The PsCZF1 gene encoding a C2H2 zinc finger protein is required for growth, development and pathogenesis in Phytophthora sojae

Microbial Pathogenesis 47 (2009) 78–86

Contents lists available at ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

The PsCZF1 gene encoding a C2H2 zinc finger protein is required for growth, development and pathogenesis in Phytophthora sojae Yonglin Wang, Daolong Dou, Xiaoli Wang, Aining Li, Yuting Sheng, Chenlei Hua, Binyan Cheng, Xiaoren Chen, Xiaobo Zheng, Yuanchao Wang* Department of Plant Pathology, Nanjing Agricultural University, Nanjing 210095, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 13 November 2008 Received in revised form 9 April 2009 Accepted 29 April 2009 Available online 15 May 2009

The C2H2 zinc finger proteins form one of the largest families of transcriptional regulators in eukaryotes. We identified a Phytophthora sojae C2H2 zinc finger (PsCZF1), that is highly conserved in sequenced oomycete pathogens. In transformants of P. sojae containing the PsCZF1 promoter fused to the b-glucuronidase (GUS) reporter gene, GUS activity was highly induced in the P. sojae oospore stage and upregulated after infection. To elucidate the function of PsCZF1, its expression was silenced by introducing anti-sense constructs into P sojae. PsCZF1-silenced transformants did not exhibit altered cell size or morphology of sporangia and hyphae; however, hyphal growth rate was reduced by around 50% in the mutants. PsCZF1-deficient mutants were also impaired in production of oospores, swimming zoospores and germinating cysts, indicating that the gene is involved in various stages of the life cycle. Furthermore, we found that PsCZF1-deficient mutants lost virulence on host soybean cultivars. Our results suggest that this oomycete-specific C2H2-type zinc finger protein plays an important role in growth, development, and pathogenesis; therefore, PsCZF1 might be an attractive oomycete-specific target for chemical fungicide screening. Crown Copyright Ó 2009 Published by Elsevier Ltd. All rights reserved.

Keywords: Oomycete Phytophthora sojae C2H2 zinc finger protein PsCZF1 Development Pathogenesis

1. Introduction Oomycetes, the fungus-like eukaryotic micro-organisms that are relatively closely related to photosynthetic algae such as brown algae and diatoms, belong to the kingdom Stramenopile [1]. The oomycetes contain a large amount of phytopathogens and the most notorious is the genus Phytophthora. Phytophthora infestans, the cause of late blight of potato and tomato, has caused billions of dollars of losses per year since the time of the Irish potato famine [2]. P. sojae, the cause of stem and root rot in soybean, is estimated to cause annual yield losses up to $1–2 billion worldwide [3]. Despite the great economic importance, the basic biology of Phytophthora and other oomycete pathogens is still poorly understood, which limits development of novel strategies for controlling the caused diseases. Phytophthora commonly produces three kinds of spores during its asexual life cycle, including sporangia, zoospores, and chlamydospores [4]. In some species, such as P. infestans, sporangia are released freely from aerial hyphae and serve as agents of dispersal [2].

* Corresponding author. Tel.: þ86 25 84399071; fax: þ86 25 84395325. E-mail addresses: [email protected] (D. Dou), [email protected] (Y. Wang).

However, sporangia are not readily released from other species, such as P. sojae, in which sporangia can differentiate to produce 10–30 zoospores, and zoospores or oospores are the main agents of dispersal [3]. Phytophthora species are typically diploid and sexual reproduction is also important [5]. Meiosis takes place in a differentiated female organ called the oogonium and a differentiated male organ called the antheridium. The antheridium fuses with the oogonium and a single haploid nucleus is transferred to the oogonium. The fertilized oogonium differentiates into a long-lived oospore, which germinates to produce hyphae [6]. The identification of genes participating in these processes, and an understanding of how they are regulated, is essential to elucidate growth, development and pathogenesis mechanisms. Transcription factors (TFs), are a large family of trans-acting molecules that are widely believed to play important roles in almost all biological processes. C2H2-type zinc finger TFs are abundant in all eukaryotic genomes, and contain one or more tandem of C2H2 motifs (CX2–4CX12HX2–6H; C, cysteine; H, histidine and X, any amino acid). TFs have a broad range of functions, such as transcription regulation and protein–protein interactions [7–9]. C2H2-type TFs are also important in pathogenic fungi, e.g., Aspergillus fumigatus [10,11], Botrytis cinerea [12], Candida albicans [13], Cryptococcus neoformans [14], and Ustilago maydis [15]. Deletion of

0882-4010/$ – see front matter Crown Copyright Ó 2009 Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.micpath.2009.04.013

Y. Wang et al. / Microbial Pathogenesis 47 (2009) 78–86

79

a particular C2H2 zinc finger TF in these fungi can affect, often depressing or blocking, pathogens virulence on host species. Unlike other true fungal phytopathogens, the functions of oomycete pathogen TFs are still largely unknown, although a bZIP transcription factor gene [16] and a cluster of NIF (nuclear LIM interactor-interacting factor) transcriptional regulators of P. infestans [17,18] have been thoroughly studied. The recent completion of P. sojae genome sequencing [19], and establishment and development of effective molecular genetic tools, such as gene transformation and gene silencing, offer new opportunities to examine the genetic basis of P. sojae in terms of biology, physiology and pathogenicity [20]. Here, we report a novel C2H2 zinc finger TF in oomycetes that is highly induced in P. sojae oospores and upregulated upon infection. Gene-silencing analysis of the gene in P. sojae demonstrated that it plays key roles in both asexual and sexual reproduction, and in pathogenesis on host soybean cultivars.

those of the other 15 were in the N-terminus (Fig. 1A). Therefore, we named 127993 as PsCZF1 (P. sojae C2H2-type zinc finger; accession number, EU912575) and 1281284 as PsCZF2. The open reading frame of PsCZF1 contained 1479 bp and no intron was predicted, resulting in a protein with 492 amino acids, which is supported by the EST sequence from Hyaloperonospora parasitica (CL1625Contig1, http://vmd.vbi.vt.edu) and our RT-PCR results (data not shown). Secondary structure prediction using the PSIPRED server revealed that each of the four zinc finger motifs in PsCZF1 was composed of two short b-strands (b1 and b2) separated by a Cys-containing short loop (L1), followed by a second loop (L2) and an a-helix (H) (Fig. 1B), which is consistent with the predicted secondary structure of C2H2-type zinc finger motifs [21] and is similar to the patters of a C2H2-type zinc finger protein, AZF1, from Saccharomyces cerevisiae (Fig. 1B). Hence, this confirmed that PsCZF1 encodes a C2H2-type zinc finger protein.

2. Results

2.2. PsCZF1 is a zinc finger protein and conserved in oomycetes

2.1. Identification and characterization of PsCZF1 in P. sojae

PsCZF1 is highly conserved in the sequenced oomycete genomes, including Phytophthora ramorum, P. infestans, and H. parasitica. We termed them as PrCZF1, PiCZF1 and HpCZF1, respectively (Fig. 2). The PsCZF1 gene is a single copy and no paralogs were identified (>50% similarity to PsCZF1) in the P. sojae genome, as well as in P. ramorum, H. parasitica and P. infestans. To exclude the possibility that unexpected copies or paralogs might have been missed in the whole genome sequence, we used EcoR I, EcoR V, Hind III, Sal I or Pst Idigested P. sojae (P6497) genomic DNA to hybridize with the PsCZF1 probe. Southern blotting showed that PsCZF1 was a single copy gene in P. sojae and did not have any highly similar paralogs (Fig. S3). No homologs found in BLAST searches of the four genes against other fungal genomes and public databases with e-values ¼ 10 if we exclude the zinc finger motif regions of the identified oomycete CZF1 proteins. However, the regions of the four adjacent C2H2 fingers were highly conserved in the fungus, animal, and plant genomes. The seven most similar genes, all

Genome-wide identification of C2H2 zinc finger genes was performed by searching for CX2–4CX12HX2–6H motif(s) in the released P. sojae genome sequence (http://vmd.vbi.vt.edu). After running INTERPRO analysis and searching for conserved functional discriminating residues with PROSITE, we identified 96 candidate genes having at least one C2H2 zinc finger motif, which contain about 0.5% of all P. sojae genes. These P. sojae C2H2 zinc finger proteins contained one to more than nine fingers, and 17 had four adjacent C2H2 fingers (Fig. 1A). Phylogenic analysis of all 17 genes with four adjacent C2H2 fingers suggested that one gene (http:// vmd.vbi.vt.edu, protein ID, 127993) was grouped in a distinct clade; and was obviously separate from the others (Fig. S1). The finger location pattern and structure of the gene was also different from those of others in that its four adjacent C2H2 fingers were located in the C-terminus; the fingers of one gene (http://vmd.vbi. vt.edu, protein ID, 1281284) were located in the middle region and

Fig. 1. Characterizations of zf_C2H2 motifs in PsCZF1. A) Motif organization of 17 four adjacent C2H2 proteins of Phytophthora sojae. Cys2/His2 zinc fingers zf_C2H2) motifs were identified by Prosite and checked by manual revision. Three groups were divided on distributions of the four adjacent C2H2 motifs. zf_C2H2 motifs were shown as dark rectangles; members per group are indicated in brackets. The localization of zf_C2H2 motif organization was shown according to the relative position. B) Multiple alignments of four zf_C2H2 motifs in PsCZF1. Amino acids predicted to be involved in the formation of the b-strand b1 and b2), the loops L1 and L2), and the a-helix H) are indicated. Residues corresponding to zinc finer consensus sequence are in bold, and identical residues are gray highlighted, – indicates gap for alignment.

80

Y. Wang et al. / Microbial Pathogenesis 47 (2009) 78–86

Fig. 2. PsCZF1 is a novel zinc finger protein and specific in oomycetes. Phylogenetic dendrograms were constructed by MEGA 4.0, with the minimum evolution algorithms using 1000 bootstrap replications. PsCZF1, EU912575, and its orthologues from Phytophthora infestans PiCZF1, FJ236069, Phytophthora ramorum PrCZF1, FJ236070, and Hyaloperonospora parasitica HpCZF1, FJ236071; as well as its highly homologous genes from Saccharomyces cerevisiae Azf1, NP_014756; Msn2p, NP_013751; Msn4p, NP_012861; Kluyveromyces lactis XP_456139; Candida albicans XP_710710; Aspergillus fumigatus EDP47468; Neurospora crassa CAC18195, respectively. zf-C2H2 motifs organization and localization of these protein were shown with dark rectangles according to the relative position and length of the proteins as scale. HS indicates the high similarity of primary sequence.

from fungi, were compared and aligned with oomycete CZF1. The results showed that no similarity was found in the regions excluding C2H2 fingers, and that the pattern of the four adjacent C2H2 fingers was also different; S. cerevisiae Msn2 or Msn4 proteins had the same C-terminal localization but contained only two adjacent C2H2 fingers and the fingers of the other five species were located near middle region (Fig. 2). Based on these results, we inferred that the identified CZF1 proteins were highly conserved and specific genes in oomycetes. 2.3. PsCZF1 is highly expressed in oospores and invading hyphae during infection To address and define the temporal and spatial pattern of PsCZF1 expression in different life stages, we made a construct of the

PsCZF1 promoter fused to the GUS reporter gene and introduced it into P. sojae using the PEG-mediated protoplast transformation method [22,23]. Strong GUS activity was observed in the oospore stage, while only faint expression of GUS was detected in hyphae and sporangia, but no activity was detected in zoospores and germinating cysts (Fig. 3). In contrast, strong GUS expression was observed in all the tested life stages of P. sojae when the HAM34 promoter was used in place of the PsCZF1 promoter (Fig. 3). As a hemibiotrophic oomycete pathogen, P. sojae colonizes soybean surfaces, followed by formation of infection-related structures and penetration into soybean tissues [24,25]. To determine whether PsCZF1 expression is induced upon infection, cytological assays were performed in P. sojae transformants expressing GUS under control of the PsCZF1 promoter. The staining results showed that the tip of infecting hyphae is the needle-like with

Fig. 3. Histochemical staining of GUS activity in the transformants of Phytophthora sojae expressing GUS gene driven by PsCZF1 promoter in the life stage. Histochemical staining activity in P. sojae expressing GUS gene governed by PsCZF1 promoter or constitutive promoter pHam34 as control, respectively. HY, SP, CY, GC, OO and IH represent GUS staining in hyphae, sporangia, cysts, germinated cysts, oospores, infection hyphae at early interaction of 2 h respectively. The arrow indicated the signal of GUS staining, and the number of plus sign was shown according to the strength of staining blue after at least 5 times observations. All the picture were viewed 200 magnification. (For interpretation of the references to colour in this figue legend, the reader is referred to the web version of this article.)

Y. Wang et al. / Microbial Pathogenesis 47 (2009) 78–86

81

Fig. 4. Expression analysis using RT-PCR and histochemical staining of GUS activity during early infection. A) Histochemical staining activity in Phytophthora sojae expressing GUS gene governed by PsCZF1 promoter or constitutive promoter pHam34 during early infections at 30 min, 1 h and 2 h post-inoculation. The arrow indicated the signal of GUS staining, and the number of plus sign was shown according to the strength of staining blue after at least 5 times observations. All the pictures were viewed 200 magnifications. B) RT-PCR analysis for PsCZF1 expression upon infection. Mycelium inoculated on soybean cultivar Williams by the methods introduced by Chen et al. [25] during the indicated time courses. The upper panel corresponding to reaction using RT-PCR primers for PsCZF1, and down panel for control reactions of actinA. The sizes of amplicons were shown on the right. (For interpretation of the references to colour in this figue legend, the reader is referred to the web version of this article.)

strong expression of GUS during a 2 h infection (Fig. 4A). To independently confirm whether expression of PsCFZ1 was really induced during the early compatible interaction, we performed a semi-quantitative RT-PCR assay based on the reported inoculation method described by Chen et al. [25]. The infecting hyphae were harvested at 0, 0.5, 1.0, and 2.0 h post-inoculation (hpi). Fig. 4B shows that PsCZF1 was upregulated upon infection. GUS staining and RT-PCR analyses suggest that PsCZF1 was highly induced in oospores and upregulated in the invading hyphae. 2.4. Generation of PsCZF1-silenced lines Since the homology-dependent gene disruption strategy that has been widely used for fungus is still not available for Phytophthora [3], we tried to silence PsCZF1 using gene-silencing methods based on PEG-mediated protoplast stable transformation. Based on recently reported P. sojae transformation methods [22,23], we co-transformed an anti-sense PsCZF1 gene driven by the constitutive hsp70 promoter with the selected plasmids [26]. In total, 61 putative transformants could grow in the selection medium with 50 ug/ul G418 (Shanghai Sangon BS723), and were selected for further RTPCR analysis. Two of the transformants (T6 and T16) generated very faint or no band after 35 cycles of PCR. In contrast, the untransformed wild type and 59 other putative transformants showed high gene expression, while the reference actinA gene was expressed at similar levels (Fig. 5A). Subsequently, quantitative real-time RT-PCR was performed to determine the relative expression of PsCFZ1 in wild type P6497 (WT), a strain only expressing the selection gene (CK), and the two assumed silenced lines (T6 and T16). A significant reduction (>80% decrease) in PsCZF1 expression was observed in the T6 and T16 silenced lines (Fig. 5B); therefore, successful silencing of PsCFZ1 had been achieved. Furthermore, southern blot analysis of T6 revealed that extra multi-copies of PsCZF1 had been integrated into the genome in T6 transformants (Fig. 5C). The results suggest that we

had obtained two independent PsCZF1-deficient transformant strains, T6 and T16, which were used for further studies. 2.5. PsCZF1 contributes to growth and development of P. sojae We compared the phenotypes of the two silenced transformants (T6 and T16) and the controls throughout their life cycle. The controls included wild type strain (WT, P6497) used for the transformation recipient and a strain only expressing the selection gene (CK). The production of oospores was markedly reduced in PsCZF1-silenced strains, which produced an average of six (T6) and nine (T16) oospores in a 1 cm2 zone around the inoculation site; the controls produced 42 (WT) and 44 (CK) oospores, which represents a significant difference from the PsCZF1-silenced strains based on a two-tailed t-test (P < 0.01) (Fig. 6; Table 2). Silencing of PsCZF1 was not associated with changes in hyphal morphology, including cell size (data not shown). However, the growth rates of T6 and T16 were around 50% lower than those of the controls, and this phenotype was repeatable even after over ten times subculture (Fig. 7; Table 2). We found that the size of sporangia did not show variation. In contrast, zoospore release in the PsCZF1sileniced lines was less efficient; from the equivalent amount of sporangia, both silenced lines produced 2  103 zoospores/ml, while the control produced 4  104 zoospores/ml. Germination ratio of encysted zoospores and the length of germ tubes were also significantly reduced in silenced lines (Fig. 8A, B; Table 2). The average percentage germination of the silenced strains was 19% (T6) and 20% (T16), compared with 57% (WT) and 49% (CK) in the controls, which represents a significant difference based on a two-tailed t-test (P < 0.01) (Fig. 8A). The average length of germ tubes in the two silenced strains was 8.4 mm (T6) and 8.3 mm (T16) after 8 h, while control germ tubes were 21 mm long, giving a significant difference based on a two-tailed t-test (P < 0.01) (Fig. 8B).

82

Y. Wang et al. / Microbial Pathogenesis 47 (2009) 78–86

A

M

WT

CK

T1

T3

T4

T6

T9

T11

T16

T41

RTase+

(bp) 365

RTaseactinA

Relative expression

B

250

C

P<0.01 1.4

WT

T6

(kb) 8.2

1.2 1.0

5.0

0.8 0.6

3.2

0.4 0.2 0.0

WT

CK

T6

2.0

T16

Fig. 5. Generation of PsCZF1-silenced lines. A) RT-PCR evaluation of PsCZF1 gene expression level using hyphae RNA from recipient strain 6497) or the indicated transformants. Reactions included PsCZF1 under normal RT-PCR condition RTaseþ (upper panel) or reverse transcriptase being omitted RTase (medium panel), and actinA (down panel). B) Relative expression of PsCZF1 in silenced lines. Error bars represent 95% confidence intervals calculated using three technical replicates for each sample within the Real-Time PCR assay. C) Southern blot analysis of plasmid integration in the recipient and transformants. Genomic DNA was digested with Hind III. The coding region of PsCZF1 was used as a probe. Marker in kilobases (kb) is indicated on the right.

2.6. PsCZF1 is essential for virulence on soybean plants

sequenced oomycete genome and was distinct from that of other true fungi. Histochemical staining of GUS activity indicated that PsCZF1 was significantly upregulated in oospores and invading hyphae during infection. Subsequently, functional studies demonstrated that PsCZF1 was important for growth, development, and virulence on host soybean plants.

To determine the effect of PsCZF1 silencing on virulence, we used the hypocotyl inoculation assay [27] to measure virulence in the susceptible soybean cultivar Williams. Ten days seedlings of soybean cultivar Williams were inoculated by controls, and nonsilenced and silenced lines. Lesions at infection sites on soybean spread and the seedlings was killed at 4 days post-inoculation when the controls and non-silenced lines were inoculated; in contrast, the two silenced lines did not have widespread lesions, and the seedlings were healthy under the exact same conditions (Fig. 9A; Fig. S4). Considering that the silenced lines grew more slowly than the controls, we observed these seedlings by inoculated silenced lines for 8 days post-inoculation and found that no seedling was killed, and the necrosis region only spread slowly (Fig. 9B).

3.1. The PsCZF1 gene represents a distinct C2H2 zinc finger protein We identified a family of oomycete C2H2 zinc finger proteins (CZF1) using motif identification from the released oomycete genomes and EST sequence database. The PsCZF1, PrCZF1, PiCZF1, and HpCZF1 proteins resembled ScMsn2 in C-terminus localization of C2H2-type zinc finger motifs; however ScMsn2 had two motifs, while oomycete CZF1 contained four (Fig. 2). Interestingly, we only found sequence similarity between oomycete CZF1 and ScMsn2 or other fungal C2H2-type zinc finger proteins in the zinc finger motif regions (Fig. 2). Although C2H2-type zinc finger motifs are widespread in the Phytophthora genome, only CZF1 had a tandem of four C-terminus-localized C2H2-type zinc finger motifs. Thus, the evidence suggests that PsCZF1 is an oomycete-specific zinc finger protein and that its functions might be conserved in this oomycete, although the mechanism is unclear. The element 50 -CCCCT-30 ,

3. Discussion The C2H2 zinc finger proteins (zf-C2H2) constitute one of the largest transcription factor families in eukaryotes [28]. In this paper, we provide first report of a putative C2H2 zinc finger transcription factor, PsCZF1, from P. sojae. The protein was conserved in the

A

B 60

WT

CK

Number of oospores

P<0.01 50 40 30 20 10 0

T6

T16

WT

CK

T6

T16

Fig. 6. Characterizations of oospore production. Oospore production was tested by incubating controls and PsCZF1-silenced transformants on 10% V8 agar media after 7 days (See Methods). Micro-photographs were taken with Leica DC100DC 350F digital camera, and calculated the numbers of oospores in 1 cm2 zone around inoculation site at least four times duplications.

Y. Wang et al. / Microbial Pathogenesis 47 (2009) 78–86

83

Table 1 The used oligonucleotides in this study. Gene

Primer name

Primer sequence

Application

Expected Size

PsCZF1

PsCZF1F1 PsCZF1R1 PsCZF1F3 PsCZF1R3 PsCZF1F4 PsCZF1R4 pPsCZF1F pPsCZF1R GUSF GUSR actinAF1 actinAR1 actinAF2 actinAR2

ATGAGTAGCACCGTCGCGG CTAGTTATCACTCTCCACAGA AGTTTCGCGGGCGCTCCGAGC CTAGTTATCACTCTCCACAGA CAGTAGTCCCAGCAGCACAG TGGGCTTCGAGTACATCTCC AGCAAGCTTCAATTATAATCGGAGTATAAATC GCGCCCGGGGGCTCGTGGGATAGATCTCCT ATGTACGTCCTGTAGAAACC TCATTGTTTGCCTCCCTGCTG GTACTGCAACATCGTGCTGTCG TTAGAAGCACTTGCGGTGCACG ACTGCACCTTCCAGACCATC CCACCACCTTGATCTTCATG

Cloning, construction

1479

PsCZF1 promoter GUS actinA

RT-PCR

365

Real-time RT-PCR

140

Cloning, construction

1000

Construction

1809

RT-PCR

250

Real-time RT-PCR

165

The restriction sites used for cloning were underlined.

which is found in around 200 gene promoter regions, has been identified as the target of ScMsn2 in S. cerevisiae [29]; the oomycete element can bind with CZF1 although the downstream regulated genes are still unknown. 3.2. Effect of PsCZF1-deficiency on growth and development To investigate the function of the oomycete CZF1 genes, we used PsCZF1 as an example and made silenced PsCZF1 transformants by stable transformation of P. sojae with an anti-sense PsCZF1 construct. In P. infestans, sense, anti-sense, promoter-free, and reverse-inverted (hairpin) constructs, and a transient genesilencing strategy based on RNAi, can successfully silence target genes [17,30–34]. Previously, we generated P. sojae PsGPA1-silenced mutants [35] by stable transformation. In this study, the two successful PsCZF1-silenced transformants were obtained using the same strategy. The silencing efficiency was still low and we identified two gene expression deficient lines after screening over 50 putative transformants of PsCZF1 (this study) or PsGPA1 [35]. However, this strategy, together with over-expression technology [23], might serve as robust techniques for functional analysis of other interesting genes in P. sojae. P. sojae reproduces both sexually and asexually. Sexual sporulation increases genetic fitness and diversity and provides a durable agent for spreading disease; while asexual reproduction generates zoospores that are the main agent for rapid dispersal of the disease [4]. The GUS reporter gene has been used to address spatial and temporal gene expression patters in P. infestans [36]. Here, we

found that PsCZF1 promoter-driven GUS was strongly induced in oospores and upregulated in planta, which is consistent with RTPCR analysis. Gene-silenced lines of PsCZF1 in P. sojae revealed that this gene is involved in several development stages, hyphal growth, production of oospores, sporangia, swimming zoospores, and in cyst germination. Surprisingly, the GUS reporter was not found in either zoospores or germinating cysts, although the gene is required for production of zoospores and for cysts germination. This was perhaps caused by the low expression level of PsCZF1 that was not detected by histochemical staining of GUS. The function of PsCZF1 was presumably mediated through its effects on genes required for these stages. Similarly, many C2H2-type transcription factors have been described in fungi that are involved in regulating growth and development correct responses to a variety of external and internal stresses [10,12–14,37–39]. Nevertheless, as our knowledge, this is the first report of a C2H2-type transcription factor requiring for oomycetes development and pathogenesis. 3.3. PsCZF1 is required for virulence Virulence in both PsCZF1-silenced lines was severely affected. Because silencing of PsCZF1 affected growth rate, and the growth is obviously important to virulence, we extended the time after inoculation to 8 days and found that infection was still in a limited level. In addition, in GUS staining and RT-PCR analyses during early infection stages, PsCZF1 was upregulated, indicating that it was involved in the infection process. Therefore, we concluded that PsCZF1-silenced lines lost the virulence caused by direct ways

Table 2 Characterizations of PsCZF1-silenced mutants and wild-type strain and control strain.

Oospore productiona Hyphal growth (cm)b Zoospore production (104/ml)c Encystment (%)d Cyst germination (%)e Germ tube length (mm)f Virulence (4 dpi)g

WT

CK

T6

T16

44  4 0.48  0.06 4  0.6 98  11 0.57  0.10 38.05  7.65 V

42  5 0.42  0.09 3  0.8 99  10 0.51  0.08 33.64  4.58 V

93 0.29  0.04 0.2  0.1 96  12 0.19  0.07 19.32  10.20 Av

61 0.26  0.05 0.15  0.1 98  10 0.21  0.08 21.06  15.09 Av

a Oospore production were performed on 10% V8 media. For these and other data in the table, values represent mean  standard deviation, which were calculated in at least three replicates. b Based on 5 days of growth on 10% V8 media. c Counting all zoospores of three microliter zoospore suspension after three times of washing and cold shock at 10  C followed by 30 min at 25  C. d Percent of zoospores forming cysts after 1 min of strongly vortexing, based on counting a minimum 100 zoospores from each strain. e Percent of zoospore cysts forming germ tube after 4 h in 10% V8 liquid, based on counting a minimum of 100 cysts from each strain. f The length of germ tubes formed from cysts for 8 h in 10% V8 liquid, the average based on counting a minimum of 60 germinated cysts from each strain. g Ten-day-old seedlings of soybean cultivar Williams were inoculated on the hypocotyls by controls (Wt and CK) or PsCZF1-silenced transformants (T6 and T16) and assessed at 4 dpi. V and Av indicated virulence and non-virulence, respectively.

84

Y. Wang et al. / Microbial Pathogenesis 47 (2009) 78–86

A

4. Methods and materials WT

CK

T6

T16

4.1. Gene identification and domain elucidation

B

0.60 P<0.01

Growth per Day (cm)

0.50 0.40 0.30 0.20 0.10 0.00

WT

CK

T6

T16

Fig. 7. Grown characterizations of the transformants on V8 media. A) Photographs were taken at 4 days after incubation on V8 media. B) Statistics of data of growth rate based on 4 days of growth on 10% V8 media. All data were treated with t-test, significant difference at p < 0.01 level.

and/or indirect ways through the growth and development, and PsCZF1 was essential to the full virulence on its host. Fungal CRZ1 acted as a signaling effector of calcineurin to regulate the virulence in many fungal pathogens, such as B. cinerea [12], A. fumigatus [10,11], C. albicans [13]; And in U. maydis, Biz1, a zf-C2H2 transcription factor, was required for plant invasion through regulating the levels of a mitotic cyclin [15]. Future microarray analysis of PsCZF1-silenced lines will allow us to identify the cis elements that bind PsCZF1 and thus unravel the functions of PsCZF1 and its signaling pathways in pathogenesis. Based on our data, we suggest that PsCZF1 is a key regulator in P. sojae for growth, development, and pathogenesis, and that it might be conserved in oomycete pathogens. Our data began to elucidate the essential signaling pathway that controls oomycete pathogen growth, development, and pathogenesis, and that might be a target for developing novel strategies for disease management. Also, the developed gene-silencing technology, together with the available and still increasing P. sojae genome and transcriptome data [20], will provide a good perspective and platform to address pathogenesis mechanisms in P. sojae and other oomycete pathogens.

4.2. Plasmid construction and P. sojae manipulation P. sojae strain P6497 was kindly provided by Prof. Tyler in Virginia Bioinformatics Institute at Virginia Tech, and maintained at 25  C in the dark on 10% V8 juice agar medium as described in Erwin and Ribiero [4]. PsCZF1, PsCZF1 promoter region and GUS genes were obtained by amplifying from P6497 gDNA or plasmid pBI121 with the combination of corresponding oligonucleotides (Table 1) under the following conditions: 2 min at 94  C, 30 s at 94  C; 30 s at 52  C; 120 s at 72  C for 30 cycles. The PCR products were cloned in pMD18-T vectors, and confirmed by sequencing. To make the anti-sense construct of pHspCzf1, we used the above sequenced PsCZF1 in the vector of pMD18-T as template to amplify PsCZF1 with the primers PsCZF1F and PsCZF1R. The PCR product was inserted Sma I-digested pTH210 [26]. The anti-sense construct, pHspCzf1, was screened and confirmed by sequencing. The PsCZF1 promoter region PCR fragment was digested with Kpn I and Hind III and cloned into Kpn I-Hind III-digested vector pHam34 [26], resulting in pCZFHam34. To construct vector

B 30.0 70

Germ Tube Length (um)

Cyst Germination Percent

A

CX2–4CX12HX2–6H (C, Cys; H, His; and X, any residue) motif(s) were searched in the released P. sojae genome sequence (http://vmd. vbi.vt.edu). The candidate sequences were determined through manual revision and checked by submitting sequences to Prosite pattern available on the web (http://www.expasy.org/prosite) for conserved function-discriminating residues. Once manually revised and annotated, putative C2H2 transcription factors were TBLASTN against the whole genome to identify C2H2-TFs not found by the above methods. The orthologs of PsCZF1 gene in sequenced oomycete genome, including P. ramorum (http://www.jgi.doe.gov), H. parasitica (http://annuminas.vbi.vt.edu), and P. infestans (http://www.broad. mit.edu) were identified using TBALST algorithm. The multiple alignments were performed using EBI Clustal W2 and default parameters. The specificity of CZF1 was also tested using BLAST search against the known fungal genomic sequence databases and public databases. Protein secondary structure prediction was evaluated on at the PSIPRED protein structure prediction server [40], and phylogenetic dendrograms were constructed by MEGA 4.0 [41], with the minimum evolution algorithms using 1000 bootstrap replications. The 1000 nucleotides located upstream of start codon of PsCZF1 from P. sojae genome sequence, was obtained and designed it to the promoter of PsCZF1.

P<0.01

60 50 40 30 20 10 0

WT

CK

T6

T16

P<0.01 25.0 20.0 15.0 10.0 5.0 0.0

WT

CK

T6

T16

Fig. 8. Characterizations of zoospore germination ratio and the germ tube length. A) The percent of zoospores germination. Percent of zoospore cysts forming germ tube after 4 h in 10% V8 liquid, based on a minimum of 100 cysts from each strain. B) The length of germ tubes. The length of germ tubes (um) formed from cysts for 8 h in 10% V8 liquid, the average based on counting a minimum of 60 germinated cysts from each strain.

Y. Wang et al. / Microbial Pathogenesis 47 (2009) 78–86

85

Fig. 9. PsCZF1-silenced transformants lose the virulence on the susceptible host plants. Ten-day-old seedlings of soybean cultivar Williams were inoculated on the hypocotyls by controls (Wt and CK) or PsCZF1-silenced transformants (T6 and T16), then photographs were taken 4 days A) or 8 days B) post-inoculation DPI), respectively. The experiments were repeated for 5 times and at least 15 seedlings were used for each inoculation.

expressing GUS, we digested pCZFHam34 or pHam34 with Sma I, respectively, and Gus was inserted into the two vectors at sense orientation, and sequenced to confirm the accuracy of the whole open reading frame. We transformed P. sojae by PEG-mediated protoplast transformation strategy [22,23] with the 1:3 combination of the selection plasmids pHspNpt [26] and the target plasmids, including anti-sense construct of PsCZF1, and GUS expression vector driven by the promoter of PsCZF1 or Ham34 gene. 4.3. Analysis of P. sojae development in the different stages

Total RNA was isolated from P6497 and the putative transformants hyphae, sporulating hyphae, zoospores, cysts and germinating cysts, using NucleoSpin RNA II (Macherey-Nagel) following the manufacturer’s protocol, respectively. The integrity of total RNA was confirmed using agarose gel electrophoresis. To remove contaminating genomic DNA in RNA preparations, 10 ug of total RNA was treated with 4 units of RNase-free DNase I (Takara) at 37  C for 30 min. To investigate the efficiency of PsCZF1 gene silencing in the putative transformants, semi-quantitative RT-PCR was performed by the following steps: First-strand cDNA was synthesized using M-MLV reverse transcriptase (RNase-free) and oligo (dT) 18 primer (Invitrogen); PCR for PsCZF1 was amplified with the primers of PsCZF1F3 and PsCZF13R under the condition: 94  C for 1 min, followed by 33 cycles of 94  C for 30 s, 52  C for 30 s, and 72  C for 30 s, and a final extension of 72  C for 10 min. P. sojae actinA gene was used as reference and PCR condition is 94  C for 1 min, followed by 24 cycles of 94  C for 30 s, 59  C for 30 s, and 72  C for 30 s, and a final extension of 72  C for 10 min with the primers of actinAF1 and actinAR1. The complete removal of all DNA was validated in a PCR under the same conditions as those used for the RT-PCR, except that the cDNA synthesis step at 37  C was omitted.

For growth assays, the recipient strain P6497 and the silenced lines were subcultured twice, and then cultured on 10% V8 juice agar medium. The semidiameter of each clone was measured after 4 days culture and the experiments were repeated in three times with five replications in each. Mating was performed on 10% V8 media and oospores of P6497 or transformants were separated from mycelium and calculated in the microscope as described by Erwin and Ribiero [4]. A mycelium plug (Ø ¼ 7 mm) was cut from a fresh P. sojae culture and placed exactly in the middle of the 10% V8 Petri dish for 7 days in the dark. Then oospore-mycelial mats in 1 cm2 zone around inoculation site were harvested and comminuted with homogenizer (Fluko) for 2 min. The suspension was countered with microscope three times. To obtain non-sporulating hyphae, P. sojae wild type strain P6497 or the transformants hyphal tip were inoculated in 20 ml of sterile clarified 10% V8 juice in 90-mm Petri dishes. After three days stationary culture, the sporulating hyphae was washed by sterile distilled water over three times until the zoospores were released. Zoospores were filtered by miracloth (Calbiochem, 475855) and collected by centrifugation at 2000 g for 10 min [42]. Encysted zoospores or cysts were obtained by strongly vortexing zoospores suspension for 60 sec, and centrifuge at 2000 g for 10 min; encysted zoospores were germinated in clarified 5% V8 broth for 1 h, and the length of germ tubes were measured in clarified 5% V8 broth for 2 h. Sporangium or zoospores production efficiency and encysted zoospores germination of wild type strain and the transformants were compared for at least three times.

Primer pairs PsCZF1F4 and PsCZF1R4, actinAF2 and actinAR2 (Table 1) were designed to anneal specifically to PsCZF1 and actinA of P. sojae by Primer3 (v. 0.4.0, http://frodo.wi.mit.edu/) for realtime RT-PCR analysis. Template cDNA was derived from mycelium grown in 10% V8 broth for four days. The actinA gene from P. sojae was used as a constitutively expressed endogenous control, and the expression of PsCZf1 in mycelium of different lines were determined relative to actinA as followed by ABI 7300 Sequence Detection System (Applied Biosystems, USA) using the intercalation of SYBR Green as a fluorescence reporter and guidelines. The expression of PsCZF1 in WT cDNA was assigned to the values of 1.0. to allow comparison to be made between lines. RT-PCR assays for the expression of PsCZF1 were carried out two times and each three technical replicates.

4.4. DNA and RNA manipulation of P. sojae

4.6. Histochemical staining of GUS and observation

Genomic DNA (gDNA) of P. sojae strain and the putative transformants strains were isolated from hyphae grown in 10% V8 liquid medium following the protocol described by Tyler et al. [27]. DNA blots were performed using DIG kit I (Roche Applied Science 11 745 832 910) with probe of the coding region of PsCZF1 labeled by DIGdUTP alkali-labile. 5 ug gDNA of P6497 or PsCZF1-silenced transformants were respectively cut by several desirable restriction enzymes, and manipulated by the provided protocols.

The histochemical assay for GUS expression in the transformants of P. sojae during life stages and infection vs. soybean Williams were performed as described by Van West et al. [43] and Chen et al. [25]. GUS activity was visualized by staining with 0.1% 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid in 50 mM NaPO4 (pH 7.0), 0.33 mM K3Fe(CN)6, 0.33 mM K4Fe(CN)6, and 0.1% Triton X-100. For observation of GUS during life stage and invading hyphae in the early infections, the P. sojae transformants

4.5. SYBR green real-time RT-PCR assay

86

Y. Wang et al. / Microbial Pathogenesis 47 (2009) 78–86

were inoculated in the staining solution for 12 h at 37  C and observed under the microscopes. 4.7. Soybean inoculation assay For plant inoculation, The recipient strain P6497 and PsCZF1silenced lines were twice subcultured on lima bean agar medium for 4 days, then inoculated on soybean cultivar Williams by hypocotyl inoculation methods Tyler [27]. The experiments were repeated in five times and 15 seedlings were used for each. The leafinoculation method was used for RT-PCR analysis in the early infection as describes by Chen et al. [25], interaction time courses were set at 0, 0.5, 1, and 2 h, respectively. Notes: Sequence data from this article can be found in the GenBank/EMBL database under accession number P. sojae (PsCZF1, EU912575 and other sequences including, P. infestans (PiCZF1, FJ236069), P. ramorum (PrCZF1, FJ236070), and H. parasitica (HpCZF1, FJ236071). Acknowledgments This research was supported by the National ‘‘973’’ Project (2009CB119202), NSFC project (30671345) to W.Y.C. Appendix. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi: 10.1016/j.micpath.2009.04.013. References [1] Baldauf SL, Roger AJ, Wenk-Siefert I, Doolittle WF. A kingdom-level phylogeny of eukaryotes based on combined protein data. Science 2000;290:972–7. [2] Fry W. Phytophthora infestans: the plant (and R gene) destroyer. Mol Plant Pathol 2008;9:385–402. [3] Tyler BM. Phytophthora sojae: root rot pathogen of soybean and model oomycete. Mol Plant Pathol 2007;8:1–8. [4] Erwin DC, Ribiero OK. Phytophthora diseases worldwide. APS Press; 1996. [5] Judelson HS, Blanco FA. The spores of Phytophthora: weapons of the plant destroyer. Nat Rev Microbiol 2005;3:47–58. [6] Prakob W, Judelson HS. Gene expression during oosporogenesis in heterothallic and homothallic Phytophthora. Fungal Genet Biol 2007;44:726–39. [7] Miller J, McLachlan AD, Klug A. Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J 1985;4:1609–14. [8] Fox AH, Liew C, Holmes M, Kowalski K, Mackay J, Crossley M. Transcriptional cofactors of the FOG family interact with GATA proteins by means of multiple zinc fingers. EMBO J 1999;18:2812–22. [9] Polekhina G, House CM, Traficante N, Mackay JP, Relaix F, Sassoon DA, et al. Siah ubiquitin ligase is structurally related to TRAF and modulates TNF-alpha signaling. Nat Struct Biol 2002;9:68–75. [10] Soriani FM, Malavazi I, da Silva Ferreira ME, Savoldi M, Von Zeska Kress MR, de Souza Goldman MH, et al. Functional characterization of the Aspergillus fumigatus CRZ1 homologue, CrzA. Mol Microbiol 2008;67:1274–91. [11] Cramer Jr RA, Perfect BZ, Pinchai N, Park S, Perlin DS, Asfaw YG, et al. Calcineurin target CrzA regulates conidial germination, hyphal growth, and pathogenesis of Aspergillus fumigatus. Eukaryot Cell 2008;7:1085–97. [12] Schumacher J, de Larrinoa IF, Tudzynski B. Calcineurin-responsive zinc finger transcription factor CRZ1 of Botrytis cinerea is required for growth, development, and full virulence on bean plants. Eukaryot Cell 2008;7:584–601. [13] Karababa M, Valentino E, Pardini G, Coste AT, Bille J, Sanglard D. CRZ1, a target of the calcineurin pathway in Candida albicans. Mol Microbiol 2006;59: 1429–51. [14] Chang YC, Wright LC, Tscharke RL, Sorrell TC, Wilson CF, Kwon-Chung KJ. Regulatory roles for the homeodomain and C2H2 zinc finger regions of Cryptococcus neoformans Ste12alphap. Mol Microbiol 2004;53:1385–96. [15] Flor-Parra I, Vranes M, Kamper J, Perez-Martin J. Biz1, a zinc finger protein required for plant invasion by Ustilago maydis, regulates the levels of a mitotic cyclin. Plant Cell 2006;18:2369–87. [16] Blanco FA, Judelson HS. A bZIP transcription factor from Phytophthora interacts with a protein kinase and is required for zoospore motility and plant infection. Mol Microbiol 2005;56:638–48.

[17] Judelson HS, Tani S. Transgene-induced silencing of the zoosporogenesisspecific NIFC gene cluster of Phytophthora infestans involves chromatin alterations. Eukaryot Cell 2007;6:1200–9. [18] Tani S, Kim KS, Judelson HS. A cluster of NIF transcriptional regulators with divergent patterns of spore-specific expression in Phytophthora infestans. Fungal Genet Biol 2005;42:42–50. [19] Tyler BM, Tripathy S, Zhang X, Dehal P, Aerts A, Jiang RH, et al. Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 2006;313:1261–6. [20] Lamour KH, Win J, Kamoun S. Oomycete genomics: new insights and future directions. FEMS Microbiol Lett 2007;274:1–8. [21] Iuchi S. Three classes of C2H2 zinc finger proteins. Cell Mol Life Sci 2001;58:625–35. [22] McLeod A, Fry BA, Zuluaga AP, Myers KL, Fry WE. Toward improvements of oomycete transformation protocols. J Eukaryot Microbiol 2008;55: 103–9. [23] Dou D, Kale SD, Wang X, Chen Y, Wang Q, Jiang RH, et al. Conserved C-terminal motifs required for avirulence and suppression of cell death by Phytophthora sojae effector Avr1b. Plant Cell 2008;20:1118–33. [24] Enkerli J, Bhatt G, Covert SF. Nht1, a transposable element cloned from a dispensable chromosome in Nectria haematococca. Mol Plant Microbe Interact 1997;10:742–9. [25] Chen X, Shen G, Wang Y, Zheng X, Wang Y. Identification of Phytophthora sojae genes upregulated during the early stage of soybean infection. FEMS Microbiol Lett 2007;269:280–8. [26] Judelson HS, Tyler BM, Michelmore RW. Transformation of the oomycete pathogen, Phytophthora infestans. Mol Plant Microbe Interact 1991;4: 602–7. [27] Tyler BM, Forster H, Coffey MD. Inheritance of avirulence factors and restriction fragment length polymorphism markers in outcrosses of the oomycete Phytophthora sojae. Mol Plant Microbe Interact 1995;8:515–23. [28] Englbrecht CC, Schoof H, Bohm S. Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. BMC Genomics 2004;5:39. [29] Martinez-Pastor MT, Marchler G, Schuller C, Marchler-Bauer A, Ruis H, Estruch F. The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). EMBO J 1996;15:2227–35. [30] Whisson SC, Avrova AO, van West P, Jones JT. A method for double-stranded RNA-mediated transient gene silencing in Phytophthora infestans. Mol Plant Pathol 2005;6:153–63. [31] Walker CA, Koppe M, Grenville-Briggs LJ, Avrova AO, Horner NR, McKinnon AD, et al. A putative DEAD-box RNA-helicase is required for normal zoospore development in the late blight pathogen Phytophthora infestans. Fungal Genet Biol 2008;45:954–62. [32] van West P, Kamoun S, van’t Klooster JW, Govers F. Internuclear gene silencing in Phytophthora infestans. Mol Cell 1999;3:339–48. [33] Grenville-Briggs LJ, Anderson VL, Fugelstad J, Avrova AO, Bouzenzana J, Williams A, et al. Cellulose synthesis in Phytophthora infestans is required for normal appressorium formation and successful infection of potato. Plant Cell 2008;20:720–38. [34] Ah-Fong AM, Bormann-Chung CA, Judelson HS. Optimization of transgenemediated silencing in Phytophthora infestans and its association with smallinterfering RNAs. Fungal Genet Biol 2008;45:1197–205. [35] Hua C, Wang Y, Zheng X, Dou D, Zhang Z, Govers F. A Phytophthora sojae G protein {alpha} subunit is involved in chemotaxis to soybean isoflavones. Eukaryot Cell 2008;7:2133–40. [36] Tani S, Judelson H. Activation of zoosporogenesis-specific genes in Phytophthora infestans involves a 7-nucleotide promoter motif and cold-induced membrane rigidity. Eukaryot Cell 2006;5:745–52. [37] Hernandez-Lopez MJ, Panadero J, Prieto JA, Randez-Gil F. Regulation of salt tolerance by Torulaspora delbrueckii calcineurin target Crz1p. Eukaryot Cell 2006;5:469–79. [38] Maeta K, Izawa S, Inoue Y. Methylglyoxal, a metabolite derived from glycolysis, functions as a signal initiator of the high osmolarity glycerol-mitogenactivated protein kinase cascade and calcineurin/Crz1-mediated pathway in Saccharomyces cerevisiae. J Biol Chem 2005;280:253–60. [39] Medvedik O, Lamming DW, Kim KD, Sinclair DA. MSN2 and MSN4 link calorie restriction and TOR to sirtuin-mediated lifespan extension in Saccharomyces cerevisiae. PLoS Biol 2007;5:e261. [40] McGuffin LJ, Bryson K, Jones DT. The PSIPRED protein structure prediction server. Bioinformatics 2000;16:404–5. [41] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24: 1596–9. [42] Ward EWB, Lazarovits G, Unwin CH, Buzzell RI. Hypocotyl reactions and glyceollin in soybeans inoculated with zoospores of Phytophthora megasperma var. sojae. Phytopathology 1979;69:951–5. [43] van West P, de Jong AJ, Judelson HS, Emons AM, Govers F. The ipiO gene of Phytophthora infestans is highly expressed in invading hyphae during infection. Fungal Genet Biol 1998;23:126–38.