibenclamide in pyramidal neurons of rat hippocampus subjected to ischemia–reperfusioninduced injury, Int. J. Neurosci. 119 (2009) 1346–1361. [22] H. Zhang, L.C. Song, Y.Y. Liu, Y. Ma, Y.L. Lu, Pinacidil reduces neuronal apoptosis following cerebral ischemia–reperfusion in rats through both mitochondrial and death-receptor signal pathways, Neurosci. Bull. 23 (2007) 145–150.