- Email: [email protected]
The receptor for advanced glycation end products RAGE is involved in corneal healing
Accepted Manuscript Title: The receptor for advanced glycation end products RAGE is involved in corneal healing Authors: Norbert Nass, Stefanie Trau, Friedrich Paulsen, Delia Kaiser, Thomas Kalinski, Saadettin Sel PII: DOI: Reference:
S0940-9602(17)30003-1 http://dx.doi.org/doi:10.1016/j.aanat.2017.01.003 AANAT 51123
To appear in: Received date: Revised date: Accepted date:
28-11-2016 9-1-2017 12-1-2017
Please cite this article as: Nass, Norbert, Trau, Stefanie, Paulsen, Friedrich, Kaiser, Delia, Kalinski, Thomas, Sel, Saadettin, The receptor for advanced glycation end products RAGE is involved in corneal healing.Annals of Anatomy http://dx.doi.org/10.1016/j.aanat.2017.01.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
The receptor for advanced glycation end products RAGE is involved in corneal healing
Norbert Nass1, Stefanie Trau1, Friedrich Paulsen2, Delia Kaiser3, Thomas Kalinski1, Saadettin Sel3 1
Department of Pathology, Otto von Guericke University Magdeburg, Leipziger Str.
44, D-39120 Magdeburg, Germany. 2
Department of Anatomy II, University of Erlangen-Nürnberg, Universitätsstr. 19, D-
91054 Erlangen, Germany 3
Department of Ophthalmology University of Heidelberg, Im Neuenheimer Feld 400,
69120 Heidelberg, Germany
Corresponding author PD Dr. Saadettin Sel Department of Ophthalmology University Heidelberg Im Neuenheimer Feld 400 69120 Heidelberg Germany Phone: +49 6221 56 35807, fax: +49 6221 56 5422 E-Mail: [email protected]
Abstract Impaired corneal healing is still a major cause of blindness. As RAGE (receptor for advanced glycation endproducts) is involved in inflammation and wound healing in other tissues, we here investigated its relevance for corneal wound healing. Corneal re-epithelialization after alkaline injury was analysed in an ex-vivo approach with cultured, enucleated eyes from mice either of the C57Bl/6 NChR genotype (RAGE +/+) and mice of the same strain lacking the RAGE gene (RAGE -/-). The wound area was determined time dependently by fluorescence imaging using fluorescein staining. The eyes of RAGE -/- mice showed a significantly slower reepithelialization than eyes of the RAGE +/- and the RAGE +/+ genotype. In immunohistochemistry, RAGE expression was increased in wounded corneas whereas the abundance of the RAGE ligand HMGB1 was unaffected, but an increase in S100b-like proteins was revealed upon injury. However, neither the addition of the RAGE agonist HMGB1 or an HMGB1 antagonising antibody nor bovine S100b protein to the culture medium of the wounded eyes had an effect on corneal wound closure in ex-vivo. Further gene expression analysis by RT-PCR demonstrated an increase in RAGE expression on the mRNA level, no significant regulation of HMGB1 and a differential regulation of the S100 gene family after alkaline burn of the cornea. In conclusion, RAGE is clearly involved in corneal re-epithelialization most probably mediated by signalling via S100 proteins.
Keywords: cornea; advanced glycation end products; RAGE; S100 proteins; HMGB1; wound healing
1. Introduction Impaired corneal wound healing is still a major cause of impaired vision, especially after alkaline burn, and strategies for treatment should be improved to avoid keratoplasty (Sharma et al., 2012; Bunker et al., 2014). In order to develop such new therapy strategies, a detailed understanding of the mechanism of corneal reepithelialization, especially the genes and signalling mechanisms involved is essential. The corneal epithelium is the outermost barrier against infections and injuries of the ocular surface. Upon wounding, the corneal epithelial cells respond by increased cell divisions, migration and differentiation processes in order to rapidly cover the lesion (Ljubimov and Saghizadeh, 2015). In particular the proliferation of the limbal stem cells, located at the outer rim of the corneal epithelium, and the migration and differentiation of these cells, play a pivotal role in the process of corneal wound healing (Castro-Muñozledo, 2013). Clinically strategies to accelerate corneal wound healing are the application of autologous serum, or the grafting of amniotic membrane to temporarily close the wounded area (Gomes et al., 2005; Rauz and Saw, 2010). In laboratory and animal experiments, the application of hematopoetic or limbal stem cells were found effective for the promotion of corneal wound healing (Rauz and Saw, 2010; Sel et al., 2012). Several other factors and genes have also been identified that are able to modify or improve the re-epithelialization of the cornea. These are growth factors such as nerve growth factor (Blanco-Mezquita et al., 2013) or insulin like factors (Hampel et al., 2013), factors associated with defence or inflammatory reactions such as the defensins (McDermott et al., 2003; Zhou et al., 2007; Garreis et al., 2010; Gao et al., 2010), trefoil factor family peptides, especially TFF3 (Paulsen et al., 2008; Schulze et al., 2014) and S100 calcium binding proteins (Garreis et al., 2011; Li et al., 2010, p. 100; Ryan et al., 2003; Sherstnev et al., 1994; Tong et al., 2014). These proteins and several other gene products presumably form a regulatory network influencing inflammation, cell division and cell differentiation during corneal reepithelialization. This system is still not understood satisfactorily to deduce effective therapy strategies to improve the corneal healing process. Corneal wound healing is often impaired in patients affected by diabetes (Winkler et al., 2014) and patients of old age (Rhim et al., 2010). Conditions that are often
characterized by accumulation of advanced glycation end products (AGEs) (Simm et al., 2008). AGEs represent a variety of non-enzymatic modifications of proteins and other biomolecules (Nass et al., 2007). Initially, a Schiff´s base is formed by the reaction of a reactive aldehyde such as glucose or methylglyoxal with an amino group, a reaction that is named after its discoverer Louis Camille Maillard (Maillard, 1912). After rearrangements, oxidations and further elimination reactions, the AGEs are formed as stable end products (Ahmad et al., 2014). These AGEs can be classified by their physicochemical properties as fluorescent, such as pentosidine or non-fluorescent such as carboxymethyl lysine (CML); as cross-linking, such as glyoxal- and methylglyoxal-lysine dimers (GOLD, MOLD) (Glomb and Monnier, 1995; Lederer and Klaiber, 1999) or non-cross linking AGEs (i.e. CML). Several AGEs are recognized by specific receptors, particularly the receptor for AGEs (RAGE), which is a pattern recognition receptor belonging to the immunoglobulin superfamily (Bierhaus et al., 2005). Other RAGE-ligands are the small calcium binding S100 proteins, HMGB-1 (amphoterin) protein and amyloid ß-protein (Schmidt et al., 2000; Alexiou et al., 2010; Lee and Park, 2013). The activation of RAGE by these ligands leads to the activation of signaling mechanisms involving reactive oxygen species, MAP-kinases and the NF-κB transcription factor, finally leading to a preinflammatory state (RAGE mediated downstream regulation of tumour necrosis factor- α (TNF- α ), interleukin-6 (IL-6), IL-1β, C-reactive protein (CRP)), which is considered to promote the development of age-associated, degenerative diseases (Bianchi et al., 2008; Nedić et al., 2013; Ott et al., 2014). In several studies, it has been shown that RAGE and its ligands, especially HMGB-1, promote healing of epidermal wounds (Ranzato et al., 2010; Zhang et al., 2012; Sorci et al., 2013). In this study, we analyse whether RAGE might also be involved in corneal reepithelialization after corneal alkali burn injury.
2. Materials and Methods
2.1 Reagents and antibodies Primary antibodies against RAGE, S100b, HMGB-1 were obtained from Santa Cruz (Heidelberg, Germany; RAGE: H-300 sc-5563), Dako cytomation (Hamburg, Germany; S100b: Z-0311) and Acris Antibodies (Herford, Germany; HMGB-1: NB100-2322SS). Primers were designed by using the primer blast online utility provided by NCBI (The National
Center
for
Biotechnology
Information
at
http://www.ncbi.nlm.nih.gov/tools/primer-blast/). In order to prevent genomic DNA amplification, the primers spanned at least one long intron. The primers were synthesized by biomers.net GmbH (Ulm, Germany). Table 1 summarizes the primer sequences and conditions used for semi-quantitative RT-PCR.
2.2 Ex-vivo wounding model All animal experiments were performed according to German law and with the appreciation of the local animal welfare committee. RAGE -/- animals (Constien et al., 2001) were obtained from Prof. Bierhaus and Prof. Nawroth (University of Heidelberg, Germany). All animals were bred in our local animal facility in a 12/12 h light/dark cycle at 25°C and 60% humidity. Male mice aged between 3 to 4 months were anesthetised by isoflurane (1%) and sacrificed by cervical dislocation. Eyes were removed immediately with forceps and kept in sterile PBS (phosphate-buffered saline) until transferred to 24-well plates (THP) which were prepared by filling with 1 mL paraffin. Eyes were immobilized with subcutaneous needles so that the corneas were facing upwards and then submerged in 1 mL PBS. After all eyes for an experiment were prepared, wounding was performed by NaOH-soaked (125mM) filter paper disks (diameter 1.4 mm; Whatman, Dassel, Germany) for two minutes. The filter disks were then removed and the eyes immediately washed with 1 mL PBS. Afterwards, PBS was replaced with 1mL DMEM/F12 medium (Gibco) supplemented with antibiotics (Pen/Strep Gentamicin, Actinomycin D; Promocell, Heidelberg, Germany) and effectors (HMGB-1(3µg/mL, Novus, Biologicals, Cambridge, UK), αHMGB-1 (10 µg/mL, Shino Test-Corporation, Kanagawa, Japan), S100b (10 µg/mL, Calbiochem, Darmstadt, Germany)). After two hours, the medium was removed, the eyes stained with fluorescein solution (Sigma-Aldrich, 0.5 % in PBS) and washed
twice with sterile PBS before fluorescence was immediately determined by using a fluorescence imaging system (Maestro-imager, Intas, Goettingen, Germany). Afterwards, medium was added and the eyes incubated at 37° in 5% CO2 in a humidified cell culture incubator until the next staining procedure. Wounded area of the corneas was determined from the fluorescence images by using the ImageJ software package (Schneider et al., 2012; https://imagej.nih.gov/ij/index.html). For immunohistochemistry, the eyes were fixed 24 h after wounding by PBS-buffered 4% formaldehyde solution.
2.3 Immunohistochemistry (IHC) Mouse corneas were wounded by sodium hydroxide soaked filter disks as described above. After 24 h incubation, eyes were fixed with formaldehyde (4%) diluted in PBS for about 24 h. Afterwards, the eyes were embedded in paraffin. The immunohistochemical experiments were performed as described previously (Sel et al., 2012). In brief, for immunodetection of RAGE, S100b and HMGB-1 antigens the following primary antibodies were used: polyclonal rabbit anti-RAGE (1:100), polyclonal rabbit anti-S100b (1:400) and polyclonal rabbit anti-HMGB-1 (1:200). After incubation with the primary antibody at 4°C overnight, the biotinylated secondary goat anti-rabbit biotinylated antibody (1:500, Vectastain ABC elite kit, Vector laboratories, Peterborough, UK) were applied for 2 h. Visualization was achieved using diaminobenzidine chromogen (DAB kit, Vector laboratories) according to the manufacturer's recommendations. After counterstaining with Mayer’s hemalum solution (Roth, Karlsruhe, Germany), the slides were examined under a light microscope (Zeiss Axioplan 2, Oberkochen, Germany). In each case, we used two negative control sections. One slide was incubated with the primary antibody only; and the other with the secondary antibody only. In the negative controls, there was no detectable immunoreactivity.
2.4 Gene expression studies in mouse cornea Eyes with wounded corneas were incubated for 24 h as described above. Afterwards, corneal epithelial cells were removed from the cornea of 8 mice using a hockey knife and immediately submerged in 250 µL Trizol solution. RNA was prepared as recommended by the manufacturer (Invitrogen, Darmstadt, Germany) and cDNA synthesis performed using a MMLV RNase H- reverse transcriptase (Promega,
Mannheim, Germany) and oligo dT18 primers (biomers.net GmbH, Ulm, Germany) at 42°C for 60 minutes with a final inactivation step of 70°C for 10 minutes as recommended
by
the
manufacturer
(Promega,
Mannheim,
Germany).
Semiquantitative PCR was performed in 20 µL reactions using Taq Polymerase (Bioline, Luckenwalde, Germany) with primer-specific annealing temperature and cycle number with 30 sec denaturation at 60°C, 30 sec annealing and 1 min synthesis at 72°. Finally, reactions were incubated for further 10 min at 72°C. In order to minimize the number of animals used in this study, we prepared RNA from a single experiment only. Six corneas were pooled for further analysis. cDNA was synthesized from the RNA samples three times and the PCR was performed repeatedly from these cDNA batches and the averaged results are presented here. After addition of loading buffer, samples were separated on 1.5% agarose gels containing ethidium bromide in TAE-buffer and visualized using a CCD-camera imaging system (GE-Healthcare, Freiburg, Germany). For quantification, cycle number was optimized to obtain clearly visible bands without saturating the PCR. Band intensities were determined from the gel images by using the ImageJ software package (Schneider et al., 2012). Data were normalized towards the GAPDH reference and expressed relative to control treatments. 2.5 Statistical Analysis The data were collected in Exel (Microsoft Corp.) and analysed with SPSS software (version 19, International Business Machines Corp.). After confirming normality of the data using a one sample Kolmogorov-Smirnov test we performed Kaplan-Meier analysis to compare the corneal wound healing process over time between RAGE (+/+), RAGE (+/-) and RAGE(-/-). The terminal event was defined as complete corneal wound healing at the respective point in time. Statistical significance between groups was analysed by log-rank test. A p-value less than 0.05 was considered as statistically significant.
3. Results
3.1
RAGE -/- and RAGE +/- mice showed slower closure of corneal alkaline injuries. We have recently described an ex-vivo model for the analysis of corneal wounding after alkaline burn (Sel et al., 2012, 2016). Freshly enucleated eyes were cultivated in serum free media after the corneas had been wounded by alkaline soaked filter paper disks. Under these conditions, the corneal wounds healed within 48 h after wounding (Fig. 1). In case of RAGE -/- and RAGE +/- corneas, the healing process was significantly gene dose dependently delayed (Fig. 1). The addition of the RAGEagonists, S100b, HMGB-1 and a neutralizing antibody against HMGB-1, did not modify the wound healing rate in RAGE +/+ corneas (Fig. 2).
3.2 RAGE, S100 but not HMGB-1 proteins accumulated after alkaline burn. Since RAGE -/- animals exhibited an impaired re-epithelialization, we analysed the protein accumulation in corneas after wounding of RAGE and its agonists S100proteins and HMGB-1 by immunohistochemistry in eyes from RAGE +/+ and -/animals. In normal corneal epithelium RAGE expression was weakly detectable by IHC. In RAGE +/+ corneas, the RAGE protein staining clearly increased within 24h at the wounded site (Fig. 3). For detection of S100 proteins we used an antibody raised against the human S100b protein. The immunoreactivity obtained with this antibody increased at the wounded site in RAGE +/+ as well as in RAGE -/- corneas (Fig. 3). In case of the HMGB-1 protein, we found high expression in the nuclei of corneal epithelial cells, but no change upon wounding in RAGE +/+ and RAGE -/- corneas (Fig. 3). We then performed an analysis of mRNA abundance in control and wounded corneas by RT-PCR with a focus on RAGE and its ligands, but also included the inflammatory interleukins IL-1β and IL-6 (Fig. 4). RAGE was upregulated in wounded corneas about 5.8-fold. Furthermore, the analysis showed that mRNA of several S100-isoforms was present in corneal epithelial cells. Significant expression was observed for the S100 A1, -4, -6, -7, -8, -9, -13 and -14 whereas only a very weak signal was obtained for S100z (data not shown). In case of S100b, S100 A2, -5 and S100g, we were not able to amplify any cDNA from the corneal samples (data not
shown). For S100b, this was further confirmed by the successful detection of mRNA from mouse cerebrum as a positive control (data not shown). S100–mRNA expression changes were only slightly different between RAGE +/+ and -/- control and wounded corneas. Significantly increased mRNA abundance after wounding was observed for S100 A4 (2.7-fold) and -8 (1.8-fold) whereas S100 A1, -6, -13 and -14 were downregulated more than 50%. These results were observed in both genotypes. Only the wound-induced S100 A4 up-regulation was slightly lower in the RAGE -/- mice. There was a small increase in IL-1β mRNA abundance in both genotypes, whereas IL-6 was downregulated only in the RAGE -/- corneas after wounding (Fig. 4).
4. Discussion RAGE and its ligands are involved in the progression of several degenerative diseases, including impaired wound healing. Especially the HMGB-1 RAGE axis has been described to be involved in heart diseases (Fukami et al., 2014), nephropathy (Nakamura et al., 2009; Cheng et al., 2015), multiple sclerosis (Sternberg et al., 2015) and wound and ulcer healing (Ranzato et al., 2010; Chen et al., 2011; Seol et al., 2012; Tancharoen et al., 2016). There are also reports on the interaction of RAGE with it S100 ligands in inflammation and wound healing (Li et al., 2010; Tong et al., 2014) on the ocular surface. We therefore investigated whether RAGE and its ligands, especially HMGB-1 and S100 family members, might be involved in corneal re-epithelialization. We analysed this by analysing eyes from RAGE-knock out and wild type mice (Constien et al., 2001) in an ex-vivo approach. Such ex-vivo experimental systems are accepted alternatives to animal experiments when significant pain is evoked as in corneal injuries. Here, ex vivo models applying pig (Bohnsack et al., 2014), rabbit (Deshpande et al., 2015; Pinheiro et al., 2015) or mice (Paulsen et al., 2008; Schulze et al., 2014; Sel et al., 2012, 2016) have been proven to give consistent results (Spöler et al., 2015). Nevertheless, whereas ex-vivo assays preserve the functions of corneal matrix, epithelium, epithelial stem cells and endothelium, systemic signals especially originating from the lacrimal glands are lost. In our experiments, the absence of the RAGE gene had an obvious effect on corneal re-epithelialization as corneas exhibited a gene-dosage dependent healing rate. This
was corroborated by immunohistochemistry that showed RAGE protein accumulation after wounding. RAGE mRNA was also upregulated in wounded corneas about 5fold, which correlates well with our IHC data and published data from other groups working on corneal neovascularisation upon alkaline burn or suturing of the cornea (Li et al., 2010; Lin et al., 2011). HMGB-1 expression remained unaltered, whereas S100 proteins clearly accumulated at the wounded site. Neither the addition of recombinant HMGB-1, nor the inhibition of HMGB-1 signalling by an inhibitory antibody had a significant effect upon re-epithelialization. Therefore, members of the S100-protein family seem to be involved in corneal wound healing. From the S100-family, proven interactors for RAGE are S100A1, S100b, S100p, S100-A12 (Prasad et al., 2009), but due to the high degree of sequence similarity of the S100-proteins it is likely that most S100 proteins do indeed interact with RAGE (Leclerc et al., 2009). Other authors have already suggested that peptides derived from S100b would accelerate corneal wound healing in rabbits (Krasnov et al., 1994; Sherstnev et al., 1994; Ziangarova and Olinevich, 2000), but in our hands, the addition of bovine S100b protein had no effect on corneal re-epithelialization in mice. Either the S100b protein was ineffective in our system, which can be due to the exvivo technique used and the concentrations that can be achieved here, or our wound healing system already works at a speed that cannot be improved any further. As the eyes were completely submerged, the ex-vivo situation is different to the situation in a whole animal where the ocular surface is only moistened by the tear film. We therefore suspect that the addition of effector molecules can be more efficient in-vivo due to higher local concentrations. Also, in the in-vivo situation the cornea is connected to the natural tear flow and therefore in contact with effector molecules secreted by the lacrimal glands and other ocular surface structures such as, for example, conjunctival epithelial cells or secretion products of the glands of Moll. We then performed a gene expression analysis of the S100 protein family in epithelial cells by RT-PCR. We were not able to demonstrate any expression of the S100b mRNA in the mouse cornea. Therefore, other S100-family members must be responsible for the observed increase in wounded corneas. The S100-proteins from mouse, which are most similar to the human S100b protein, are the S00A1- S100zand S100A4-proteins with 58%, 48% and 47% sequence identity, respectively. Deducing from our RT-PCR data on these S100 isoforms only S100A4 mRNA was upregulated in the wounded tissue. We, therefore, propose that this S100 protein
was most likely responsible for the increase in the S100 protein signal observed in the immunohistochemical study. Interestingly, the expression of several S100 proteins was reduced 24 h after wounding. Only a small subset of S100 proteins remained unchanged and, especially for S100A4, we observed a robust mRNA accumulation upon wounding. These data and its similarity to human S100b suggest that S100A4 is involved in the re-epithelialization process as it has indeed been proposed before (Ryan et al., 2003). Similar S100 regulation was observed in a study analysing neovascularisation in alkaline burnt corneas (Li et al., 2010). These authors have analysed S100 gene expression for a longer period of time and found that S100A4, S100A6, S100A8, S100A9, and S100A13 were upregulated upon wounding. The postulated activation of RAGE would result in increased inflammation mediated by activation of NF-κB. At least in Drosophila, NF-κB is required for wound repair, whereas in mammalian models there is evidence that NF-κB activation promotes neovascularisation (Lee et al., 2014) after alkaline burn. Nevertheless, RAGE activation often results in the generation of hydrogen peroxide as a signalling molecule (Daffu et al., 2013; Ott et al., 2014). Interestingly, a recent study could show that the addition of small amounts of hydrogen peroxide resulted in improved healing of wounded corneas (Pan et al., 2011). These data are in line with the idea that RAGE is activated by a ligand during the re-epithelialization process which causes the production of hydrogen peroxide as a signalling molecule, which further triggers cell migration and adhesion. However, others pointed out that the AGE-RAGE interaction inhibited this process through an excess of reactive oxygen (Shi et al., 2013). Our study clearly demonstrated that RAGE expression influences corneal reepithelialization and the data suggest that this is mediated by S100 proteins. Further studies with S100-knock out animals or the specific knock out of S100-family members at the mouse cornea are now needed to further prove the interaction of RAGE and S100 A4 in the process of corneal wound healing. Acknowledgements The authors wish to thank Prof. Bierhaus and Prof. Nawroth for providing the RAGE knock out mice for this study.
References Ahmad, S., Khan, M.S., Akhter, F., Khan, M.S., Khan, A., Ashraf, J.M., Pandey, R.P., Shahab, U., 2014. Glycoxidation of biological macromolecules: a critical approach to halt the menace of glycation. Glycobiology 24, 979–990. doi:10.1093/glycob/cwu057 Alexiou, P., Chatzopoulou, M., Pegklidou, K., Demopoulos, V.J., 2010. RAGE: a multi-ligand receptor unveiling novel insights in health and disease. Curr. Med. Chem. 17, 2232– 2252. Bianchi, R., Giambanco, I., Donato, I.R., 2008. S100B/RAGE-dependent activation of microglia via NF-κB and AP-1. Co-regulation of COX-2 expression by S100B and IL1β and TNF-α, Neurobiol. Aging 31, 665–677, http: //dx.doi.org/10.1016/j.neurobiolaging.2008.05.017. Bierhaus, A., Humpert, P.M., Morcos, M., Wendt, T., Chavakis, T., Arnold, B., Stern, D.M., Nawroth, P.P., 2005. Understanding RAGE, the receptor for advanced glycation end products. J. Mol. Med. 83, 876–886. doi:10.1007/s00109-005-0688-7 Blanco-Mezquita, T., Martinez-Garcia, C., Proença, R., Zieske, J.D., Bonini, S., Lambiase, A., Merayo-Lloves, J., 2013. Nerve growth factor promotes corneal epithelial migration by enhancing expression of matrix metalloprotease-9. Invest. Ophthalmol. Vis. Sci. 54, 3880–3890. doi:10.1167/iovs.12-10816 Bohnsack, R.N., Warejcka, D.J., Wang, L., Gillespie, S.R., Bernstein, A.M., Twining, S.S., Dahms, N.M., 2014. Expression of insulin-like growth factor 2 receptor in corneal keratocytes during differentiation and in response to wound healing. Invest. Ophthalmol. Vis. Sci. 55, 7697–7708. doi:10.1167/iovs.14-15179 Bunker, D.J.L., George, R.J., Kleinschmidt, A., Kumar, R.J., Maitz, P., 2014. Alkali-related ocular burns: a case series and review. J Burn Care Res 35, 261–268. doi:10.1097/BCR.0b013e31829b0037 Castro-Muñozledo, F., 2013. Review: corneal epithelial stem cells, their niche and wound healing. Mol. Vis. 19, 1600–1613. Chen, K.-B., Uchida, K., Nakajima, H., Yayama, T., Hirai, T., Rodriguez Guerrero, A., Kobayashi, S., Ma, W.-Y., Liu, S.-Y., Zhu, P., Baba, H., 2011. High-mobility group box-1 and its receptors contribute to proinflammatory response in the acute phase of spinal cord injury in rats. Spine 36, 2122–2129. doi:10.1097/BRS.0b013e318203941c Cheng, M., Liu, H., Zhang, D., Liu, Y., Wang, C., Liu, F., Chen, J., 2015. HMGB1 Enhances the AGE-Induced Expression of CTGF and TGF-β via RAGE-Dependent Signaling in Renal Tubular Epithelial Cells. Am. J. Nephrol. 41, 257–266. doi:10.1159/000381464 Constien, R., Forde, A., Liliensiek, B., Gröne, H.J., Nawroth, P., Hämmerling, G., Arnold, B., 2001. Characterization of a novel EGFP reporter mouse to monitor Cre recombination as demonstrated by a Tie2 Cre mouse line. Genesis 30, 36–44.
Daffu, G., del Pozo, C.H., O’Shea, K.M., Ananthakrishnan, R., Ramasamy, R., Schmidt, A.M., 2013. Radical roles for RAGE in the pathogenesis of oxidative stress in cardiovascular diseases and beyond. Int J Mol Sci 14, 19891–19910. doi:10.3390/ijms141019891 Deshpande, P., Ortega, Í., Sefat, F., Sangwan, V.S., Green, N., Claeyssens, F., MacNeil, S., 2015. Rocking media over ex vivo corneas improves this model and allows the study of the effect of proinflammatory cytokines on wound healing. Invest. Ophthalmol. Vis. Sci. 56, 1553–1561. doi:10.1167/iovs.14-15308 Fukami, K., Yamagishi, S.-I., Okuda, S., 2014. Role of AGEs-RAGE system in cardiovascular disease. Curr. Pharm. Des. 20, 2395–2402. Gao, N., Kumar, A., Jyot, J., Yu, F.-S., 2010. Flagellin-induced corneal antimicrobial peptide production and wound repair involve a novel NF-kappaB-independent and EGFRdependent pathway. PLoS ONE 5, e9351. doi:10.1371/journal.pone.0009351 Garreis, F., Gottschalt, M., Paulsen, F.P., 2010. Antimicrobial peptides as a major part of the innate immune defense at the ocular surface. Dev Ophthalmol 45, 16–22. doi:10.1159/000315016 Garreis, F., Gottschalt, M., Schlorf, T., Gläser, R., Harder, J., Worlitzsch, D., Paulsen, F.P., 2011. Expression and regulation of antimicrobial peptide psoriasin (S100A7) at the ocular surface and in the lacrimal apparatus. Invest. Ophthalmol. Vis. Sci. 52, 4914– 4922. doi:10.1167/iovs.10-6598 Glomb, M.A., Monnier, V.M., 1995. Mechanism of protein modification by glyoxal and glycolaldehyde, reactive intermediates of the Maillard reaction. J. Biol. Chem. 270, 10017–10026. Gomes, J.A.P., Romano, A., Santos, M.S., Dua, H.S., 2005. Amniotic membrane use in ophthalmology. Curr Opin Ophthalmol 16, 233–240. Hampel, U., Klonisch, T., Sel, S., Schulze, U., Garreis, F., Seitmann, H., Zouboulis, C.C., Paulsen, F.P., 2013. Insulin-like factor 3 promotes wound healing at the ocular surface. Endocrinology 154, 2034–2045. doi:10.1210/en.2012-2201 Keshava Prasad, T.S., Goel, R., Kandasamy, K., Keerthikumar, S., Kumar, S., Mathivanan, S., Telikicherla, D., Raju, R., Shafreen, B., Venugopal, A., Balakrishnan, L., Marimuthu, A., Banerjee, S., Somanathan, D.S., Sebastian, A., Rani, S., Ray, S., Harrys Kishore, C.J., Kanth, S., Ahmed, M., Kashyap, M.K., Mohmood, R., Ramachandra, Y.L., Krishna, V., Rahiman, B.A., Mohan, S., Ranganathan, P., Ramabadran, S., Chaerkady, R., Pandey, A., 2009. Human Protein Reference Database--2009 update. Nucleic Acids Res. 37, D767-772. doi:10.1093/nar/gkn892
Krasnov, M.M., Ziangirova, G.G., Malaeva, L.V., Bocharov, V.E., Olinevich, V.B., 1994. [Effects of protein S100 beta on the course of corneal healing in rabbits]. Vestn Oftalmol 110, 29–32. Leclerc, E., Fritz, G., Vetter, S.W., Heizmann, C.W., 2009. Binding of S100 proteins to RAGE: An update. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1793, 993–1007. doi:10.1016/j.bbamcr.2008.11.016 Lederer, M.O., Klaiber, R.G., 1999. Cross-linking of proteins by Maillard processes: characterization and detection of lysine-arginine cross-links derived from glyoxal and methylglyoxal. Bioorg. Med. Chem. 7, 2499–2507. Lee, E.J., Park, J.H., 2013. Receptor for Advanced Glycation Endproducts (RAGE), Its Ligands, and Soluble RAGE: Potential Biomarkers for Diagnosis and Therapeutic Targets for Human Renal Diseases. Genomics Inform 11, 224–229. doi:10.5808/GI.2013.11.4.224 Lee, H.S., Lee, J.H., Kim, C.E., Yang, J.W., 2014. Anti-neovascular effect of chondrocytederived extracellular matrix on corneal alkaline burns in rabbits. Graefes Arch. Clin. Exp. Ophthalmol. 252, 951–961. doi:10.1007/s00417-014-2633-3 Li, C., Zhang, F., Wang, Y., 2010. S100A proteins in the pathogenesis of experimental corneal neovascularization. Mol. Vis. 16, 2225–2235. Lin, Q., Yang, X.P., Fang, D., Ren, X., Zhou, H., Fang, J., Liu, X., Zhou, S., Wen, F., Yao, X., Wang, J.M., Su, S.B., 2011. High-mobility group box-1 mediates toll-like receptor 4dependent angiogenesis. Arterioscler. Thromb. Vasc. Biol. 31, 1024–1032. doi:10.1161/ATVBAHA.111.224048 Ljubimov, A.V., Saghizadeh, M., 2015. Progress in corneal wound healing. Prog Retin Eye Res. doi:10.1016/j.preteyeres.2015.07.002 Louis Camille Maillard, 1912. Action des acides amines sur les sucres: formation des melanoidines par voie methodique. C.R.Acad.Sci.Ser 2, 66–68. McDermott, A.M., Redfern, R.L., Zhang, B., Pei, Y., Huang, L., Proske, R.J., 2003. Defensin expression by the cornea: multiple signalling pathways mediate IL-1beta stimulation of hBD-2 expression by human corneal epithelial cells. Invest. Ophthalmol. Vis. Sci. 44, 1859–1865. Nakamura, T., Sato, E., Fujiwara, N., Kawagoe, Y., Ueda, Y., Suzuki, T., Yamada, S., Takeuchi, M., Fukami, K., Ueda, S., Adachi, H., Matsui, T., Okuda, S., Yamagishi, S., 2009. Positive association of serum levels of advanced glycation end products and high mobility group box-1 with asymmetric dimethylarginine in nondiabetic chronic kidney disease patients. Metab. Clin. Exp. 58, 1624–1628. doi:10.1016/j.metabol.2009.05.018
Nedić, O., Rattan, S.I., Grune, T., Trougakos, I.P., 2013. Molecular effects of advanced glycation end products on cell signalling pathways, ageing and pathophysiology. Free Radic Res. 47 Suppl 1:28-38. doi: 10.3109/10715762.2013.806798. Nass, N., Bartling, B., Navarrete Santos, A., Scheubel, R.J., Börgermann, J., Silber, R.E., Simm, A., 2007. Advanced glycation end products, diabetes and ageing. Z Gerontol Geriatr 40, 349–356. doi:10.1007/s00391-007-0484-9 Ott, C., Jacobs, K., Haucke, E., Navarrete Santos, A., Grune, T., Simm, A., 2014. Role of advanced glycation end products in cellular signaling. Redox Biol 2, 411–429. doi:10.1016/j.redox.2013.12.016 Pan, Q., Qiu, W.-Y., Huo, Y.-N., Yao, Y.-F., Lou, M.F., 2011. Low levels of hydrogen peroxide stimulate corneal epithelial cell adhesion, migration, and wound healing. Invest. Ophthalmol. Vis. Sci. 52, 1723–1734. doi:10.1167/iovs.10-5866 Paulsen, F.P., Woon, C.-W., Varoga, D., Jansen, A., Garreis, F., Jäger, K., Amm, M., Podolsky, D.K., Steven, P., Barker, N.P., Sel, S., 2008. Intestinal trefoil factor/TFF3 promotes re-epithelialization of corneal wounds. J. Biol. Chem. 283, 13418–13427. doi:10.1074/jbc.M800177200 Pinheiro, R., Panfil, C., Schrage, N., Dutescu, R.M., 2015. The Impact of Glaucoma Medications on Corneal Wound Healing. J. Glaucoma. doi:10.1097/IJG.0000000000000279 Ranzato, E., Patrone, M., Pedrazzi, M., Burlando, B., 2010. Hmgb1 promotes wound healing of 3T3 mouse fibroblasts via RAGE-dependent ERK1/2 activation. Cell Biochem. Biophys. 57, 9–17. doi:10.1007/s12013-010-9077-0 Rauz, S., Saw, V.P., 2010. Serum eye drops, amniotic membrane and limbal epithelial stem cells--tools in the treatment of ocular surface disease. Cell Tissue Bank 11, 13–27. doi:10.1007/s10561-009-9128-1 Rhim, J.H., Kim, J.H., Yeo, E.-J., Kim, J.C., Park, S.C., 2010. Caveolin-1 as a novel indicator of wound-healing capacity in aged human corneal epithelium. Mol. Med. 16, 527–534. doi:10.2119/molmed.2010.00046 Ryan, D.G., Taliana, L., Sun, L., Wei, Z.-G., Masur, S.K., Lavker, R.M., 2003. Involvement of S100A4 in stromal fibroblasts of the regenerating cornea. Invest. Ophthalmol. Vis. Sci. 44, 4255–4262. Schmidt, A.M., Yan, S.D., Yan, S.F., Stern, D.M., 2000. The biology of the receptor for advanced glycation end products and its ligands. Biochim. Biophys. Acta 1498, 99– 111. Schneider, C.A., Rasband, W.S., Eliceiri, K.W., 2012. NIH Image to ImageJ: 25 years of image analysis. Nat Meth 9, 671–675. doi:10.1038/nmeth.2089
Schulze, U., Hampel, U., Sel, S., Contreras-Ruiz, L., Schicht, M., Dieckow, J., Diebold, Y., Paulsen, F., 2014. Trefoil factor family peptide 3 (TFF3) is upregulated under experimental conditions similar to dry eye disease and supports corneal wound healing effects in vitro. Invest. Ophthalmol. Vis. Sci. 55, 3037–3042. doi:10.1167/iovs.13-13423 Sel, S., Schilling, U.M., Nass, N., Simm, A., Garreis, F., Knak, M., Storsberg, J., Kaiser, M., Kalinski, T., Ehrich, D., Bredehorn-Mayr, T., Paulsen, F., 2012. Bone marrow cells and CD117-positive haematopoietic stem cells promote corneal wound healing. Acta ophthalmologica. doi:10.1111/j.1755-3768.2012.02388.x Sel, S., Trau, S., Paulsen, F., Kalinski, T., Stangl, G.I., Nass, N., 2016. 1,25-dihydroxyvitamin D3 inhibits corneal wound healing in an ex-vivo mouse model. Graefes Arch. Clin. Exp. Ophthalmol. 254, 717–724. doi:10.1007/s00417-016-3267-4 Seol, D., McCabe, D.J., Choe, H., Zheng, H., Yu, Y., Jang, K., Walter, M.W., Lehman, A.D., Ding, L., Buckwalter, J.A., Martin, J.A., 2012. Chondrogenic progenitor cells respond to cartilage injury. Arthritis Rheum. 64, 3626–3637. doi:10.1002/art.34613 Sharma, N., Singh, D., Sobti, A., Agarwal, P., Velpandian, T., Titiyal, J.S., Ghose, S., 2012. Course and outcome of accidental sodium hydroxide ocular injury. Am. J. Ophthalmol. 154, 740–749.e2. doi:10.1016/j.ajo.2012.04.018 Sherstnev, V.V., Krasnov, M.M., Ziangirova, G.G., Malaeva, L.V., Bocharov, V.E., Olinevich, V.B., Gruden’, M.A., 1994. [The stimulating effect of S100beta protein on regeneration of the rabbit cornea]. Biull Eksp Biol Med 118, 98–101. Shi, L., Chen, H., Yu, X., Wu, X., 2013. Advanced glycation end products delay corneal epithelial wound healing through reactive oxygen species generation. Mol. Cell. Biochem. 383, 253–259. doi:10.1007/s11010-013-1773-9 Simm, A., Nass, N., Bartling, B., Hofmann, B., Silber, R.-E., Navarrete Santos, A., 2008. Potential biomarkers of ageing. Biol. Chem. 389, 257–265. doi:10.1515/BC.2008.034 Sorci, G., Riuzzi, F., Giambanco, I., Donato, R., 2013. RAGE in tissue homeostasis, repair and regeneration. Biochim. Biophys. Acta 1833, 101–109. doi:10.1016/j.bbamcr.2012.10.021 Spöler, F., Kray, O., Kray, S., Panfil, C., Schrage, N.F., 2015. The Ex Vivo Eye Irritation Test as an alternative test method for serious eye damage/eye irritation. Altern Lab Anim 43, 163–179. Sternberg, Z., Sternberg, D., Chichelli, T., Drake, A., Patel, N., Kolb, C., Chadha, K., Yu, J., Hojnacki, D., 2015. High-mobility group box 1 in multiple sclerosis. Immunol. Res. doi:10.1007/s12026-015-8673-x Tancharoen, S., Gando, S., Binita, S., Nagasato, T., Kikuchi, K., Nawa, Y., Dararat, P., Yamamoto, M., Narkpinit, S., Maruyama, I., 2016. HMGB1 Promotes Intraoral Palatal
Wound Healing through RAGE-Dependent Mechanisms. Int J Mol Sci 17. doi:10.3390/ijms17111961 Tong, L., Lan, W., Lim, R.R., Chaurasia, S.S., 2014. S100A proteins as molecular targets in the ocular surface inflammatory diseases. Ocul Surf 12, 23–31. doi:10.1016/j.jtos.2013.10.001 Winkler, M.A., Dib, C., Ljubimov, A.V., Saghizadeh, M., 2014. Targeting miR-146a to treat delayed wound healing in human diabetic organ-cultured corneas. PLoS ONE 9, e114692. doi:10.1371/journal.pone.0114692 Zhang, Q., O’Hearn, S., Kavalukas, S.L., Barbul, A., 2012. Role of high mobility group box 1 (HMGB1) in wound healing. J. Surg. Res. 176, 343–347. doi:10.1016/j.jss.2011.06.069 Zhou, L., Beuerman, R.W., Huang, L., Barathi, A., Foo, Y.H., Li, S.F.Y., Chew, F.T., Tan, D., 2007. Proteomic analysis of rabbit tear fluid: Defensin levels after an experimental corneal wound are correlated to wound closure. Proteomics 7, 3194–3206. doi:10.1002/pmic.200700137 Ziangarova, G.G., Olinevich, V.B., 2000. [Use of S100b protein for optimization of cornea regeneration after surgery]. Izv. Akad. Nauk. Ser. Biol. 27–32.
Legends to the figures Fig. 1: Time course of re-epithelialization of mouse corneas from RAGE -/-, +/- and +/+ mice (1A). Eyes were enucleated, wounded by sodium hydroxide soaked paper disks before and cultured ex-vivo. The wounded area was determined by fluorescein staining and fluorescence imaging. Data represent means with standard error bars of 16 corneas in each group. Statistical significance was determined by Kaplan-Meier analysis using the log-rank test (RAGE +/+ versus RAGE +/-: p=0.037; RAGE +/+ versus RAGE -/-: p=0.003; RAGE +/- versus RAGE -/-: p=0.042). An example of a wounded RAGE +/+ cornea is depicted in 1B. The wounded areas of the corneas are encircled by white lines. Fig. 2: Addition of HMGB-1 protein or a neutralizing antibody directed against HMGB-1 and bovine S100b protein did not influence corneal re-epithelialization in enucleated RAGE +/+ corneas. Kaplan-Meier analysis was performed to determine statistical significance over time by log-rank test (HMGB1 (n=12) versus (n=12) control: p=0.216; anti-HMGB1(n=12) versus control (n=12): p=0.623; S100b (n=12) versus control (n=12): p=0.317). Fig. 3: Immunohistochemical detection of RAGE, S100b-like proteins and HMGB-1 in wounded corneas of RAGE +/+ and RAGE -/- mice 24 h after wounding. Brown colour indicates specific antibody reactivity. E, corneal epithelium; S, corneal stroma; W, wounded area after alkaline burn. Fig. 4: Analysis of gene expression in control (c) and wounded (w) corneas of RAGE +/+ and RAGE -/- mice after 24 hours of culture. Corneal epithelial cells from 8 different corneas were scraped off and used for RNA extraction, cDNA synthesis and semiquantitative PCR. Numbers indicate abundance of PCR product relative to control RAGE +/+ corneas. Data represent means of 3 RT-PCR replicas.
Figure 1
Figure 2
Figure 3
Figure 4
Table 1: Primer sequences and conditions used for semiquantitative PCR. Gene ID
Accession number
Primer sequence
S100 A1
NM_011309.3
S100 A9
NM_009114.2
A100 A8
NM_013650.2
S100 A6
NM_011313.2
S100 A7a
NM_199422.1
S100b
NM_009115.3
S100z S100 A13
NM_00108115 9.1 NM_009113.4
S100 A4
NM_011311.2
S100 A2 S100 A3
NM_00119576 0.1 NM_011310.2
S100 A5
NM_011312.2
S100 g
NM_009789.2
S100 A14 IL-1ß
NM_00116352 5.2 NM_008361.3
IL-6
NM_031168.1
HMGB-1
NM_010439.3
GAPDH
NM_008084.2
RAGE
NM_007425.2
TCTGTTCCGACGTCAGGCCG TGCACGTCGAGACTGGGCAAG GGACACCCTGACACCCTGAGCA TGGGCAGCTGTCACATGGCT ACTGGAGAAGGCCTTGAGCAACCT GGACCCAGCCCTAGGCCAGAA TAAGGCCGGCCAGACTGCGA GGCCCCCAGGAAGGCGACAT GCCCGGGAAGGGGACAAGGA TGCACACAACTGCCGGTGGA CTCCGGGCGAGAGGGTGACA AGCCCCTGGGAAGGGGGTTG TCTTGCAAGGAGGGCGACAGG CGCAACCGTCAGAGCTGCCAC GCCTCAGGGCTCCAGATCGGT TTCCGGATCCCCAGGGCCTTC GGCAAGACCCTTGGAGGAGGC TCCGGGGCTCCTTATCTGGGC GCCAGTCAAGAGGACGAGAGGCT CGCTGGGGACCCCTCAAGGAA GAGTATGCAGGGCGCTGTGGG ACTGGGGGCAAGGAGGCTCAG GGGTAGCAAGCTGACCCTGAGT GGCCATGCACAGCGTGGTCA GACTCCTGCAGCGGTTGCACT GCCTTCAGGAGGCTGGGGAAC GCTGCCAGCAGGTCTCCCCCT CCCACCCCCTGAGCTCCCTTG AAAAGCCTCGTGCTGTCGGACC CTGCTTGTGAGGTGCTGATGTACC CAAGAGACTTCCATCCAGTTGC TTGCCGAGTAGATCTCAAAGTGAC TAGAGACGCGCCGGGCAA GGCCTCTTGGGTGCATTGGGG GACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTAG TGGCAAAGAAACACTCGTGA GAGATGGCACAGGTCAAGGT
Size (base pair) 447
Temperature 58°
291
60°
286
60°
332
60°
234
60°
411
60°
198
60°
376
60°
296
60°
228
60°
253
58°
181
60°
180
60°
643
60°
337
58°
367
52°
371
60°
453
60°
282
58°
S0940-9602(17)30003-1 http://dx.doi.org/doi:10.1016/j.aanat.2017.01.003 AANAT 51123
To appear in: Received date: Revised date: Accepted date:
28-11-2016 9-1-2017 12-1-2017
Please cite this article as: Nass, Norbert, Trau, Stefanie, Paulsen, Friedrich, Kaiser, Delia, Kalinski, Thomas, Sel, Saadettin, The receptor for advanced glycation end products RAGE is involved in corneal healing.Annals of Anatomy http://dx.doi.org/10.1016/j.aanat.2017.01.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
The receptor for advanced glycation end products RAGE is involved in corneal healing
Norbert Nass1, Stefanie Trau1, Friedrich Paulsen2, Delia Kaiser3, Thomas Kalinski1, Saadettin Sel3 1
Department of Pathology, Otto von Guericke University Magdeburg, Leipziger Str.
44, D-39120 Magdeburg, Germany. 2
Department of Anatomy II, University of Erlangen-Nürnberg, Universitätsstr. 19, D-
91054 Erlangen, Germany 3
Department of Ophthalmology University of Heidelberg, Im Neuenheimer Feld 400,
69120 Heidelberg, Germany
Corresponding author PD Dr. Saadettin Sel Department of Ophthalmology University Heidelberg Im Neuenheimer Feld 400 69120 Heidelberg Germany Phone: +49 6221 56 35807, fax: +49 6221 56 5422 E-Mail: [email protected]
Abstract Impaired corneal healing is still a major cause of blindness. As RAGE (receptor for advanced glycation endproducts) is involved in inflammation and wound healing in other tissues, we here investigated its relevance for corneal wound healing. Corneal re-epithelialization after alkaline injury was analysed in an ex-vivo approach with cultured, enucleated eyes from mice either of the C57Bl/6 NChR genotype (RAGE +/+) and mice of the same strain lacking the RAGE gene (RAGE -/-). The wound area was determined time dependently by fluorescence imaging using fluorescein staining. The eyes of RAGE -/- mice showed a significantly slower reepithelialization than eyes of the RAGE +/- and the RAGE +/+ genotype. In immunohistochemistry, RAGE expression was increased in wounded corneas whereas the abundance of the RAGE ligand HMGB1 was unaffected, but an increase in S100b-like proteins was revealed upon injury. However, neither the addition of the RAGE agonist HMGB1 or an HMGB1 antagonising antibody nor bovine S100b protein to the culture medium of the wounded eyes had an effect on corneal wound closure in ex-vivo. Further gene expression analysis by RT-PCR demonstrated an increase in RAGE expression on the mRNA level, no significant regulation of HMGB1 and a differential regulation of the S100 gene family after alkaline burn of the cornea. In conclusion, RAGE is clearly involved in corneal re-epithelialization most probably mediated by signalling via S100 proteins.
Keywords: cornea; advanced glycation end products; RAGE; S100 proteins; HMGB1; wound healing
1. Introduction Impaired corneal wound healing is still a major cause of impaired vision, especially after alkaline burn, and strategies for treatment should be improved to avoid keratoplasty (Sharma et al., 2012; Bunker et al., 2014). In order to develop such new therapy strategies, a detailed understanding of the mechanism of corneal reepithelialization, especially the genes and signalling mechanisms involved is essential. The corneal epithelium is the outermost barrier against infections and injuries of the ocular surface. Upon wounding, the corneal epithelial cells respond by increased cell divisions, migration and differentiation processes in order to rapidly cover the lesion (Ljubimov and Saghizadeh, 2015). In particular the proliferation of the limbal stem cells, located at the outer rim of the corneal epithelium, and the migration and differentiation of these cells, play a pivotal role in the process of corneal wound healing (Castro-Muñozledo, 2013). Clinically strategies to accelerate corneal wound healing are the application of autologous serum, or the grafting of amniotic membrane to temporarily close the wounded area (Gomes et al., 2005; Rauz and Saw, 2010). In laboratory and animal experiments, the application of hematopoetic or limbal stem cells were found effective for the promotion of corneal wound healing (Rauz and Saw, 2010; Sel et al., 2012). Several other factors and genes have also been identified that are able to modify or improve the re-epithelialization of the cornea. These are growth factors such as nerve growth factor (Blanco-Mezquita et al., 2013) or insulin like factors (Hampel et al., 2013), factors associated with defence or inflammatory reactions such as the defensins (McDermott et al., 2003; Zhou et al., 2007; Garreis et al., 2010; Gao et al., 2010), trefoil factor family peptides, especially TFF3 (Paulsen et al., 2008; Schulze et al., 2014) and S100 calcium binding proteins (Garreis et al., 2011; Li et al., 2010, p. 100; Ryan et al., 2003; Sherstnev et al., 1994; Tong et al., 2014). These proteins and several other gene products presumably form a regulatory network influencing inflammation, cell division and cell differentiation during corneal reepithelialization. This system is still not understood satisfactorily to deduce effective therapy strategies to improve the corneal healing process. Corneal wound healing is often impaired in patients affected by diabetes (Winkler et al., 2014) and patients of old age (Rhim et al., 2010). Conditions that are often
characterized by accumulation of advanced glycation end products (AGEs) (Simm et al., 2008). AGEs represent a variety of non-enzymatic modifications of proteins and other biomolecules (Nass et al., 2007). Initially, a Schiff´s base is formed by the reaction of a reactive aldehyde such as glucose or methylglyoxal with an amino group, a reaction that is named after its discoverer Louis Camille Maillard (Maillard, 1912). After rearrangements, oxidations and further elimination reactions, the AGEs are formed as stable end products (Ahmad et al., 2014). These AGEs can be classified by their physicochemical properties as fluorescent, such as pentosidine or non-fluorescent such as carboxymethyl lysine (CML); as cross-linking, such as glyoxal- and methylglyoxal-lysine dimers (GOLD, MOLD) (Glomb and Monnier, 1995; Lederer and Klaiber, 1999) or non-cross linking AGEs (i.e. CML). Several AGEs are recognized by specific receptors, particularly the receptor for AGEs (RAGE), which is a pattern recognition receptor belonging to the immunoglobulin superfamily (Bierhaus et al., 2005). Other RAGE-ligands are the small calcium binding S100 proteins, HMGB-1 (amphoterin) protein and amyloid ß-protein (Schmidt et al., 2000; Alexiou et al., 2010; Lee and Park, 2013). The activation of RAGE by these ligands leads to the activation of signaling mechanisms involving reactive oxygen species, MAP-kinases and the NF-κB transcription factor, finally leading to a preinflammatory state (RAGE mediated downstream regulation of tumour necrosis factor- α (TNF- α ), interleukin-6 (IL-6), IL-1β, C-reactive protein (CRP)), which is considered to promote the development of age-associated, degenerative diseases (Bianchi et al., 2008; Nedić et al., 2013; Ott et al., 2014). In several studies, it has been shown that RAGE and its ligands, especially HMGB-1, promote healing of epidermal wounds (Ranzato et al., 2010; Zhang et al., 2012; Sorci et al., 2013). In this study, we analyse whether RAGE might also be involved in corneal reepithelialization after corneal alkali burn injury.
2. Materials and Methods
2.1 Reagents and antibodies Primary antibodies against RAGE, S100b, HMGB-1 were obtained from Santa Cruz (Heidelberg, Germany; RAGE: H-300 sc-5563), Dako cytomation (Hamburg, Germany; S100b: Z-0311) and Acris Antibodies (Herford, Germany; HMGB-1: NB100-2322SS). Primers were designed by using the primer blast online utility provided by NCBI (The National
Center
for
Biotechnology
Information
at
http://www.ncbi.nlm.nih.gov/tools/primer-blast/). In order to prevent genomic DNA amplification, the primers spanned at least one long intron. The primers were synthesized by biomers.net GmbH (Ulm, Germany). Table 1 summarizes the primer sequences and conditions used for semi-quantitative RT-PCR.
2.2 Ex-vivo wounding model All animal experiments were performed according to German law and with the appreciation of the local animal welfare committee. RAGE -/- animals (Constien et al., 2001) were obtained from Prof. Bierhaus and Prof. Nawroth (University of Heidelberg, Germany). All animals were bred in our local animal facility in a 12/12 h light/dark cycle at 25°C and 60% humidity. Male mice aged between 3 to 4 months were anesthetised by isoflurane (1%) and sacrificed by cervical dislocation. Eyes were removed immediately with forceps and kept in sterile PBS (phosphate-buffered saline) until transferred to 24-well plates (THP) which were prepared by filling with 1 mL paraffin. Eyes were immobilized with subcutaneous needles so that the corneas were facing upwards and then submerged in 1 mL PBS. After all eyes for an experiment were prepared, wounding was performed by NaOH-soaked (125mM) filter paper disks (diameter 1.4 mm; Whatman, Dassel, Germany) for two minutes. The filter disks were then removed and the eyes immediately washed with 1 mL PBS. Afterwards, PBS was replaced with 1mL DMEM/F12 medium (Gibco) supplemented with antibiotics (Pen/Strep Gentamicin, Actinomycin D; Promocell, Heidelberg, Germany) and effectors (HMGB-1(3µg/mL, Novus, Biologicals, Cambridge, UK), αHMGB-1 (10 µg/mL, Shino Test-Corporation, Kanagawa, Japan), S100b (10 µg/mL, Calbiochem, Darmstadt, Germany)). After two hours, the medium was removed, the eyes stained with fluorescein solution (Sigma-Aldrich, 0.5 % in PBS) and washed
twice with sterile PBS before fluorescence was immediately determined by using a fluorescence imaging system (Maestro-imager, Intas, Goettingen, Germany). Afterwards, medium was added and the eyes incubated at 37° in 5% CO2 in a humidified cell culture incubator until the next staining procedure. Wounded area of the corneas was determined from the fluorescence images by using the ImageJ software package (Schneider et al., 2012; https://imagej.nih.gov/ij/index.html). For immunohistochemistry, the eyes were fixed 24 h after wounding by PBS-buffered 4% formaldehyde solution.
2.3 Immunohistochemistry (IHC) Mouse corneas were wounded by sodium hydroxide soaked filter disks as described above. After 24 h incubation, eyes were fixed with formaldehyde (4%) diluted in PBS for about 24 h. Afterwards, the eyes were embedded in paraffin. The immunohistochemical experiments were performed as described previously (Sel et al., 2012). In brief, for immunodetection of RAGE, S100b and HMGB-1 antigens the following primary antibodies were used: polyclonal rabbit anti-RAGE (1:100), polyclonal rabbit anti-S100b (1:400) and polyclonal rabbit anti-HMGB-1 (1:200). After incubation with the primary antibody at 4°C overnight, the biotinylated secondary goat anti-rabbit biotinylated antibody (1:500, Vectastain ABC elite kit, Vector laboratories, Peterborough, UK) were applied for 2 h. Visualization was achieved using diaminobenzidine chromogen (DAB kit, Vector laboratories) according to the manufacturer's recommendations. After counterstaining with Mayer’s hemalum solution (Roth, Karlsruhe, Germany), the slides were examined under a light microscope (Zeiss Axioplan 2, Oberkochen, Germany). In each case, we used two negative control sections. One slide was incubated with the primary antibody only; and the other with the secondary antibody only. In the negative controls, there was no detectable immunoreactivity.
2.4 Gene expression studies in mouse cornea Eyes with wounded corneas were incubated for 24 h as described above. Afterwards, corneal epithelial cells were removed from the cornea of 8 mice using a hockey knife and immediately submerged in 250 µL Trizol solution. RNA was prepared as recommended by the manufacturer (Invitrogen, Darmstadt, Germany) and cDNA synthesis performed using a MMLV RNase H- reverse transcriptase (Promega,
Mannheim, Germany) and oligo dT18 primers (biomers.net GmbH, Ulm, Germany) at 42°C for 60 minutes with a final inactivation step of 70°C for 10 minutes as recommended
by
the
manufacturer
(Promega,
Mannheim,
Germany).
Semiquantitative PCR was performed in 20 µL reactions using Taq Polymerase (Bioline, Luckenwalde, Germany) with primer-specific annealing temperature and cycle number with 30 sec denaturation at 60°C, 30 sec annealing and 1 min synthesis at 72°. Finally, reactions were incubated for further 10 min at 72°C. In order to minimize the number of animals used in this study, we prepared RNA from a single experiment only. Six corneas were pooled for further analysis. cDNA was synthesized from the RNA samples three times and the PCR was performed repeatedly from these cDNA batches and the averaged results are presented here. After addition of loading buffer, samples were separated on 1.5% agarose gels containing ethidium bromide in TAE-buffer and visualized using a CCD-camera imaging system (GE-Healthcare, Freiburg, Germany). For quantification, cycle number was optimized to obtain clearly visible bands without saturating the PCR. Band intensities were determined from the gel images by using the ImageJ software package (Schneider et al., 2012). Data were normalized towards the GAPDH reference and expressed relative to control treatments. 2.5 Statistical Analysis The data were collected in Exel (Microsoft Corp.) and analysed with SPSS software (version 19, International Business Machines Corp.). After confirming normality of the data using a one sample Kolmogorov-Smirnov test we performed Kaplan-Meier analysis to compare the corneal wound healing process over time between RAGE (+/+), RAGE (+/-) and RAGE(-/-). The terminal event was defined as complete corneal wound healing at the respective point in time. Statistical significance between groups was analysed by log-rank test. A p-value less than 0.05 was considered as statistically significant.
3. Results
3.1
RAGE -/- and RAGE +/- mice showed slower closure of corneal alkaline injuries. We have recently described an ex-vivo model for the analysis of corneal wounding after alkaline burn (Sel et al., 2012, 2016). Freshly enucleated eyes were cultivated in serum free media after the corneas had been wounded by alkaline soaked filter paper disks. Under these conditions, the corneal wounds healed within 48 h after wounding (Fig. 1). In case of RAGE -/- and RAGE +/- corneas, the healing process was significantly gene dose dependently delayed (Fig. 1). The addition of the RAGEagonists, S100b, HMGB-1 and a neutralizing antibody against HMGB-1, did not modify the wound healing rate in RAGE +/+ corneas (Fig. 2).
3.2 RAGE, S100 but not HMGB-1 proteins accumulated after alkaline burn. Since RAGE -/- animals exhibited an impaired re-epithelialization, we analysed the protein accumulation in corneas after wounding of RAGE and its agonists S100proteins and HMGB-1 by immunohistochemistry in eyes from RAGE +/+ and -/animals. In normal corneal epithelium RAGE expression was weakly detectable by IHC. In RAGE +/+ corneas, the RAGE protein staining clearly increased within 24h at the wounded site (Fig. 3). For detection of S100 proteins we used an antibody raised against the human S100b protein. The immunoreactivity obtained with this antibody increased at the wounded site in RAGE +/+ as well as in RAGE -/- corneas (Fig. 3). In case of the HMGB-1 protein, we found high expression in the nuclei of corneal epithelial cells, but no change upon wounding in RAGE +/+ and RAGE -/- corneas (Fig. 3). We then performed an analysis of mRNA abundance in control and wounded corneas by RT-PCR with a focus on RAGE and its ligands, but also included the inflammatory interleukins IL-1β and IL-6 (Fig. 4). RAGE was upregulated in wounded corneas about 5.8-fold. Furthermore, the analysis showed that mRNA of several S100-isoforms was present in corneal epithelial cells. Significant expression was observed for the S100 A1, -4, -6, -7, -8, -9, -13 and -14 whereas only a very weak signal was obtained for S100z (data not shown). In case of S100b, S100 A2, -5 and S100g, we were not able to amplify any cDNA from the corneal samples (data not
shown). For S100b, this was further confirmed by the successful detection of mRNA from mouse cerebrum as a positive control (data not shown). S100–mRNA expression changes were only slightly different between RAGE +/+ and -/- control and wounded corneas. Significantly increased mRNA abundance after wounding was observed for S100 A4 (2.7-fold) and -8 (1.8-fold) whereas S100 A1, -6, -13 and -14 were downregulated more than 50%. These results were observed in both genotypes. Only the wound-induced S100 A4 up-regulation was slightly lower in the RAGE -/- mice. There was a small increase in IL-1β mRNA abundance in both genotypes, whereas IL-6 was downregulated only in the RAGE -/- corneas after wounding (Fig. 4).
4. Discussion RAGE and its ligands are involved in the progression of several degenerative diseases, including impaired wound healing. Especially the HMGB-1 RAGE axis has been described to be involved in heart diseases (Fukami et al., 2014), nephropathy (Nakamura et al., 2009; Cheng et al., 2015), multiple sclerosis (Sternberg et al., 2015) and wound and ulcer healing (Ranzato et al., 2010; Chen et al., 2011; Seol et al., 2012; Tancharoen et al., 2016). There are also reports on the interaction of RAGE with it S100 ligands in inflammation and wound healing (Li et al., 2010; Tong et al., 2014) on the ocular surface. We therefore investigated whether RAGE and its ligands, especially HMGB-1 and S100 family members, might be involved in corneal re-epithelialization. We analysed this by analysing eyes from RAGE-knock out and wild type mice (Constien et al., 2001) in an ex-vivo approach. Such ex-vivo experimental systems are accepted alternatives to animal experiments when significant pain is evoked as in corneal injuries. Here, ex vivo models applying pig (Bohnsack et al., 2014), rabbit (Deshpande et al., 2015; Pinheiro et al., 2015) or mice (Paulsen et al., 2008; Schulze et al., 2014; Sel et al., 2012, 2016) have been proven to give consistent results (Spöler et al., 2015). Nevertheless, whereas ex-vivo assays preserve the functions of corneal matrix, epithelium, epithelial stem cells and endothelium, systemic signals especially originating from the lacrimal glands are lost. In our experiments, the absence of the RAGE gene had an obvious effect on corneal re-epithelialization as corneas exhibited a gene-dosage dependent healing rate. This
was corroborated by immunohistochemistry that showed RAGE protein accumulation after wounding. RAGE mRNA was also upregulated in wounded corneas about 5fold, which correlates well with our IHC data and published data from other groups working on corneal neovascularisation upon alkaline burn or suturing of the cornea (Li et al., 2010; Lin et al., 2011). HMGB-1 expression remained unaltered, whereas S100 proteins clearly accumulated at the wounded site. Neither the addition of recombinant HMGB-1, nor the inhibition of HMGB-1 signalling by an inhibitory antibody had a significant effect upon re-epithelialization. Therefore, members of the S100-protein family seem to be involved in corneal wound healing. From the S100-family, proven interactors for RAGE are S100A1, S100b, S100p, S100-A12 (Prasad et al., 2009), but due to the high degree of sequence similarity of the S100-proteins it is likely that most S100 proteins do indeed interact with RAGE (Leclerc et al., 2009). Other authors have already suggested that peptides derived from S100b would accelerate corneal wound healing in rabbits (Krasnov et al., 1994; Sherstnev et al., 1994; Ziangarova and Olinevich, 2000), but in our hands, the addition of bovine S100b protein had no effect on corneal re-epithelialization in mice. Either the S100b protein was ineffective in our system, which can be due to the exvivo technique used and the concentrations that can be achieved here, or our wound healing system already works at a speed that cannot be improved any further. As the eyes were completely submerged, the ex-vivo situation is different to the situation in a whole animal where the ocular surface is only moistened by the tear film. We therefore suspect that the addition of effector molecules can be more efficient in-vivo due to higher local concentrations. Also, in the in-vivo situation the cornea is connected to the natural tear flow and therefore in contact with effector molecules secreted by the lacrimal glands and other ocular surface structures such as, for example, conjunctival epithelial cells or secretion products of the glands of Moll. We then performed a gene expression analysis of the S100 protein family in epithelial cells by RT-PCR. We were not able to demonstrate any expression of the S100b mRNA in the mouse cornea. Therefore, other S100-family members must be responsible for the observed increase in wounded corneas. The S100-proteins from mouse, which are most similar to the human S100b protein, are the S00A1- S100zand S100A4-proteins with 58%, 48% and 47% sequence identity, respectively. Deducing from our RT-PCR data on these S100 isoforms only S100A4 mRNA was upregulated in the wounded tissue. We, therefore, propose that this S100 protein
was most likely responsible for the increase in the S100 protein signal observed in the immunohistochemical study. Interestingly, the expression of several S100 proteins was reduced 24 h after wounding. Only a small subset of S100 proteins remained unchanged and, especially for S100A4, we observed a robust mRNA accumulation upon wounding. These data and its similarity to human S100b suggest that S100A4 is involved in the re-epithelialization process as it has indeed been proposed before (Ryan et al., 2003). Similar S100 regulation was observed in a study analysing neovascularisation in alkaline burnt corneas (Li et al., 2010). These authors have analysed S100 gene expression for a longer period of time and found that S100A4, S100A6, S100A8, S100A9, and S100A13 were upregulated upon wounding. The postulated activation of RAGE would result in increased inflammation mediated by activation of NF-κB. At least in Drosophila, NF-κB is required for wound repair, whereas in mammalian models there is evidence that NF-κB activation promotes neovascularisation (Lee et al., 2014) after alkaline burn. Nevertheless, RAGE activation often results in the generation of hydrogen peroxide as a signalling molecule (Daffu et al., 2013; Ott et al., 2014). Interestingly, a recent study could show that the addition of small amounts of hydrogen peroxide resulted in improved healing of wounded corneas (Pan et al., 2011). These data are in line with the idea that RAGE is activated by a ligand during the re-epithelialization process which causes the production of hydrogen peroxide as a signalling molecule, which further triggers cell migration and adhesion. However, others pointed out that the AGE-RAGE interaction inhibited this process through an excess of reactive oxygen (Shi et al., 2013). Our study clearly demonstrated that RAGE expression influences corneal reepithelialization and the data suggest that this is mediated by S100 proteins. Further studies with S100-knock out animals or the specific knock out of S100-family members at the mouse cornea are now needed to further prove the interaction of RAGE and S100 A4 in the process of corneal wound healing. Acknowledgements The authors wish to thank Prof. Bierhaus and Prof. Nawroth for providing the RAGE knock out mice for this study.
References Ahmad, S., Khan, M.S., Akhter, F., Khan, M.S., Khan, A., Ashraf, J.M., Pandey, R.P., Shahab, U., 2014. Glycoxidation of biological macromolecules: a critical approach to halt the menace of glycation. Glycobiology 24, 979–990. doi:10.1093/glycob/cwu057 Alexiou, P., Chatzopoulou, M., Pegklidou, K., Demopoulos, V.J., 2010. RAGE: a multi-ligand receptor unveiling novel insights in health and disease. Curr. Med. Chem. 17, 2232– 2252. Bianchi, R., Giambanco, I., Donato, I.R., 2008. S100B/RAGE-dependent activation of microglia via NF-κB and AP-1. Co-regulation of COX-2 expression by S100B and IL1β and TNF-α, Neurobiol. Aging 31, 665–677, http: //dx.doi.org/10.1016/j.neurobiolaging.2008.05.017. Bierhaus, A., Humpert, P.M., Morcos, M., Wendt, T., Chavakis, T., Arnold, B., Stern, D.M., Nawroth, P.P., 2005. Understanding RAGE, the receptor for advanced glycation end products. J. Mol. Med. 83, 876–886. doi:10.1007/s00109-005-0688-7 Blanco-Mezquita, T., Martinez-Garcia, C., Proença, R., Zieske, J.D., Bonini, S., Lambiase, A., Merayo-Lloves, J., 2013. Nerve growth factor promotes corneal epithelial migration by enhancing expression of matrix metalloprotease-9. Invest. Ophthalmol. Vis. Sci. 54, 3880–3890. doi:10.1167/iovs.12-10816 Bohnsack, R.N., Warejcka, D.J., Wang, L., Gillespie, S.R., Bernstein, A.M., Twining, S.S., Dahms, N.M., 2014. Expression of insulin-like growth factor 2 receptor in corneal keratocytes during differentiation and in response to wound healing. Invest. Ophthalmol. Vis. Sci. 55, 7697–7708. doi:10.1167/iovs.14-15179 Bunker, D.J.L., George, R.J., Kleinschmidt, A., Kumar, R.J., Maitz, P., 2014. Alkali-related ocular burns: a case series and review. J Burn Care Res 35, 261–268. doi:10.1097/BCR.0b013e31829b0037 Castro-Muñozledo, F., 2013. Review: corneal epithelial stem cells, their niche and wound healing. Mol. Vis. 19, 1600–1613. Chen, K.-B., Uchida, K., Nakajima, H., Yayama, T., Hirai, T., Rodriguez Guerrero, A., Kobayashi, S., Ma, W.-Y., Liu, S.-Y., Zhu, P., Baba, H., 2011. High-mobility group box-1 and its receptors contribute to proinflammatory response in the acute phase of spinal cord injury in rats. Spine 36, 2122–2129. doi:10.1097/BRS.0b013e318203941c Cheng, M., Liu, H., Zhang, D., Liu, Y., Wang, C., Liu, F., Chen, J., 2015. HMGB1 Enhances the AGE-Induced Expression of CTGF and TGF-β via RAGE-Dependent Signaling in Renal Tubular Epithelial Cells. Am. J. Nephrol. 41, 257–266. doi:10.1159/000381464 Constien, R., Forde, A., Liliensiek, B., Gröne, H.J., Nawroth, P., Hämmerling, G., Arnold, B., 2001. Characterization of a novel EGFP reporter mouse to monitor Cre recombination as demonstrated by a Tie2 Cre mouse line. Genesis 30, 36–44.
Daffu, G., del Pozo, C.H., O’Shea, K.M., Ananthakrishnan, R., Ramasamy, R., Schmidt, A.M., 2013. Radical roles for RAGE in the pathogenesis of oxidative stress in cardiovascular diseases and beyond. Int J Mol Sci 14, 19891–19910. doi:10.3390/ijms141019891 Deshpande, P., Ortega, Í., Sefat, F., Sangwan, V.S., Green, N., Claeyssens, F., MacNeil, S., 2015. Rocking media over ex vivo corneas improves this model and allows the study of the effect of proinflammatory cytokines on wound healing. Invest. Ophthalmol. Vis. Sci. 56, 1553–1561. doi:10.1167/iovs.14-15308 Fukami, K., Yamagishi, S.-I., Okuda, S., 2014. Role of AGEs-RAGE system in cardiovascular disease. Curr. Pharm. Des. 20, 2395–2402. Gao, N., Kumar, A., Jyot, J., Yu, F.-S., 2010. Flagellin-induced corneal antimicrobial peptide production and wound repair involve a novel NF-kappaB-independent and EGFRdependent pathway. PLoS ONE 5, e9351. doi:10.1371/journal.pone.0009351 Garreis, F., Gottschalt, M., Paulsen, F.P., 2010. Antimicrobial peptides as a major part of the innate immune defense at the ocular surface. Dev Ophthalmol 45, 16–22. doi:10.1159/000315016 Garreis, F., Gottschalt, M., Schlorf, T., Gläser, R., Harder, J., Worlitzsch, D., Paulsen, F.P., 2011. Expression and regulation of antimicrobial peptide psoriasin (S100A7) at the ocular surface and in the lacrimal apparatus. Invest. Ophthalmol. Vis. Sci. 52, 4914– 4922. doi:10.1167/iovs.10-6598 Glomb, M.A., Monnier, V.M., 1995. Mechanism of protein modification by glyoxal and glycolaldehyde, reactive intermediates of the Maillard reaction. J. Biol. Chem. 270, 10017–10026. Gomes, J.A.P., Romano, A., Santos, M.S., Dua, H.S., 2005. Amniotic membrane use in ophthalmology. Curr Opin Ophthalmol 16, 233–240. Hampel, U., Klonisch, T., Sel, S., Schulze, U., Garreis, F., Seitmann, H., Zouboulis, C.C., Paulsen, F.P., 2013. Insulin-like factor 3 promotes wound healing at the ocular surface. Endocrinology 154, 2034–2045. doi:10.1210/en.2012-2201 Keshava Prasad, T.S., Goel, R., Kandasamy, K., Keerthikumar, S., Kumar, S., Mathivanan, S., Telikicherla, D., Raju, R., Shafreen, B., Venugopal, A., Balakrishnan, L., Marimuthu, A., Banerjee, S., Somanathan, D.S., Sebastian, A., Rani, S., Ray, S., Harrys Kishore, C.J., Kanth, S., Ahmed, M., Kashyap, M.K., Mohmood, R., Ramachandra, Y.L., Krishna, V., Rahiman, B.A., Mohan, S., Ranganathan, P., Ramabadran, S., Chaerkady, R., Pandey, A., 2009. Human Protein Reference Database--2009 update. Nucleic Acids Res. 37, D767-772. doi:10.1093/nar/gkn892
Krasnov, M.M., Ziangirova, G.G., Malaeva, L.V., Bocharov, V.E., Olinevich, V.B., 1994. [Effects of protein S100 beta on the course of corneal healing in rabbits]. Vestn Oftalmol 110, 29–32. Leclerc, E., Fritz, G., Vetter, S.W., Heizmann, C.W., 2009. Binding of S100 proteins to RAGE: An update. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1793, 993–1007. doi:10.1016/j.bbamcr.2008.11.016 Lederer, M.O., Klaiber, R.G., 1999. Cross-linking of proteins by Maillard processes: characterization and detection of lysine-arginine cross-links derived from glyoxal and methylglyoxal. Bioorg. Med. Chem. 7, 2499–2507. Lee, E.J., Park, J.H., 2013. Receptor for Advanced Glycation Endproducts (RAGE), Its Ligands, and Soluble RAGE: Potential Biomarkers for Diagnosis and Therapeutic Targets for Human Renal Diseases. Genomics Inform 11, 224–229. doi:10.5808/GI.2013.11.4.224 Lee, H.S., Lee, J.H., Kim, C.E., Yang, J.W., 2014. Anti-neovascular effect of chondrocytederived extracellular matrix on corneal alkaline burns in rabbits. Graefes Arch. Clin. Exp. Ophthalmol. 252, 951–961. doi:10.1007/s00417-014-2633-3 Li, C., Zhang, F., Wang, Y., 2010. S100A proteins in the pathogenesis of experimental corneal neovascularization. Mol. Vis. 16, 2225–2235. Lin, Q., Yang, X.P., Fang, D., Ren, X., Zhou, H., Fang, J., Liu, X., Zhou, S., Wen, F., Yao, X., Wang, J.M., Su, S.B., 2011. High-mobility group box-1 mediates toll-like receptor 4dependent angiogenesis. Arterioscler. Thromb. Vasc. Biol. 31, 1024–1032. doi:10.1161/ATVBAHA.111.224048 Ljubimov, A.V., Saghizadeh, M., 2015. Progress in corneal wound healing. Prog Retin Eye Res. doi:10.1016/j.preteyeres.2015.07.002 Louis Camille Maillard, 1912. Action des acides amines sur les sucres: formation des melanoidines par voie methodique. C.R.Acad.Sci.Ser 2, 66–68. McDermott, A.M., Redfern, R.L., Zhang, B., Pei, Y., Huang, L., Proske, R.J., 2003. Defensin expression by the cornea: multiple signalling pathways mediate IL-1beta stimulation of hBD-2 expression by human corneal epithelial cells. Invest. Ophthalmol. Vis. Sci. 44, 1859–1865. Nakamura, T., Sato, E., Fujiwara, N., Kawagoe, Y., Ueda, Y., Suzuki, T., Yamada, S., Takeuchi, M., Fukami, K., Ueda, S., Adachi, H., Matsui, T., Okuda, S., Yamagishi, S., 2009. Positive association of serum levels of advanced glycation end products and high mobility group box-1 with asymmetric dimethylarginine in nondiabetic chronic kidney disease patients. Metab. Clin. Exp. 58, 1624–1628. doi:10.1016/j.metabol.2009.05.018
Nedić, O., Rattan, S.I., Grune, T., Trougakos, I.P., 2013. Molecular effects of advanced glycation end products on cell signalling pathways, ageing and pathophysiology. Free Radic Res. 47 Suppl 1:28-38. doi: 10.3109/10715762.2013.806798. Nass, N., Bartling, B., Navarrete Santos, A., Scheubel, R.J., Börgermann, J., Silber, R.E., Simm, A., 2007. Advanced glycation end products, diabetes and ageing. Z Gerontol Geriatr 40, 349–356. doi:10.1007/s00391-007-0484-9 Ott, C., Jacobs, K., Haucke, E., Navarrete Santos, A., Grune, T., Simm, A., 2014. Role of advanced glycation end products in cellular signaling. Redox Biol 2, 411–429. doi:10.1016/j.redox.2013.12.016 Pan, Q., Qiu, W.-Y., Huo, Y.-N., Yao, Y.-F., Lou, M.F., 2011. Low levels of hydrogen peroxide stimulate corneal epithelial cell adhesion, migration, and wound healing. Invest. Ophthalmol. Vis. Sci. 52, 1723–1734. doi:10.1167/iovs.10-5866 Paulsen, F.P., Woon, C.-W., Varoga, D., Jansen, A., Garreis, F., Jäger, K., Amm, M., Podolsky, D.K., Steven, P., Barker, N.P., Sel, S., 2008. Intestinal trefoil factor/TFF3 promotes re-epithelialization of corneal wounds. J. Biol. Chem. 283, 13418–13427. doi:10.1074/jbc.M800177200 Pinheiro, R., Panfil, C., Schrage, N., Dutescu, R.M., 2015. The Impact of Glaucoma Medications on Corneal Wound Healing. J. Glaucoma. doi:10.1097/IJG.0000000000000279 Ranzato, E., Patrone, M., Pedrazzi, M., Burlando, B., 2010. Hmgb1 promotes wound healing of 3T3 mouse fibroblasts via RAGE-dependent ERK1/2 activation. Cell Biochem. Biophys. 57, 9–17. doi:10.1007/s12013-010-9077-0 Rauz, S., Saw, V.P., 2010. Serum eye drops, amniotic membrane and limbal epithelial stem cells--tools in the treatment of ocular surface disease. Cell Tissue Bank 11, 13–27. doi:10.1007/s10561-009-9128-1 Rhim, J.H., Kim, J.H., Yeo, E.-J., Kim, J.C., Park, S.C., 2010. Caveolin-1 as a novel indicator of wound-healing capacity in aged human corneal epithelium. Mol. Med. 16, 527–534. doi:10.2119/molmed.2010.00046 Ryan, D.G., Taliana, L., Sun, L., Wei, Z.-G., Masur, S.K., Lavker, R.M., 2003. Involvement of S100A4 in stromal fibroblasts of the regenerating cornea. Invest. Ophthalmol. Vis. Sci. 44, 4255–4262. Schmidt, A.M., Yan, S.D., Yan, S.F., Stern, D.M., 2000. The biology of the receptor for advanced glycation end products and its ligands. Biochim. Biophys. Acta 1498, 99– 111. Schneider, C.A., Rasband, W.S., Eliceiri, K.W., 2012. NIH Image to ImageJ: 25 years of image analysis. Nat Meth 9, 671–675. doi:10.1038/nmeth.2089
Schulze, U., Hampel, U., Sel, S., Contreras-Ruiz, L., Schicht, M., Dieckow, J., Diebold, Y., Paulsen, F., 2014. Trefoil factor family peptide 3 (TFF3) is upregulated under experimental conditions similar to dry eye disease and supports corneal wound healing effects in vitro. Invest. Ophthalmol. Vis. Sci. 55, 3037–3042. doi:10.1167/iovs.13-13423 Sel, S., Schilling, U.M., Nass, N., Simm, A., Garreis, F., Knak, M., Storsberg, J., Kaiser, M., Kalinski, T., Ehrich, D., Bredehorn-Mayr, T., Paulsen, F., 2012. Bone marrow cells and CD117-positive haematopoietic stem cells promote corneal wound healing. Acta ophthalmologica. doi:10.1111/j.1755-3768.2012.02388.x Sel, S., Trau, S., Paulsen, F., Kalinski, T., Stangl, G.I., Nass, N., 2016. 1,25-dihydroxyvitamin D3 inhibits corneal wound healing in an ex-vivo mouse model. Graefes Arch. Clin. Exp. Ophthalmol. 254, 717–724. doi:10.1007/s00417-016-3267-4 Seol, D., McCabe, D.J., Choe, H., Zheng, H., Yu, Y., Jang, K., Walter, M.W., Lehman, A.D., Ding, L., Buckwalter, J.A., Martin, J.A., 2012. Chondrogenic progenitor cells respond to cartilage injury. Arthritis Rheum. 64, 3626–3637. doi:10.1002/art.34613 Sharma, N., Singh, D., Sobti, A., Agarwal, P., Velpandian, T., Titiyal, J.S., Ghose, S., 2012. Course and outcome of accidental sodium hydroxide ocular injury. Am. J. Ophthalmol. 154, 740–749.e2. doi:10.1016/j.ajo.2012.04.018 Sherstnev, V.V., Krasnov, M.M., Ziangirova, G.G., Malaeva, L.V., Bocharov, V.E., Olinevich, V.B., Gruden’, M.A., 1994. [The stimulating effect of S100beta protein on regeneration of the rabbit cornea]. Biull Eksp Biol Med 118, 98–101. Shi, L., Chen, H., Yu, X., Wu, X., 2013. Advanced glycation end products delay corneal epithelial wound healing through reactive oxygen species generation. Mol. Cell. Biochem. 383, 253–259. doi:10.1007/s11010-013-1773-9 Simm, A., Nass, N., Bartling, B., Hofmann, B., Silber, R.-E., Navarrete Santos, A., 2008. Potential biomarkers of ageing. Biol. Chem. 389, 257–265. doi:10.1515/BC.2008.034 Sorci, G., Riuzzi, F., Giambanco, I., Donato, R., 2013. RAGE in tissue homeostasis, repair and regeneration. Biochim. Biophys. Acta 1833, 101–109. doi:10.1016/j.bbamcr.2012.10.021 Spöler, F., Kray, O., Kray, S., Panfil, C., Schrage, N.F., 2015. The Ex Vivo Eye Irritation Test as an alternative test method for serious eye damage/eye irritation. Altern Lab Anim 43, 163–179. Sternberg, Z., Sternberg, D., Chichelli, T., Drake, A., Patel, N., Kolb, C., Chadha, K., Yu, J., Hojnacki, D., 2015. High-mobility group box 1 in multiple sclerosis. Immunol. Res. doi:10.1007/s12026-015-8673-x Tancharoen, S., Gando, S., Binita, S., Nagasato, T., Kikuchi, K., Nawa, Y., Dararat, P., Yamamoto, M., Narkpinit, S., Maruyama, I., 2016. HMGB1 Promotes Intraoral Palatal
Wound Healing through RAGE-Dependent Mechanisms. Int J Mol Sci 17. doi:10.3390/ijms17111961 Tong, L., Lan, W., Lim, R.R., Chaurasia, S.S., 2014. S100A proteins as molecular targets in the ocular surface inflammatory diseases. Ocul Surf 12, 23–31. doi:10.1016/j.jtos.2013.10.001 Winkler, M.A., Dib, C., Ljubimov, A.V., Saghizadeh, M., 2014. Targeting miR-146a to treat delayed wound healing in human diabetic organ-cultured corneas. PLoS ONE 9, e114692. doi:10.1371/journal.pone.0114692 Zhang, Q., O’Hearn, S., Kavalukas, S.L., Barbul, A., 2012. Role of high mobility group box 1 (HMGB1) in wound healing. J. Surg. Res. 176, 343–347. doi:10.1016/j.jss.2011.06.069 Zhou, L., Beuerman, R.W., Huang, L., Barathi, A., Foo, Y.H., Li, S.F.Y., Chew, F.T., Tan, D., 2007. Proteomic analysis of rabbit tear fluid: Defensin levels after an experimental corneal wound are correlated to wound closure. Proteomics 7, 3194–3206. doi:10.1002/pmic.200700137 Ziangarova, G.G., Olinevich, V.B., 2000. [Use of S100b protein for optimization of cornea regeneration after surgery]. Izv. Akad. Nauk. Ser. Biol. 27–32.
Legends to the figures Fig. 1: Time course of re-epithelialization of mouse corneas from RAGE -/-, +/- and +/+ mice (1A). Eyes were enucleated, wounded by sodium hydroxide soaked paper disks before and cultured ex-vivo. The wounded area was determined by fluorescein staining and fluorescence imaging. Data represent means with standard error bars of 16 corneas in each group. Statistical significance was determined by Kaplan-Meier analysis using the log-rank test (RAGE +/+ versus RAGE +/-: p=0.037; RAGE +/+ versus RAGE -/-: p=0.003; RAGE +/- versus RAGE -/-: p=0.042). An example of a wounded RAGE +/+ cornea is depicted in 1B. The wounded areas of the corneas are encircled by white lines. Fig. 2: Addition of HMGB-1 protein or a neutralizing antibody directed against HMGB-1 and bovine S100b protein did not influence corneal re-epithelialization in enucleated RAGE +/+ corneas. Kaplan-Meier analysis was performed to determine statistical significance over time by log-rank test (HMGB1 (n=12) versus (n=12) control: p=0.216; anti-HMGB1(n=12) versus control (n=12): p=0.623; S100b (n=12) versus control (n=12): p=0.317). Fig. 3: Immunohistochemical detection of RAGE, S100b-like proteins and HMGB-1 in wounded corneas of RAGE +/+ and RAGE -/- mice 24 h after wounding. Brown colour indicates specific antibody reactivity. E, corneal epithelium; S, corneal stroma; W, wounded area after alkaline burn. Fig. 4: Analysis of gene expression in control (c) and wounded (w) corneas of RAGE +/+ and RAGE -/- mice after 24 hours of culture. Corneal epithelial cells from 8 different corneas were scraped off and used for RNA extraction, cDNA synthesis and semiquantitative PCR. Numbers indicate abundance of PCR product relative to control RAGE +/+ corneas. Data represent means of 3 RT-PCR replicas.
Figure 1
Figure 2
Figure 3
Figure 4
Table 1: Primer sequences and conditions used for semiquantitative PCR. Gene ID
Accession number
Primer sequence
S100 A1
NM_011309.3
S100 A9
NM_009114.2
A100 A8
NM_013650.2
S100 A6
NM_011313.2
S100 A7a
NM_199422.1
S100b
NM_009115.3
S100z S100 A13
NM_00108115 9.1 NM_009113.4
S100 A4
NM_011311.2
S100 A2 S100 A3
NM_00119576 0.1 NM_011310.2
S100 A5
NM_011312.2
S100 g
NM_009789.2
S100 A14 IL-1ß
NM_00116352 5.2 NM_008361.3
IL-6
NM_031168.1
HMGB-1
NM_010439.3
GAPDH
NM_008084.2
RAGE
NM_007425.2
TCTGTTCCGACGTCAGGCCG TGCACGTCGAGACTGGGCAAG GGACACCCTGACACCCTGAGCA TGGGCAGCTGTCACATGGCT ACTGGAGAAGGCCTTGAGCAACCT GGACCCAGCCCTAGGCCAGAA TAAGGCCGGCCAGACTGCGA GGCCCCCAGGAAGGCGACAT GCCCGGGAAGGGGACAAGGA TGCACACAACTGCCGGTGGA CTCCGGGCGAGAGGGTGACA AGCCCCTGGGAAGGGGGTTG TCTTGCAAGGAGGGCGACAGG CGCAACCGTCAGAGCTGCCAC GCCTCAGGGCTCCAGATCGGT TTCCGGATCCCCAGGGCCTTC GGCAAGACCCTTGGAGGAGGC TCCGGGGCTCCTTATCTGGGC GCCAGTCAAGAGGACGAGAGGCT CGCTGGGGACCCCTCAAGGAA GAGTATGCAGGGCGCTGTGGG ACTGGGGGCAAGGAGGCTCAG GGGTAGCAAGCTGACCCTGAGT GGCCATGCACAGCGTGGTCA GACTCCTGCAGCGGTTGCACT GCCTTCAGGAGGCTGGGGAAC GCTGCCAGCAGGTCTCCCCCT CCCACCCCCTGAGCTCCCTTG AAAAGCCTCGTGCTGTCGGACC CTGCTTGTGAGGTGCTGATGTACC CAAGAGACTTCCATCCAGTTGC TTGCCGAGTAGATCTCAAAGTGAC TAGAGACGCGCCGGGCAA GGCCTCTTGGGTGCATTGGGG GACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTAG TGGCAAAGAAACACTCGTGA GAGATGGCACAGGTCAAGGT
Size (base pair) 447
Temperature 58°
291
60°
286
60°
332
60°
234
60°
411
60°
198
60°
376
60°
296
60°
228
60°
253
58°
181
60°
180
60°
643
60°
337
58°
367
52°
371
60°
453
60°
282
58°