- Email: [email protected]
ob mice
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
Obesity Research & Clinical Practice (2015) xxx, xxx—xxx
The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice Satoshi Hirako a, Yoshihiro Wakayama b,c, Hyounju Kim d, Yuzuru Iizuka d, Akiyo Matsumoto d, Nobuhiro Wada e, Ai Kimura f, Mai Okabe g, Junichi Sakagami b, Mamiko Suzuki h, Fumiko Takenoya i, Seiji Shioda f,∗ a
Department of Health and Nutrition, University of Human Arts and Sciences, Saitama, Japan b Department of Anatomy, Showa University School of Medicine, Tokyo, Japan c Wakayama Clinic, Machida-shi, Tokyo, Japan d Department of Clinical Dietetics & Human Nutrition, Faculty of Pharmaceutical Sciences, Josai University, Saitama, Japan e Department of Internal Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan f Hoshi University School of Pharmacy and Pharmaceutical Sciences Global Research Center for Innovative Life Science Peptide Drug Innovation, Tokyo, Japan g Tokyo Shokuryo Dietitian Academy, Tokyo, Japan h Department of Biochemistry, Showa University School of Medicine, Tokyo, Japan i Department of Exercise and Sports Physiology, Hoshi University School of Pharmacy and Pharmaceutical Science, Tokyo, Japan Received 15 January 2015 ; received in revised form 24 November 2015; accepted 4 December 2015
KEYWORDS AQP7; AQP9; Obesity;
Summary Aquaporin (AQP) 7 and AQP9 are subcategorised as aquaglyceroporins which transport glycerin in addition to water. These AQPs may play a role in the homeostasis of energy metabolism. We examined the effect of AQP7, AQP9, and lipid metabolism-related gene expression in obese mice. In diet-induced obese (DIO)
∗ Corresponding author at: Hoshi University School of Pharmacy and Pharmaceutical Sciences Global Research, Center for Innovative Life Science Peptide Drug Innovation, 2-4-41 Ebara, Shinagawa-ku, Tokyo 142-8501, Japan. Tel.: +81 3 5498 5853; fax: +81 3 5498 5853. E-mail address: [email protected] (S. Shioda).
http://dx.doi.org/10.1016/j.orcp.2015.12.001 1871-403X/© 2015 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
2
S. Hirako et al. Lipid metabolism; Hepatic lipids
mice, excess lipid accumulated in the liver, which was hyperleptinemic and hyperinsulinemic. Hepatic AQP9 gene expression was significantly increased in both DIO and ob/ob mice compared to controls. The mRNA expression levels of fatty acid and triglyceride synthesis-related genes and fatty acid  oxidation-related genes in the liver were also higher in both mouse models, suggesting that triglyceride synthesis in this organ is promoted as a result of glycerol release from adipocytes. Adipose AQP7 and AQP9 gene expressions were increased in DIO mice, but there was no difference in ob/ob mice compared to wild-type mice. In summary, adipose AQP7 and AQP9 gene expressions are increased by diet-induced obesity, indicating that this is one of the mechanisms by which lipid accumulates in response to a high fat diet, not the genetic mutation of ob/ob mice. Hepatic AQP9 gene expression was increased in both obesity model mice. AQP7 and AQP9 therefore have the potential of defining molecules for the characterisation of obesity or fatty liver and may be a target molecules for the treatment of those disease. © 2015 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.
Introduction Obesity increases the risk of developing diabetes, fatty liver, hypertension, hyperlipidemia, metabolic syndrome, coronary heart disease, and stroke [1,2], and preventing this condition is important in the healthy maintenance of the body. Obesity is the state in which surplus energy accumulates as fat as a result of excessive energy intake and low energy expenditure due to lack of exercise. The adipose tissue undergoes lipogenesis and lipolysis depending on the energy balance. In the hypertrophic state, the adipocytes store triglycerides, whereas in response to starvation and sympathetic nerve activation, they degrade triglycerides and release free fatty acids (FFA) and glycerol into the blood to supply energy to the entire body [3,4]. Aquaporins (AQPs) are channels that allow the movement of water across the cell membrane [5]. Certain members of this family, the aquaglyceroporins, which include AQP3, 7, 9, and 10, transport glycerol as well as water and are involved in the biosynthesis of triglycerides [6]. The AQP7 gene was first cloned from human adipose tissue [7]. AQP7 is localised to a wide range of tissues in rodents. It is abundantly expressed in adipose tissue [8], and is also expressed in kidney, pancreas, and muscle [9,10]. The AQP9 gene was first cloned from a human liver cDNA library [11]. In rats, AQP9 mRNA has been found in the liver, testis, brain, and lung [12]. The FFA and glycerol generated in adipocytes are released to other tissues, and the efflux of glycerol from adipose tissue is facilitated by AQP7 [13—16]. In the liver AQP9 facilitates the uptake of glycerol,
which is metabolised to glycerol 3-phosphate via the glycolytic pathway [13—16]. Hence, both AQP7 and AQP9 seem to play an important role in the homeostasis of energy metabolism. The expression levels of these genes in adipocytes and hepatocytes are reduced by feeding and increased by fasting, in parallel to the changes in plasma glycerol levels [7,17]. In rodents, AQP7 expression in the adipose tissue and AQP9 expression in the liver are downregulated by insulin. Streptozotocin (STZ)-induced diabetic mice exhibit increased expression levels of adipocyte AQP7 and hepatic AQP9 [18—20]. In addition, the gene expression of adipocyte AQP7 and hepatic AQP9 are increased in leptin receptor deficient db/db mice [20]. Recently, we demonstrated that AQP7 expression is upregulated in the skeletal muscle of leptin deficient ob/ob mice [21]. Many reports have described the function and regulation of the aquaglyceroporins in ob/ob and db/db mice as models of obesity, but there have been fewer studies of diet-induced obese (DIO) mice. Here we investigated the AQP gene expression profiles of DIO and ob/ob mice, and examined the role of AQP7 and AQP9 in their lipid metabolism.
Materials and methods Animals and diets Male C57BL/6J mice were obtained from Sankyo Labo Service Corporation (Tokyo, Japan) at 5 weeks of age and fed a normal laboratory diet for 1 week to acclimatise the animals to their new conditions. The mice were divided into 2 groups (lean or DIO group, n = 7 in each group). At the beginning of
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
Aquaglyceroporin expression in DIO and ob/ob mice experiment, body weight was the same between the two groups (lean group; 20.4 ± 0.63 g vs DIO group; 20.6 ± 0.56 g (p = 0.999)). Mice in the lean control group were fed a normal laboratory diet (Labo MR stock; 15.2 energy % of fat; Nosan Corporation, Japan), whereas the DIO mice received a high-fat diet (D12451; 45 energy % of fat; Research Diets, NJ, USA) ad libitum for 16 weeks to induce obesity. Animals were reared in a room with controlled temperature (20 ± 2 ◦ C), humidity (55 ± 15%), and a 12-h day cycle (8:00 AM—8:00 PM). The food was changed at 15:00 every day. All animal studies were conducted in accordance with the ‘‘Standards Relating to the Care and Management of Experimental Animals’’ (Notice No. 6 of the Office of Prime Minister dated March 27, 1980) and with approval from the Animal Use Committee of Showa University.
3 analysis. The removed organs were frozen in liquid nitrogen and stored at −80 ◦ C.
Quantification of hepatic and plasma profile Hepatic lipids were extracted from approximately 100 mg of liver tissue for each mouse in accordance with the method of Folch et al. [22]. Triacylglyceride and total cholesterol in the liver were measured using the Triglyceride E-Test and Cholesterol E-Test kits (Wako Pure Chemical Industries, Ltd.), respectively. Quantification of plasma triacylglyceride and total cholesterol levels was performed using the same test kits. Plasma insulin and leptin levels were quantified by enzyme-linked immunosorbent assays (ELISA) using the Insulin ELISA kit and the Leptin/mouse ELISA kit, respectively (Morinaga Institute of Biological Science, Tokyo, Japan).
Collection of blood and tissue samples The mice were starved for 3 h and were anesthetised by intraperitoneal injection of pentobarbital sodium (Dainippon Sumitomo Pharma, Osaka, Japan). Blood samples were collected from the tail vein, and glucose was measured using a Medisafe-Mini (Terumo, Tokyo, Japan), after which the animals were dissected. Blood samples were collected from the heart and treated with heparin. The liver and epididymal white adipose tissues (WAT) were removed immediately and weighed. A piece of liver tissue was excised from the median lobe of the liver. Liver samples were individually collected for each group and fixed with 10% neutral buffered formalin (Wako Pure Chemical Industries, Ltd.). The samples were embedded in paraffin, cut into sections, and stained with hematoxylin—eosin (H&E) for histopathological examination. Plasma was obtained by centrifugation (900 × g, 4 ◦ C, 10 min) and frozen at −80 ◦ C for storage until Table 1
Quantification of mRNA expression Total RNA was extracted from the liver and WAT sample of each mouse using TRIzol (Life Technologies, Inc.) and was then converted into cDNA with the Affinity-Script QPCR cDNA Synthesis Kit (Agilent Technologies). A real-time polymerase chain reaction (RT-PCR) was performed using SYBR Premix Ex Taq II reagent (TaKaRa BIO INC) with an ABI PRISM 7900 sequence detection system (Life Technologies, Inc.). The thermal cycling conditions were as follows: 95 ◦ C for 30 s followed by 45 cycles at 95 ◦ C for 5 s and extension at 72 ◦ C for 1 min. Relative copy numbers were obtained from standard curve values and were normalised to 18s rRNA. DIO and ob/ob mouse mRNA levels were normalised as a percentage of the values obtained in control lean and wild-type mice, respectively. The primers used for real-time PCR analysis are listed in Table 1.
Primer for RT-PCR amplification of indicated genes.
Gene
Forward primer (5 —3 )
Reverse primer (5 —3 )
AQP7 AQP9 FAS SCD1 DGAT2 GPAT MTP AOX CPT1 18S rRNA
TGGGTTTTGGATTCGGAGT CTCAACTCTGGTTGTGCCATGAA GCTGCTGTTGGAAGTCAGC TTCCCTCCTGCAAGCTCTAC ACTCTGGAGGTTGGCACCAT TCATCCAGTATGGCATTCTCACA GCTCCCTCAGCTGGTGGAT CACCATTGCCATTCGATACA GACTCCGCTCGCTCATTC GATCCGAGGGCCTCACTAAAC
TGTTCTTCTTGTCGGTGATGG ATCATAGGGCCCACGACAGGTA AGTGTTCGTTCCTCGGAGTG CAGAGCGCTGGTCATGTAGT GGGTGTGGCTCAGGAGGAT GCAAGGCCAGGACTGACATC CAGGATGGCTTCTAGCGAGTCT TGCGTCTGAAAATCCAAAATC TCTGCCATCTTGAGTGGTGA AGTCCCTGCCCTTTGTACACA
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
4
S. Hirako et al.
ob/ob mice study 10-week-old male C57BL/6J Leptin-deficient (Lepob /Lepob (ob/ob)) and wild type (wild) control mice were obtained from Sankyo Labo Service Corporation (Tokyo, Japan) and provided free access to a normal laboratory diet for 12 weeks (n = 10). The 22-week-old mice were then sacrificed by cervical dislocation, and the liver and WAT were dissected from each mouse, after which total RNA was extracted from each tissue and subjected to RT-PCR.
Statistical analysis Data are expressed as median (minimum— maximum). Data were analysed by Mann—Whitney U test. Statistical significance was accepted at a value of p < 0.05.
Results Body weight and tissue weight The body and WAT weights of the DIO mice increased 1.5-fold and 8.6-fold, respectively, compared with those of lean mice (Table 2). These results suggest that the increase in body weight of the DIO mice is due to an increase in adipose tissue weight. Liver weights were significantly increased in the DIO mice.
Blood glucose and plasma parameters In comparison with lean mice, DIO mice displayed significantly elevated levels of blood glucose and
plasma insulin (Table 2). The plasma leptin level was also approximately 37-fold higher in the DIO mice. Although the plasma total cholesterol level was increased in these mice, no change was observed in their plasma triglyceride level in comparison with lean mice (Table 2).
Liver histology, and lipid levels To investigate whether lipid accumulates in the liver of DIO mice, we performed histological analysis of H&E-stained liver sections. As illustrated in Fig. 1, many lipid droplets were observed in the liver of DIO mice. In contrast, lean mice had no such lipid droplets. The hepatic triglyceride and total cholesterol levels of the DIO mice were 11.1fold and 1.6-fold greater, respectively, than those of lean mice. These results demonstrate that excessive lipids accumulate in the liver of DIO mice, suggesting that this could be the cause of the increase in liver weight observed in these animals.
Hepatic and WAT mRNA expression levels of AQPs and lipid metabolism-related genes in the liver of DIO mouse The mRNA expression of hepatic AQP9 and lipid metabolism-related genes were measured by RTPCR analysis (Table 3 and Fig. 2). The mRNA level of AQP9 was significantly higher in the DIO mice than in the lean mice (Fig. 2A). The mRNA levels of fatty acid synthase (FAS) and stearoyl-CoA desaturase (SCD) 1, which are key enzymes in fatty acid biosynthesis, were also significantly higher in the DIO mice, as were the mRNA levels of diacylglycerol acyltransferase (DGAT) 2, microsomal triglyceride
Table 2 Body weight, tissue weight, plasma glucose metabolism-related parameter levels and plasma lipid levels of lean and DIO mice. Lean Body weight (g) Liver weight (g) WAT weight (g) Blood glucose (mg/dL) Plasma Total cholesterol (mg/mL) Triglyceride (mg/mL) Insulin (ng/mL) Leptin (ng/mL) Liver Total cholesterol (mg/g) Triglyceride (mg/g)
DIO
P value (U test) *
28.75 1.13 0.30 158.00
(27.07—29.43) (1.02—1.18) (0.22—0.51) (148—185)
43.25 1.42 2.59 221.00
(39.41—44.93) (1.32—1.50)* (1.82—2.84)* (186—238)*
207.27 68.04 0.24 2.20
(194.34—216.96) (49.89—133.01) (0.14—0.68) (0.67—4.19)
370.99 52.60 1.85 81.51
(299.55—425.13)* (42.76—87.89) (1.53—4.18)* (52.56—134.74)*
1.75 (1.57—1.91) 5.67 (3.26—6.67)
2.86 (2.32—3.86)* 63.00 (36.43—100.92)*
0.002 0.025 0.002 0.002 0.002 0.109 0.002 0.002 0.002 0.002
Values represent median (minimum—maximum) (n = 7). * p < 0.05, between lean and DIO mice.
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ARTICLE IN PRESS
ORCP-535; No. of Pages 9
Aquaglyceroporin expression in DIO and ob/ob mice
5
Figure 1 Histology of the liver of lean and DIO mice. H&E-stained liver sections of lean (A) and DIO mice (B). Bar = 50 m. Table 3
Expression of genes associated with lipid metabolism in the lean and DIO mice liver. Lean
Fatty acid biosynthesis FAS 100.0 SCD1 100.0 Triacylglycerol biosynthesis DGAT2 100.0 GPAT 100.0 MTP 100.0 Fatty acid -oxidation AOX 100.0 CPT1 100.0
DIO
P value (U test)
(64.5—217.7) (57.2—229.9)
268.1 (68.0—403.1)* 254.8 (98.8—509.0)*
0.022 0.025
(67.1—119.4) (55.7—263.6) (62.7—118.9)
148.1 (77.3—189.6)* 267.7 (111.24—505.76)* 149.3 (98.4—218.3)*
0.025 0.018 0.025
(74.8—174.0) (68.1—128.4)
201.6 (142.8—317.2)* 228.6 (112.5—338.8)*
0.013 0.006
FAS; fatty acid synthase, SCD; stearoyl-CoA desaturase, DGAT; diacylglycerol acyltransferase, GPAT; glycerol-3-phosphate acyltransferase, MTP; microsomal triglyceride transfer protein AOX; acyl-CoA oxidase, CPT; carnitine palmitoyltransferase. Values represent the median (minimum—maximum) (n = 7). * p < 0.05, between Lean and DIO mice.
Figure 2 Expression levels of liver AQP9 mRNA (A), WAT AQP7 mRNA (B), and WAT AQP9 mRNA (C) in lean and DIO mice. Results are expressed as the ratio of the obtained value to that in lean mice. Box plots with whiskers show median, quartiles, and the minimum and maximum range (n = 7). mRNA expression is normalised against that of the housekeeping gene 18s rRNA. *p < 0.05, between lean and DIO mice. n.s.; non-significant. Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ARTICLE IN PRESS
ORCP-535; No. of Pages 9
6
S. Hirako et al. Table 4
Expression of genes associated with lipid metabolism in the wild and ob/ob mice liver. Wild
Fatty acid biosynthesis FAS 100.0 SCD1 100.0 Triacylglycerol biosynthesis DGAT2 100.0 GPAT 100.0 MTP 100.0 Fatty acid -oxidation AOX 100.0 CPT1 100.0
ob/ob
P value (U test)
(39.4—262.7) (48.9—313.0)
872.4 (108.3—1815.8)* 801.3 (495.1—1773.4)*
0.00 0.02
(50.8—179.5) (78.4—115.9) (54.1—235.2)
174.0 (91.97—239.7)* 834.3 (101.0—1261.9)* 345.6 (84.74—385.79)*
0.01 0.03 0.03
(43.7—447.1) (51.0—201.8)
326.8 (67.9—657.0)* 277.0 (93.9—487.0)*
0.03 0.01
FAS; fatty acid synthase, SCD; stearoyl-CoA desaturase, DGAT; diacylglycerol acyltransferase, GPAT; glycerol-3-phosphate acyltransferase, MTP; microsomal triglyceride transfer protein AOX; acyl-CoA oxidase, CPT; carnitine palmitoyltransferase. Values represent the median (minimum-maximum) (n = 10). * p < 0.05, between wild-type and ob/ob mice.
transfer protein (MTP) and glycerol kinase (GyK), which are involved in triacylglycerol biosynthesis. Similarly, the mRNA levels of carnitine palmitoyl transferase (CPT) 1 and acyl-CoA oxidase (AOX), a peroxisome proliferator-activated receptor (PPAR) ␣ target gene involved in fatty acid oxidation, were significantly higher in the DIO mice than in the lean mice. Measurement of mRNA expression in the WAT (Fig. 2B and C) revealed that the level of AQP7 was significantly higher in the DIO mice than in the lean mice. However no difference was observed expression levels of AQP9 between DIO and lean mice.
Hepatic and WAT mRNA expression levels in ob/ob mice The hepatic and WAT mRNA expression profiles in ob/ob mice are presented in Table 4 and Fig. 3. The AQP9 mRNA level in the liver of the obese ob/ob mice was significantly higher than that in wild-type mice. The hepatic mRNA expression levels of genes associated with fatty acid biosynthesis, triacylglycerol biosynthesis and fatty acid oxidation were also higher in the ob/ob mice. In particular, the expression levels of FAS and SCD1 were
Figure 3 Expression levels of liver AQP9 mRNA (A), WAT AQP7 mRNA (B), and WAT AQP9 mRNA (C) in wild and ob/ob mice. Results are expressed as the ratio of the obtained value to that in wild-type mice. Box plots with whiskers show median, quartiles, and the minimum and maximum range (n = 10). mRNA expression is normalised against that of the housekeeping gene 18s rRNA. *p < 0.05, between wild-type and ob/ob mice. n.s.; non-significant. Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
Aquaglyceroporin expression in DIO and ob/ob mice 8.7-fold and 8.0-fold higher, respectively, than those in wild-type mice. The gene expression level of glycerol-3-phosphate acyltransferase (GPAT) which is involved in triglyceride synthesis, was increased 8.3-fold in ob/ob mice and the gene expression levels of CPT1 and AOX, which are involved in fatty acid oxidation, were increased approximately 2.8-fold. However no difference was observed in WAT expression levels of AQP7 and AQP9 between wild-type and ob/ob mice (Fig. 3B and C).
Discussion This study investigated the role of AQP7 and AQP9 in the development of obesity and fatty liver in obese DIO and ob/ob mice. Body weights and epididymal WAT weights were significantly increased in these mice compared with lean mice. In addition, DIO mice displayed significantly elevated levels of blood glucose and plasma insulin. In particular, there was a dramatic increase in plasma leptin levels in these mice. Moreover, the lipid accumulation in their liver was significantly increased. It has been reported that obese mice, other than ob/ob mice, exhibit hyperinsulinemia and hyperleptinemia [23—25], and that excessive lipid accumulates in the liver [26,27]. In this study, hyperinsulinemia, hyperleptinemia and fatty liver were observed in the DIO mice. In order to evaluate the relationship between aquaglyceroporins such as AQP7 and AQP9 and lipid metabolism, we examined the mRNA expression levels of AQP7, AQP9, and lipid metabolism-related genes. The mRNA levels of AOX and CPT1 were also significantly increased in the DIO and ob/ob mice. Previous studies have demonstrated that PPAR␣ is activated by dietary fatty acids and that the expression of PPAR␣ target genes is increased in obese mice [28,29]. Based on our data, we believe that fatty acid beta-oxidationrelated gene expression is increased in DIO mice via PPAR␣ activation. We also consider that elevated fatty acid oxidation is a compensatory mechanism to decrease the excessive fat which accumulates in the liver. Previous studies have demonstrated that the expression of fatty acid biosynthesisrelated genes is increased in ob/ob mice and that this rise can be overcome by the administration of leptin [30,31], suggesting that the difference observed between these animals and DIO mice can be explained by the lack of leptin in the former model. The aquaglyceroporins AQP7 and AQP9 are important channel proteins that are involved in the metabolism of glycerol and triglycerides, and
7 the mRNA expression levels of adipose AQP7 and hepatic AQP9 were higher in DIO mice than in lean animals. AQP9 is a target gene of PPAR␣, which is involved in fatty acid oxidation [32], whereas AQP7 is a target gene of PPAR␥, which is a regulator of adipocyte differentiation and lipid metabolism [33]. It has been reported that PPAR␥ is activated by dietary fatty acids, as well as obesity [34]. Moreover, the expression of AQP7 and AQP9 is increased in insulin resistance [8,14]. In previous studies, adipose AQP7 and hepatic AQP9 gene expression were shown to increase in the db/db model of obesity and diabetes, as well as in response to STZ administration, which is a type 1 diabetes model [8]. In the current study, hyperinsulinemia was observed in DIO mice, suggesting that AQP7 and AQP9 gene expression may be increased by insulin resistance, in addition to PPAR␥ or PPAR␣ activation. Interestingly, there was no difference in adipose AQP7 expression between ob/ob and wild-type mice due to the leptin deficiency of the former. In contrast, DIO and db/db mice are leptin-resistant, leading to significant production of leptin by adipocytes and a very high blood leptin level [24,25]. These findings suggest that the blood and/or adipocyte leptin concentrations are more important in the regulation of AQP7 expression than a state of leptin or insulin resistance. Recently, we demonstrated that muscle AQP7 expression is increased in ob/ob mice [21]. It has been suggested that AQP7 and AQP9 have different expression regulatory mechanisms and that they are controlled by various factors in a complicated manner. In this study, the expression levels of adipose AQP7 and hepatic AQP9 increased in DIO mice, although adipose AQP9 level was same as control level. In other words, the secretion of glycerol from adipocytes increased, as did glycerol uptake by the liver. Glycerol is the metabolic intermediate of gluconeogenesis and triglyceride synthesis. The gene expression of fatty acid and triglyceride synthesis-related enzymes increased in the adipocyte of DIO mice. AQP7 deficiency is associated with increased fat mass and the development of obesity [14,35,36]. Furthermore, this deficiency causes insulin resistance. Thus, the increase in adipose AQP7 expression in DIO mice provides a mechanism to inhibit excessive fat accumulation in adipose tissue, whereas the increase in AQP9 expression in the liver maintains homeostasis of plasma lipids and glycerol. In summary, this study demonstrates that AQP7 and AQP9 play an important role in lipid metabolism, making them potential targets in the treatment of obesity and fatty liver.
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
8
S. Hirako et al.
Conflict of interest No potential conflicts of interest were disclosed.
Acknowledgments This work was supported in part by a Research Grant from the Asahi Group Foundation to Y.W. and a Grant-in-Aid for Scientific Research on Innovative Areas (to SS no. 22126004) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
References [1] Wilson PW, D’Agostino RB, Sullivan L, Parise H, Kannel WB. Overweight and obesity as determinants of cardiovascular risk: the Framingham experience. Arch Intern Med 2002;162:1867—72. [2] Meshkani R, Adeli K. Hepatic insulin resistance, metabolic syndrome and cardiovascular disease. Clin Biochem 2009;42:1331—46. [3] Watt MJ, Spriet LL. Triacylglycerol lipases and metabolic control: implications for health and disease. Am J Physiol Endocrinol Metab 2010;299:E162—8. [4] Zechner R, Kienesberger PC, Haemmerle G, Zimmermann R, Lass A. Adipose triglyceride lipase and the lipolytic catabolism of cellular fat stores. J Lipid Res 2009;50: 3—21. [5] King LS, Kozono D, Agre P. From structure to disease: the evolving tale of aquaporin biology. Nat Rev Mol Cell Biol 2004;5:687—98. [6] Agre P, Kozono D. Aquaporin water channels: molecular mechanisms for human diseases. FEBS Lett 2003;555:72—8. [7] Kishida K, Kuriyama H, Funahashi T, Shimomura I, Kihara S, Ouchi N, et al. Aquaporin adipose, a putative glycerol channel in adipocytes. J Biol Chem 2000;275:20896—902. [8] Lebeck J. Metabolic impact of the glycerol channels AQP7 and AQP9 in adipose tissue and liver. J Mol Endocrinol 2014;52:R165—78. [9] Kishida K, Shimomura I, Kondo H, Kuriyama H, Makino Y, Nishizawa H, et al. Genomic structure and insulinmediated repression of the aquaporin adipose (AQPap), adipose-specific glycerol channel. J Biol Chem 2001;276: 36251—60. [10] Wakayama Y, Inoue M, Kojima H, Jimi T, Shibuya S, Hara H, et al. Expression and localization of aquaporin 7 in normal skeletal myofiber. Cell Tissue Res 2004;316:123—9. [11] Ishibashi K, Kuwahara M, Gu Y, Tanaka Y, Marumo F, Sasaki S. Cloning and functional expression of a new aquaporin (AQP9) abundantly expressed in the peripheral leukocytes permeable to water and urea, but not to glycerol. Biochem Biophys Res Commun 1998;244:268—74. [12] Tsukaguchi H, Shayakul C, Berger UV, Mackenzie B, Devidas S, Guggino WB, et al. Molecular characterization of a broad selectivity neutral solute channel. J Biol Chem 1998;273:24737—43. [13] Maeda N. Implications of aquaglyceroporins 7 and 9 in glycerol metabolism and metabolic syndrome. Mol Aspects Med 2012;33:665—75. [14] Maeda N, Funahashi T, Shimomura I. Metabolic impact of adipose and hepatic glycerol channels aquaporin
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
7 and aquaporin 9. Nat Clin Pract Endocrinol Metab 2008;4:627—34. Maeda N, Hibuse T, Funahashi T. Role of aquaporin-7 and aquaporin-9 in glycerol metabolism; involvement in obesity. Handb Exp Pharmacol 2009:233—49. Rodriguez A, Catalan V, Gomez-Ambrosi J, Fruhbeck G. Role of aquaporin-7 in the pathophysiological control of fat accumulation in mice. FEBS Lett 2006;580:4771—6. Skowronski MT, Lebeck J, Rojek A, Praetorius J, Fuchtbauer EM, Frokiaer J, et al. AQP7 is localized in capillaries of adipose tissue, cardiac and striated muscle: implications in glycerol metabolism. Am J Physiol Renal Physiol 2007;292:F956—65. Kondo H, Shimomura I, Kishida K, Kuriyama H, Makino Y, Nishizawa H, et al. Human aquaporin adipose (AQPap) gene. Genomic structure, promoter analysis and functional mutation. Eur J Biochem/FEBS 2002;269:1814—26. Carbrey JM, Gorelick-Feldman DA, Kozono D, Praetorius J, Nielsen S, Agre P. Aquaglyceroporin AQP9: solute permeation and metabolic control of expression in liver. Proc Natl Acad Sci U S A 2003;100:2945—50. Kuriyama H, Shimomura I, Kishida K, Kondo H, Furuyama N, Nishizawa H, et al. Coordinated regulation of fat-specific and liver-specific glycerol channels, aquaporin adipose and aquaporin 9. Diabetes 2002;51:2915—21. Wakayama Y, Hirako S, Ogawa T, Jimi T, Shioda S. Upregulated expression of AQP 7 in the skeletal muscles of obese ob/ob mice. Acta Histochem Cytochem 2014;47:27—33. Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 1957;226:497—509. Havel PJ, Kasim-Karakas S, Mueller W, Johnson PR, Gingerich RL, Stern JS. Relationship of plasma leptin to plasma insulin and adiposity in normal weight and overweight women: effects of dietary fat content and sustained weight loss. J Clin Endocrinol Metab 1996;81:4406—13. Takahashi N, Patel HR, Qi Y, Dushay J, Ahima RS. Divergent effects of leptin in mice susceptible or resistant to obesity. Hormone Metab Res = Hormon- und Stoffwechselforschung = Hormones et metabolisme 2002;34: 691—7. Van Heek M, Compton DS, France CF, Tedesco RP, Fawzi AB, Graziano MP, et al. Diet-induced obese mice develop peripheral, but not central, resistance to leptin. J Clin Investig 1997;99:385—90. Arai T, Kim H, Chiba H, Matsumoto A. Anti-obesity effect of fish oil and fish oil—fenofibrate combination in female KK mice. J Atheroscler Thromb 2009;16:674—83. Arai T, Kim H, Hirako S, Nakasatomi M, Chiba H, Matsumoto A. Effects of dietary fat energy restriction and fish oil feeding on hepatic metabolic abnormalities and insulin resistance in KK mice with high-fat diet-induced obesity. J Nutr Biochem 2013;24:267—73. Chavin KD, Yang S, Lin HZ, Chatham J, Chacko VP, Hoek JB, et al. Obesity induces expression of uncoupling protein-2 in hepatocytes and promotes liver ATP depletion. J Biol Chem 1999;274:5692—700. Monsalve FA, Pyarasani RD, Delgado-Lopez F, MooreCarrasco R. Peroxisome proliferator-activated receptor targets for the treatment of metabolic diseases. Med Inflamm 2013;2013:549627. Biddinger SB, Miyazaki M, Boucher J, Ntambi JM, Kahn CR. Leptin suppresses stearoyl-CoA desaturase 1 by mechanisms independent of insulin and sterol regulatory elementbinding protein-1c. Diabetes 2006;55:2032—41. Shimomura I, Bashmakov Y, Horton JD. Increased levels of nuclear SREBP-1c associated with fatty livers in
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
Aquaglyceroporin expression in DIO and ob/ob mice two mouse models of diabetes mellitus. J Biol Chem 1999;274:30028—32. [32] Rakhshandehroo M, Knoch B, Muller M, Kersten S. Peroxisome proliferator-activated receptor alpha target genes. PPAR Res 2010. Article ID 612089. [33] Kishida K, Shimomura I, Nishizawa H, Maeda N, Kuriyama H, Kondo H, et al. Enhancement of the aquaporin adipose gene expression by a peroxisome proliferator-activated receptor gamma. J Biol Chem 2001;276:48572—9. [34] Kubota N, Terauchi Y, Miki H, Tamemoto H, Yamauchi T, Komeda K, et al. PPAR gamma mediates high-fat
9 diet-induced adipocyte hypertrophy and insulin resistance. Mol Cell 1999;4:597—609. [35] Hara-Chikuma M, Sohara E, Rai T, Ikawa M, Okabe M, Sasaki S, et al. Progressive adipocyte hypertrophy in aquaporin-7-deficient mice: adipocyte glycerol permeability as a novel regulator of fat accumulation. J Biol Chem 2005;280:15493—6. [36] Hibuse T, Maeda N, Funahashi T, Yamamoto K, Nagasawa A, Mizunoya W, et al. Aquaporin 7 deficiency is associated with development of obesity through activation of adipose glycerol kinase. Proc Natl Acad Sci U S A 2005;102:10993—8.
Available online at www.sciencedirect.com
ScienceDirect
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ARTICLE IN PRESS
Obesity Research & Clinical Practice (2015) xxx, xxx—xxx
The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice Satoshi Hirako a, Yoshihiro Wakayama b,c, Hyounju Kim d, Yuzuru Iizuka d, Akiyo Matsumoto d, Nobuhiro Wada e, Ai Kimura f, Mai Okabe g, Junichi Sakagami b, Mamiko Suzuki h, Fumiko Takenoya i, Seiji Shioda f,∗ a
Department of Health and Nutrition, University of Human Arts and Sciences, Saitama, Japan b Department of Anatomy, Showa University School of Medicine, Tokyo, Japan c Wakayama Clinic, Machida-shi, Tokyo, Japan d Department of Clinical Dietetics & Human Nutrition, Faculty of Pharmaceutical Sciences, Josai University, Saitama, Japan e Department of Internal Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan f Hoshi University School of Pharmacy and Pharmaceutical Sciences Global Research Center for Innovative Life Science Peptide Drug Innovation, Tokyo, Japan g Tokyo Shokuryo Dietitian Academy, Tokyo, Japan h Department of Biochemistry, Showa University School of Medicine, Tokyo, Japan i Department of Exercise and Sports Physiology, Hoshi University School of Pharmacy and Pharmaceutical Science, Tokyo, Japan Received 15 January 2015 ; received in revised form 24 November 2015; accepted 4 December 2015
KEYWORDS AQP7; AQP9; Obesity;
Summary Aquaporin (AQP) 7 and AQP9 are subcategorised as aquaglyceroporins which transport glycerin in addition to water. These AQPs may play a role in the homeostasis of energy metabolism. We examined the effect of AQP7, AQP9, and lipid metabolism-related gene expression in obese mice. In diet-induced obese (DIO)
∗ Corresponding author at: Hoshi University School of Pharmacy and Pharmaceutical Sciences Global Research, Center for Innovative Life Science Peptide Drug Innovation, 2-4-41 Ebara, Shinagawa-ku, Tokyo 142-8501, Japan. Tel.: +81 3 5498 5853; fax: +81 3 5498 5853. E-mail address: [email protected] (S. Shioda).
http://dx.doi.org/10.1016/j.orcp.2015.12.001 1871-403X/© 2015 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
2
S. Hirako et al. Lipid metabolism; Hepatic lipids
mice, excess lipid accumulated in the liver, which was hyperleptinemic and hyperinsulinemic. Hepatic AQP9 gene expression was significantly increased in both DIO and ob/ob mice compared to controls. The mRNA expression levels of fatty acid and triglyceride synthesis-related genes and fatty acid  oxidation-related genes in the liver were also higher in both mouse models, suggesting that triglyceride synthesis in this organ is promoted as a result of glycerol release from adipocytes. Adipose AQP7 and AQP9 gene expressions were increased in DIO mice, but there was no difference in ob/ob mice compared to wild-type mice. In summary, adipose AQP7 and AQP9 gene expressions are increased by diet-induced obesity, indicating that this is one of the mechanisms by which lipid accumulates in response to a high fat diet, not the genetic mutation of ob/ob mice. Hepatic AQP9 gene expression was increased in both obesity model mice. AQP7 and AQP9 therefore have the potential of defining molecules for the characterisation of obesity or fatty liver and may be a target molecules for the treatment of those disease. © 2015 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.
Introduction Obesity increases the risk of developing diabetes, fatty liver, hypertension, hyperlipidemia, metabolic syndrome, coronary heart disease, and stroke [1,2], and preventing this condition is important in the healthy maintenance of the body. Obesity is the state in which surplus energy accumulates as fat as a result of excessive energy intake and low energy expenditure due to lack of exercise. The adipose tissue undergoes lipogenesis and lipolysis depending on the energy balance. In the hypertrophic state, the adipocytes store triglycerides, whereas in response to starvation and sympathetic nerve activation, they degrade triglycerides and release free fatty acids (FFA) and glycerol into the blood to supply energy to the entire body [3,4]. Aquaporins (AQPs) are channels that allow the movement of water across the cell membrane [5]. Certain members of this family, the aquaglyceroporins, which include AQP3, 7, 9, and 10, transport glycerol as well as water and are involved in the biosynthesis of triglycerides [6]. The AQP7 gene was first cloned from human adipose tissue [7]. AQP7 is localised to a wide range of tissues in rodents. It is abundantly expressed in adipose tissue [8], and is also expressed in kidney, pancreas, and muscle [9,10]. The AQP9 gene was first cloned from a human liver cDNA library [11]. In rats, AQP9 mRNA has been found in the liver, testis, brain, and lung [12]. The FFA and glycerol generated in adipocytes are released to other tissues, and the efflux of glycerol from adipose tissue is facilitated by AQP7 [13—16]. In the liver AQP9 facilitates the uptake of glycerol,
which is metabolised to glycerol 3-phosphate via the glycolytic pathway [13—16]. Hence, both AQP7 and AQP9 seem to play an important role in the homeostasis of energy metabolism. The expression levels of these genes in adipocytes and hepatocytes are reduced by feeding and increased by fasting, in parallel to the changes in plasma glycerol levels [7,17]. In rodents, AQP7 expression in the adipose tissue and AQP9 expression in the liver are downregulated by insulin. Streptozotocin (STZ)-induced diabetic mice exhibit increased expression levels of adipocyte AQP7 and hepatic AQP9 [18—20]. In addition, the gene expression of adipocyte AQP7 and hepatic AQP9 are increased in leptin receptor deficient db/db mice [20]. Recently, we demonstrated that AQP7 expression is upregulated in the skeletal muscle of leptin deficient ob/ob mice [21]. Many reports have described the function and regulation of the aquaglyceroporins in ob/ob and db/db mice as models of obesity, but there have been fewer studies of diet-induced obese (DIO) mice. Here we investigated the AQP gene expression profiles of DIO and ob/ob mice, and examined the role of AQP7 and AQP9 in their lipid metabolism.
Materials and methods Animals and diets Male C57BL/6J mice were obtained from Sankyo Labo Service Corporation (Tokyo, Japan) at 5 weeks of age and fed a normal laboratory diet for 1 week to acclimatise the animals to their new conditions. The mice were divided into 2 groups (lean or DIO group, n = 7 in each group). At the beginning of
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
Aquaglyceroporin expression in DIO and ob/ob mice experiment, body weight was the same between the two groups (lean group; 20.4 ± 0.63 g vs DIO group; 20.6 ± 0.56 g (p = 0.999)). Mice in the lean control group were fed a normal laboratory diet (Labo MR stock; 15.2 energy % of fat; Nosan Corporation, Japan), whereas the DIO mice received a high-fat diet (D12451; 45 energy % of fat; Research Diets, NJ, USA) ad libitum for 16 weeks to induce obesity. Animals were reared in a room with controlled temperature (20 ± 2 ◦ C), humidity (55 ± 15%), and a 12-h day cycle (8:00 AM—8:00 PM). The food was changed at 15:00 every day. All animal studies were conducted in accordance with the ‘‘Standards Relating to the Care and Management of Experimental Animals’’ (Notice No. 6 of the Office of Prime Minister dated March 27, 1980) and with approval from the Animal Use Committee of Showa University.
3 analysis. The removed organs were frozen in liquid nitrogen and stored at −80 ◦ C.
Quantification of hepatic and plasma profile Hepatic lipids were extracted from approximately 100 mg of liver tissue for each mouse in accordance with the method of Folch et al. [22]. Triacylglyceride and total cholesterol in the liver were measured using the Triglyceride E-Test and Cholesterol E-Test kits (Wako Pure Chemical Industries, Ltd.), respectively. Quantification of plasma triacylglyceride and total cholesterol levels was performed using the same test kits. Plasma insulin and leptin levels were quantified by enzyme-linked immunosorbent assays (ELISA) using the Insulin ELISA kit and the Leptin/mouse ELISA kit, respectively (Morinaga Institute of Biological Science, Tokyo, Japan).
Collection of blood and tissue samples The mice were starved for 3 h and were anesthetised by intraperitoneal injection of pentobarbital sodium (Dainippon Sumitomo Pharma, Osaka, Japan). Blood samples were collected from the tail vein, and glucose was measured using a Medisafe-Mini (Terumo, Tokyo, Japan), after which the animals were dissected. Blood samples were collected from the heart and treated with heparin. The liver and epididymal white adipose tissues (WAT) were removed immediately and weighed. A piece of liver tissue was excised from the median lobe of the liver. Liver samples were individually collected for each group and fixed with 10% neutral buffered formalin (Wako Pure Chemical Industries, Ltd.). The samples were embedded in paraffin, cut into sections, and stained with hematoxylin—eosin (H&E) for histopathological examination. Plasma was obtained by centrifugation (900 × g, 4 ◦ C, 10 min) and frozen at −80 ◦ C for storage until Table 1
Quantification of mRNA expression Total RNA was extracted from the liver and WAT sample of each mouse using TRIzol (Life Technologies, Inc.) and was then converted into cDNA with the Affinity-Script QPCR cDNA Synthesis Kit (Agilent Technologies). A real-time polymerase chain reaction (RT-PCR) was performed using SYBR Premix Ex Taq II reagent (TaKaRa BIO INC) with an ABI PRISM 7900 sequence detection system (Life Technologies, Inc.). The thermal cycling conditions were as follows: 95 ◦ C for 30 s followed by 45 cycles at 95 ◦ C for 5 s and extension at 72 ◦ C for 1 min. Relative copy numbers were obtained from standard curve values and were normalised to 18s rRNA. DIO and ob/ob mouse mRNA levels were normalised as a percentage of the values obtained in control lean and wild-type mice, respectively. The primers used for real-time PCR analysis are listed in Table 1.
Primer for RT-PCR amplification of indicated genes.
Gene
Forward primer (5 —3 )
Reverse primer (5 —3 )
AQP7 AQP9 FAS SCD1 DGAT2 GPAT MTP AOX CPT1 18S rRNA
TGGGTTTTGGATTCGGAGT CTCAACTCTGGTTGTGCCATGAA GCTGCTGTTGGAAGTCAGC TTCCCTCCTGCAAGCTCTAC ACTCTGGAGGTTGGCACCAT TCATCCAGTATGGCATTCTCACA GCTCCCTCAGCTGGTGGAT CACCATTGCCATTCGATACA GACTCCGCTCGCTCATTC GATCCGAGGGCCTCACTAAAC
TGTTCTTCTTGTCGGTGATGG ATCATAGGGCCCACGACAGGTA AGTGTTCGTTCCTCGGAGTG CAGAGCGCTGGTCATGTAGT GGGTGTGGCTCAGGAGGAT GCAAGGCCAGGACTGACATC CAGGATGGCTTCTAGCGAGTCT TGCGTCTGAAAATCCAAAATC TCTGCCATCTTGAGTGGTGA AGTCCCTGCCCTTTGTACACA
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
4
S. Hirako et al.
ob/ob mice study 10-week-old male C57BL/6J Leptin-deficient (Lepob /Lepob (ob/ob)) and wild type (wild) control mice were obtained from Sankyo Labo Service Corporation (Tokyo, Japan) and provided free access to a normal laboratory diet for 12 weeks (n = 10). The 22-week-old mice were then sacrificed by cervical dislocation, and the liver and WAT were dissected from each mouse, after which total RNA was extracted from each tissue and subjected to RT-PCR.
Statistical analysis Data are expressed as median (minimum— maximum). Data were analysed by Mann—Whitney U test. Statistical significance was accepted at a value of p < 0.05.
Results Body weight and tissue weight The body and WAT weights of the DIO mice increased 1.5-fold and 8.6-fold, respectively, compared with those of lean mice (Table 2). These results suggest that the increase in body weight of the DIO mice is due to an increase in adipose tissue weight. Liver weights were significantly increased in the DIO mice.
Blood glucose and plasma parameters In comparison with lean mice, DIO mice displayed significantly elevated levels of blood glucose and
plasma insulin (Table 2). The plasma leptin level was also approximately 37-fold higher in the DIO mice. Although the plasma total cholesterol level was increased in these mice, no change was observed in their plasma triglyceride level in comparison with lean mice (Table 2).
Liver histology, and lipid levels To investigate whether lipid accumulates in the liver of DIO mice, we performed histological analysis of H&E-stained liver sections. As illustrated in Fig. 1, many lipid droplets were observed in the liver of DIO mice. In contrast, lean mice had no such lipid droplets. The hepatic triglyceride and total cholesterol levels of the DIO mice were 11.1fold and 1.6-fold greater, respectively, than those of lean mice. These results demonstrate that excessive lipids accumulate in the liver of DIO mice, suggesting that this could be the cause of the increase in liver weight observed in these animals.
Hepatic and WAT mRNA expression levels of AQPs and lipid metabolism-related genes in the liver of DIO mouse The mRNA expression of hepatic AQP9 and lipid metabolism-related genes were measured by RTPCR analysis (Table 3 and Fig. 2). The mRNA level of AQP9 was significantly higher in the DIO mice than in the lean mice (Fig. 2A). The mRNA levels of fatty acid synthase (FAS) and stearoyl-CoA desaturase (SCD) 1, which are key enzymes in fatty acid biosynthesis, were also significantly higher in the DIO mice, as were the mRNA levels of diacylglycerol acyltransferase (DGAT) 2, microsomal triglyceride
Table 2 Body weight, tissue weight, plasma glucose metabolism-related parameter levels and plasma lipid levels of lean and DIO mice. Lean Body weight (g) Liver weight (g) WAT weight (g) Blood glucose (mg/dL) Plasma Total cholesterol (mg/mL) Triglyceride (mg/mL) Insulin (ng/mL) Leptin (ng/mL) Liver Total cholesterol (mg/g) Triglyceride (mg/g)
DIO
P value (U test) *
28.75 1.13 0.30 158.00
(27.07—29.43) (1.02—1.18) (0.22—0.51) (148—185)
43.25 1.42 2.59 221.00
(39.41—44.93) (1.32—1.50)* (1.82—2.84)* (186—238)*
207.27 68.04 0.24 2.20
(194.34—216.96) (49.89—133.01) (0.14—0.68) (0.67—4.19)
370.99 52.60 1.85 81.51
(299.55—425.13)* (42.76—87.89) (1.53—4.18)* (52.56—134.74)*
1.75 (1.57—1.91) 5.67 (3.26—6.67)
2.86 (2.32—3.86)* 63.00 (36.43—100.92)*
0.002 0.025 0.002 0.002 0.002 0.109 0.002 0.002 0.002 0.002
Values represent median (minimum—maximum) (n = 7). * p < 0.05, between lean and DIO mice.
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ARTICLE IN PRESS
ORCP-535; No. of Pages 9
Aquaglyceroporin expression in DIO and ob/ob mice
5
Figure 1 Histology of the liver of lean and DIO mice. H&E-stained liver sections of lean (A) and DIO mice (B). Bar = 50 m. Table 3
Expression of genes associated with lipid metabolism in the lean and DIO mice liver. Lean
Fatty acid biosynthesis FAS 100.0 SCD1 100.0 Triacylglycerol biosynthesis DGAT2 100.0 GPAT 100.0 MTP 100.0 Fatty acid -oxidation AOX 100.0 CPT1 100.0
DIO
P value (U test)
(64.5—217.7) (57.2—229.9)
268.1 (68.0—403.1)* 254.8 (98.8—509.0)*
0.022 0.025
(67.1—119.4) (55.7—263.6) (62.7—118.9)
148.1 (77.3—189.6)* 267.7 (111.24—505.76)* 149.3 (98.4—218.3)*
0.025 0.018 0.025
(74.8—174.0) (68.1—128.4)
201.6 (142.8—317.2)* 228.6 (112.5—338.8)*
0.013 0.006
FAS; fatty acid synthase, SCD; stearoyl-CoA desaturase, DGAT; diacylglycerol acyltransferase, GPAT; glycerol-3-phosphate acyltransferase, MTP; microsomal triglyceride transfer protein AOX; acyl-CoA oxidase, CPT; carnitine palmitoyltransferase. Values represent the median (minimum—maximum) (n = 7). * p < 0.05, between Lean and DIO mice.
Figure 2 Expression levels of liver AQP9 mRNA (A), WAT AQP7 mRNA (B), and WAT AQP9 mRNA (C) in lean and DIO mice. Results are expressed as the ratio of the obtained value to that in lean mice. Box plots with whiskers show median, quartiles, and the minimum and maximum range (n = 7). mRNA expression is normalised against that of the housekeeping gene 18s rRNA. *p < 0.05, between lean and DIO mice. n.s.; non-significant. Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ARTICLE IN PRESS
ORCP-535; No. of Pages 9
6
S. Hirako et al. Table 4
Expression of genes associated with lipid metabolism in the wild and ob/ob mice liver. Wild
Fatty acid biosynthesis FAS 100.0 SCD1 100.0 Triacylglycerol biosynthesis DGAT2 100.0 GPAT 100.0 MTP 100.0 Fatty acid -oxidation AOX 100.0 CPT1 100.0
ob/ob
P value (U test)
(39.4—262.7) (48.9—313.0)
872.4 (108.3—1815.8)* 801.3 (495.1—1773.4)*
0.00 0.02
(50.8—179.5) (78.4—115.9) (54.1—235.2)
174.0 (91.97—239.7)* 834.3 (101.0—1261.9)* 345.6 (84.74—385.79)*
0.01 0.03 0.03
(43.7—447.1) (51.0—201.8)
326.8 (67.9—657.0)* 277.0 (93.9—487.0)*
0.03 0.01
FAS; fatty acid synthase, SCD; stearoyl-CoA desaturase, DGAT; diacylglycerol acyltransferase, GPAT; glycerol-3-phosphate acyltransferase, MTP; microsomal triglyceride transfer protein AOX; acyl-CoA oxidase, CPT; carnitine palmitoyltransferase. Values represent the median (minimum-maximum) (n = 10). * p < 0.05, between wild-type and ob/ob mice.
transfer protein (MTP) and glycerol kinase (GyK), which are involved in triacylglycerol biosynthesis. Similarly, the mRNA levels of carnitine palmitoyl transferase (CPT) 1 and acyl-CoA oxidase (AOX), a peroxisome proliferator-activated receptor (PPAR) ␣ target gene involved in fatty acid oxidation, were significantly higher in the DIO mice than in the lean mice. Measurement of mRNA expression in the WAT (Fig. 2B and C) revealed that the level of AQP7 was significantly higher in the DIO mice than in the lean mice. However no difference was observed expression levels of AQP9 between DIO and lean mice.
Hepatic and WAT mRNA expression levels in ob/ob mice The hepatic and WAT mRNA expression profiles in ob/ob mice are presented in Table 4 and Fig. 3. The AQP9 mRNA level in the liver of the obese ob/ob mice was significantly higher than that in wild-type mice. The hepatic mRNA expression levels of genes associated with fatty acid biosynthesis, triacylglycerol biosynthesis and fatty acid oxidation were also higher in the ob/ob mice. In particular, the expression levels of FAS and SCD1 were
Figure 3 Expression levels of liver AQP9 mRNA (A), WAT AQP7 mRNA (B), and WAT AQP9 mRNA (C) in wild and ob/ob mice. Results are expressed as the ratio of the obtained value to that in wild-type mice. Box plots with whiskers show median, quartiles, and the minimum and maximum range (n = 10). mRNA expression is normalised against that of the housekeeping gene 18s rRNA. *p < 0.05, between wild-type and ob/ob mice. n.s.; non-significant. Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
Aquaglyceroporin expression in DIO and ob/ob mice 8.7-fold and 8.0-fold higher, respectively, than those in wild-type mice. The gene expression level of glycerol-3-phosphate acyltransferase (GPAT) which is involved in triglyceride synthesis, was increased 8.3-fold in ob/ob mice and the gene expression levels of CPT1 and AOX, which are involved in fatty acid oxidation, were increased approximately 2.8-fold. However no difference was observed in WAT expression levels of AQP7 and AQP9 between wild-type and ob/ob mice (Fig. 3B and C).
Discussion This study investigated the role of AQP7 and AQP9 in the development of obesity and fatty liver in obese DIO and ob/ob mice. Body weights and epididymal WAT weights were significantly increased in these mice compared with lean mice. In addition, DIO mice displayed significantly elevated levels of blood glucose and plasma insulin. In particular, there was a dramatic increase in plasma leptin levels in these mice. Moreover, the lipid accumulation in their liver was significantly increased. It has been reported that obese mice, other than ob/ob mice, exhibit hyperinsulinemia and hyperleptinemia [23—25], and that excessive lipid accumulates in the liver [26,27]. In this study, hyperinsulinemia, hyperleptinemia and fatty liver were observed in the DIO mice. In order to evaluate the relationship between aquaglyceroporins such as AQP7 and AQP9 and lipid metabolism, we examined the mRNA expression levels of AQP7, AQP9, and lipid metabolism-related genes. The mRNA levels of AOX and CPT1 were also significantly increased in the DIO and ob/ob mice. Previous studies have demonstrated that PPAR␣ is activated by dietary fatty acids and that the expression of PPAR␣ target genes is increased in obese mice [28,29]. Based on our data, we believe that fatty acid beta-oxidationrelated gene expression is increased in DIO mice via PPAR␣ activation. We also consider that elevated fatty acid oxidation is a compensatory mechanism to decrease the excessive fat which accumulates in the liver. Previous studies have demonstrated that the expression of fatty acid biosynthesisrelated genes is increased in ob/ob mice and that this rise can be overcome by the administration of leptin [30,31], suggesting that the difference observed between these animals and DIO mice can be explained by the lack of leptin in the former model. The aquaglyceroporins AQP7 and AQP9 are important channel proteins that are involved in the metabolism of glycerol and triglycerides, and
7 the mRNA expression levels of adipose AQP7 and hepatic AQP9 were higher in DIO mice than in lean animals. AQP9 is a target gene of PPAR␣, which is involved in fatty acid oxidation [32], whereas AQP7 is a target gene of PPAR␥, which is a regulator of adipocyte differentiation and lipid metabolism [33]. It has been reported that PPAR␥ is activated by dietary fatty acids, as well as obesity [34]. Moreover, the expression of AQP7 and AQP9 is increased in insulin resistance [8,14]. In previous studies, adipose AQP7 and hepatic AQP9 gene expression were shown to increase in the db/db model of obesity and diabetes, as well as in response to STZ administration, which is a type 1 diabetes model [8]. In the current study, hyperinsulinemia was observed in DIO mice, suggesting that AQP7 and AQP9 gene expression may be increased by insulin resistance, in addition to PPAR␥ or PPAR␣ activation. Interestingly, there was no difference in adipose AQP7 expression between ob/ob and wild-type mice due to the leptin deficiency of the former. In contrast, DIO and db/db mice are leptin-resistant, leading to significant production of leptin by adipocytes and a very high blood leptin level [24,25]. These findings suggest that the blood and/or adipocyte leptin concentrations are more important in the regulation of AQP7 expression than a state of leptin or insulin resistance. Recently, we demonstrated that muscle AQP7 expression is increased in ob/ob mice [21]. It has been suggested that AQP7 and AQP9 have different expression regulatory mechanisms and that they are controlled by various factors in a complicated manner. In this study, the expression levels of adipose AQP7 and hepatic AQP9 increased in DIO mice, although adipose AQP9 level was same as control level. In other words, the secretion of glycerol from adipocytes increased, as did glycerol uptake by the liver. Glycerol is the metabolic intermediate of gluconeogenesis and triglyceride synthesis. The gene expression of fatty acid and triglyceride synthesis-related enzymes increased in the adipocyte of DIO mice. AQP7 deficiency is associated with increased fat mass and the development of obesity [14,35,36]. Furthermore, this deficiency causes insulin resistance. Thus, the increase in adipose AQP7 expression in DIO mice provides a mechanism to inhibit excessive fat accumulation in adipose tissue, whereas the increase in AQP9 expression in the liver maintains homeostasis of plasma lipids and glycerol. In summary, this study demonstrates that AQP7 and AQP9 play an important role in lipid metabolism, making them potential targets in the treatment of obesity and fatty liver.
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
8
S. Hirako et al.
Conflict of interest No potential conflicts of interest were disclosed.
Acknowledgments This work was supported in part by a Research Grant from the Asahi Group Foundation to Y.W. and a Grant-in-Aid for Scientific Research on Innovative Areas (to SS no. 22126004) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
References [1] Wilson PW, D’Agostino RB, Sullivan L, Parise H, Kannel WB. Overweight and obesity as determinants of cardiovascular risk: the Framingham experience. Arch Intern Med 2002;162:1867—72. [2] Meshkani R, Adeli K. Hepatic insulin resistance, metabolic syndrome and cardiovascular disease. Clin Biochem 2009;42:1331—46. [3] Watt MJ, Spriet LL. Triacylglycerol lipases and metabolic control: implications for health and disease. Am J Physiol Endocrinol Metab 2010;299:E162—8. [4] Zechner R, Kienesberger PC, Haemmerle G, Zimmermann R, Lass A. Adipose triglyceride lipase and the lipolytic catabolism of cellular fat stores. J Lipid Res 2009;50: 3—21. [5] King LS, Kozono D, Agre P. From structure to disease: the evolving tale of aquaporin biology. Nat Rev Mol Cell Biol 2004;5:687—98. [6] Agre P, Kozono D. Aquaporin water channels: molecular mechanisms for human diseases. FEBS Lett 2003;555:72—8. [7] Kishida K, Kuriyama H, Funahashi T, Shimomura I, Kihara S, Ouchi N, et al. Aquaporin adipose, a putative glycerol channel in adipocytes. J Biol Chem 2000;275:20896—902. [8] Lebeck J. Metabolic impact of the glycerol channels AQP7 and AQP9 in adipose tissue and liver. J Mol Endocrinol 2014;52:R165—78. [9] Kishida K, Shimomura I, Kondo H, Kuriyama H, Makino Y, Nishizawa H, et al. Genomic structure and insulinmediated repression of the aquaporin adipose (AQPap), adipose-specific glycerol channel. J Biol Chem 2001;276: 36251—60. [10] Wakayama Y, Inoue M, Kojima H, Jimi T, Shibuya S, Hara H, et al. Expression and localization of aquaporin 7 in normal skeletal myofiber. Cell Tissue Res 2004;316:123—9. [11] Ishibashi K, Kuwahara M, Gu Y, Tanaka Y, Marumo F, Sasaki S. Cloning and functional expression of a new aquaporin (AQP9) abundantly expressed in the peripheral leukocytes permeable to water and urea, but not to glycerol. Biochem Biophys Res Commun 1998;244:268—74. [12] Tsukaguchi H, Shayakul C, Berger UV, Mackenzie B, Devidas S, Guggino WB, et al. Molecular characterization of a broad selectivity neutral solute channel. J Biol Chem 1998;273:24737—43. [13] Maeda N. Implications of aquaglyceroporins 7 and 9 in glycerol metabolism and metabolic syndrome. Mol Aspects Med 2012;33:665—75. [14] Maeda N, Funahashi T, Shimomura I. Metabolic impact of adipose and hepatic glycerol channels aquaporin
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
7 and aquaporin 9. Nat Clin Pract Endocrinol Metab 2008;4:627—34. Maeda N, Hibuse T, Funahashi T. Role of aquaporin-7 and aquaporin-9 in glycerol metabolism; involvement in obesity. Handb Exp Pharmacol 2009:233—49. Rodriguez A, Catalan V, Gomez-Ambrosi J, Fruhbeck G. Role of aquaporin-7 in the pathophysiological control of fat accumulation in mice. FEBS Lett 2006;580:4771—6. Skowronski MT, Lebeck J, Rojek A, Praetorius J, Fuchtbauer EM, Frokiaer J, et al. AQP7 is localized in capillaries of adipose tissue, cardiac and striated muscle: implications in glycerol metabolism. Am J Physiol Renal Physiol 2007;292:F956—65. Kondo H, Shimomura I, Kishida K, Kuriyama H, Makino Y, Nishizawa H, et al. Human aquaporin adipose (AQPap) gene. Genomic structure, promoter analysis and functional mutation. Eur J Biochem/FEBS 2002;269:1814—26. Carbrey JM, Gorelick-Feldman DA, Kozono D, Praetorius J, Nielsen S, Agre P. Aquaglyceroporin AQP9: solute permeation and metabolic control of expression in liver. Proc Natl Acad Sci U S A 2003;100:2945—50. Kuriyama H, Shimomura I, Kishida K, Kondo H, Furuyama N, Nishizawa H, et al. Coordinated regulation of fat-specific and liver-specific glycerol channels, aquaporin adipose and aquaporin 9. Diabetes 2002;51:2915—21. Wakayama Y, Hirako S, Ogawa T, Jimi T, Shioda S. Upregulated expression of AQP 7 in the skeletal muscles of obese ob/ob mice. Acta Histochem Cytochem 2014;47:27—33. Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 1957;226:497—509. Havel PJ, Kasim-Karakas S, Mueller W, Johnson PR, Gingerich RL, Stern JS. Relationship of plasma leptin to plasma insulin and adiposity in normal weight and overweight women: effects of dietary fat content and sustained weight loss. J Clin Endocrinol Metab 1996;81:4406—13. Takahashi N, Patel HR, Qi Y, Dushay J, Ahima RS. Divergent effects of leptin in mice susceptible or resistant to obesity. Hormone Metab Res = Hormon- und Stoffwechselforschung = Hormones et metabolisme 2002;34: 691—7. Van Heek M, Compton DS, France CF, Tedesco RP, Fawzi AB, Graziano MP, et al. Diet-induced obese mice develop peripheral, but not central, resistance to leptin. J Clin Investig 1997;99:385—90. Arai T, Kim H, Chiba H, Matsumoto A. Anti-obesity effect of fish oil and fish oil—fenofibrate combination in female KK mice. J Atheroscler Thromb 2009;16:674—83. Arai T, Kim H, Hirako S, Nakasatomi M, Chiba H, Matsumoto A. Effects of dietary fat energy restriction and fish oil feeding on hepatic metabolic abnormalities and insulin resistance in KK mice with high-fat diet-induced obesity. J Nutr Biochem 2013;24:267—73. Chavin KD, Yang S, Lin HZ, Chatham J, Chacko VP, Hoek JB, et al. Obesity induces expression of uncoupling protein-2 in hepatocytes and promotes liver ATP depletion. J Biol Chem 1999;274:5692—700. Monsalve FA, Pyarasani RD, Delgado-Lopez F, MooreCarrasco R. Peroxisome proliferator-activated receptor targets for the treatment of metabolic diseases. Med Inflamm 2013;2013:549627. Biddinger SB, Miyazaki M, Boucher J, Ntambi JM, Kahn CR. Leptin suppresses stearoyl-CoA desaturase 1 by mechanisms independent of insulin and sterol regulatory elementbinding protein-1c. Diabetes 2006;55:2032—41. Shimomura I, Bashmakov Y, Horton JD. Increased levels of nuclear SREBP-1c associated with fatty livers in
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001
ORCP-535; No. of Pages 9
ARTICLE IN PRESS
Aquaglyceroporin expression in DIO and ob/ob mice two mouse models of diabetes mellitus. J Biol Chem 1999;274:30028—32. [32] Rakhshandehroo M, Knoch B, Muller M, Kersten S. Peroxisome proliferator-activated receptor alpha target genes. PPAR Res 2010. Article ID 612089. [33] Kishida K, Shimomura I, Nishizawa H, Maeda N, Kuriyama H, Kondo H, et al. Enhancement of the aquaporin adipose gene expression by a peroxisome proliferator-activated receptor gamma. J Biol Chem 2001;276:48572—9. [34] Kubota N, Terauchi Y, Miki H, Tamemoto H, Yamauchi T, Komeda K, et al. PPAR gamma mediates high-fat
9 diet-induced adipocyte hypertrophy and insulin resistance. Mol Cell 1999;4:597—609. [35] Hara-Chikuma M, Sohara E, Rai T, Ikawa M, Okabe M, Sasaki S, et al. Progressive adipocyte hypertrophy in aquaporin-7-deficient mice: adipocyte glycerol permeability as a novel regulator of fat accumulation. J Biol Chem 2005;280:15493—6. [36] Hibuse T, Maeda N, Funahashi T, Yamamoto K, Nagasawa A, Mizunoya W, et al. Aquaporin 7 deficiency is associated with development of obesity through activation of adipose glycerol kinase. Proc Natl Acad Sci U S A 2005;102:10993—8.
Available online at www.sciencedirect.com
ScienceDirect
Please cite this article in press as: Hirako S, et al. The relationship between aquaglyceroporin expression and development of fatty liver in diet-induced obesity and ob/ob mice. Obes Res Clin Pract (2015), http://dx.doi.org/10.1016/j.orcp.2015.12.001