The ribonuclease III site flanking 23S sequences in the 30S ribosomal precursor RNA of E. coli

Cell, Vol. 19. 393-401,

February

1980,

Copyright

0 1980

by MIT

The Ribonuclease III Site Flanking 23s Sequences the 30s Ribosomal Precursor RNA of E. coli Richard J. Bram,* Richard A. Young? and Joan A. Steitz Department of Molecular Biophysics and Biochemistry Yale University New Haven, Connecticut 06510

Summary The DNA sequence of the 23S-55 rRNA intergenic region has been determined for two ribosomai RNA operons in E. coli. The spacer in both rfnX and rfnD* is 92 bp long; the sequences are identical except for two heterogeneities. 130 bp at the 3’ end of the 23s rRNA gene have also been sequenced. We observe that a region surrounding the 3’ end of 23s is complementary to sequences surrounding the 5’ end of the gene. This compiementarity predicts a giant stem and loop structure closed by an almost perfectly double-stranded helix of 28 bp that includes both termini of mature 23s rRNA. Moreover, we find that this helix can be extended after a brief interruption to.inciude a substantial number of additional residues from the two spacer regions flanking the 235 gene; interestingly, the extended structure involves sequences that are conserved in the distal portion of the two different types of 16S23s spacer region-those containing tRNA$ and tRNA?, and those with tRNA$‘“. We have also analyzed the ends of the precursor 23s RNA (23%) produced by in vitro RNAase IIt cleavage of the 30s pre-rRNA. The terminal sequences of 23% appear in the 28 bp helical region, several nucleotides beyond the 23s mature ends. Thus we propose that residues separated by the 2900 nucieotides of 23s rRNA come together to form a processing site for RNAase ill in the ribosomal RNA precursor molecule. introduction The ribosomal RNA (rm) operons in E. coii contain single copies of each of the 16S, 23s and 5s rRNA genes (Pace, 1973). Early pulse labeling experiments (Pace, 1973) and ultrastructural studies (Hamkalo and Miller, 1973) suggested that the genes are transcribed as a single unit which is subsequently cleaved and modified to yield the three mature rRNA species. The observation of a large precursor molecule was not made, however, until the isolation of an RNAase Illl Present California t Present Lausanne,

address: Stanford University School of Medicine, 94305. address: Swiss Institute for Experimental Cancer Switzerland.

Stanford, Research,

in

mutant, AB301 /105 (Kindler, Keil and Hofschneider, 1973); RNAase 111had previously been shown to be specific for double-stranded RNA of either natural or synthetic origin (Robertson, Webster and Zinder, 1967, 1968). In the presence of chloramphenicol, RNAase III- mutant cells accumulate large amounts of a 2 megadalton RNA (30s pre-rRNA) which can be cleaved in vitro by purified RNAase Ill to give species slightly larger than the mature rRNAs (Dunn and Studier, 1973b; Nikolaev, Silengo and Schlessinger, 1973; Ginsburg and Steitz, 1975). The 17s sized product (16S,,,) was shown by Tl oligonucleotide analysis (Ginsburg and Steitz, 1975) to be identical to the pl6S precursor observed in chloramphenicol-treated or pulse-labeled wild-type cells (Brownlee and Cartwright, 1971; Lowry and Dahlberg, 1971; Hayes et al., 1971; Sogin et al., 1971). Thus an early step in the normal processing pathway apparently involves highly specific recognition and cleavage of the ribosomal RNA transcript by RNAase 111. RNAase Ill has also been shown to be the factor that “sizes” the phage T7 early mRNA precursor both in vivo and in vitro (Dunn and Studier, 1973a, 1973b; Robertson and Dunn, 1975). Analyses of regions surrounding the five cleavage sites (Oakley and Coleman, 1977; Rosenberg and Kramer, 1977; Robertson, Dickson and Dunn, 1977; J. Dunn, personal communication) reveal little sequence homology, but comparable RNA secondary structures can be predicted. Each region can be folded into a hairpin consisting of two 9-l 1 bp stems separated by an internal loop (bubble) within which cleavage occurs. Young and Steitz (1978) sequenced the DNA preceding and following the 16s gene in two rrn operons and located the 168, termini produced by RNAase III cleavage of the rRNA transcript (Ginsburg and Steitz, 1975). No hairpin loop structures similar to the T7 sites could be predicted for sequences surrounding these ends. Rather, the two regions are complementaQ to each other, suggesting that sequences flanking 16s rRNA come together in the 30s pre-rRNA to form a double helical structure whose hairpin loop includes the entire mature 16s rRNA molecule. The stem region contains a 26 bp perfectly double-stranded segment which includes the sites of RNAase Ill cleavage. In a parallel study, Robertson and Barany (1978) isolated double-stranded regions from 30s pre-rRNA and demonstrated that one of these contained both RNAase Ill cleavage sites flanking the 16s gene. In this paper, we show that sequences flanking the 23s gene are similarly complementary to each other and may base pair to form a giant stem and loop structure in the 30s pre-rRNA. We have also characterized the ends of the 23SIs species generated by RNAase Ill in vitro and have located these sequences within the double helical region.

Cell 394

and Ava II; the data are presented in Figure 1 B. From the pattern of restriction sites predicted by the sequence of 5s rRNA (Brownlee, Sanger and Barrell, 19671, we located the 5s gene approximately 200 bp 3’ to the Ava I site in Figure 1 B. Hence the Ava I/Ava II fragment from rrnD*, as well as the corresponding fragment from the rrnX operon, was sequenced. The two operons have nearly identical sequences in the region analyzed. The sequences of the Ava I/Ava II fragment are presented in Figure 2.

Results PNA Sequence of the 23S-5s rRNA Spacer Region We have sequenced the DNA at the 3’ end of the 23s rRNA gene from two rrn transducing phages. As discussed previously (Young, Macklis and Steitz, 19791, hdilv5 carries rrnX, a hybrid operon which contains the 3’ terminal portion of rrnC and the 5’ portion of rrnF (or G) (Boros, Kiss and Venetianer, 1979); it is known that the crossover occurred somewhere between the 16S-23s spacer and the distal tRNAs, but we do not know which of the two operons is represented at the 3’ end of 23s rRNA. Likewise, although it was previously believed that XdaroE carried the complete rrnD operon, it now appears from the hybridization studies of Boros et al. (1979) and E. Lund (personal communication) that the 3’ region is derived from rrnG (or 0; again, it is unclear exactly where the crossover occurred relative to the 3’ end of the 23s gene. We therefore call the operson on AdaroE rrnD*. To pinpoint the region of interest for sequencing in the two phage DNAs, we isolated the 9% XdaroE Eco RI/Barn HI fragment containing the 3’ portion of rrnD* (see Figure 1 A). This fragment was mapped using the restriction enzymes Ava I, Hae Ill, Hpa II, Hha I, Tha I

RNAase Ill Cleavage Sites In the 306 rRNA Precursor 30s precursor rRNA was isolated from RNAase Illcells and cleaved in vitro with purified RNAase Ill. Then, to allow analysis by rapid RNA sequencing methods, the digestion products were 3’ end-labeled by ligation with 5’-32P-pCp or kinased at the 5’ end using Y-~*P-ATP. Gel patterns of the RNA before and after digestion are shown in Figure 3. To examine the RNAase Ill cleavage site 3’ to 23s sequences, 23Slll rRNA labeled at its 3’ end with 5’32P-pCp was first examined. This RNA was subjected to digestion by RNAase Tl and the oligonucleotides were fractionated on a two-dimensional fingerprint (Figure 4A). Note that although the original 30s preBamHI 3

-_

t

c3.B

1i

60

A

26.4 5

21.1 26.5

1.4 11 f

1.4 t t

i

12.8’

\

II.5

‘? ’ 9.5

94)

9.5

1

23 S Figure

rRNA

I

I

!

1

II e

b

jfl!j 0.6

’ Eco RI

t75

‘XboI

9.8

,

IT.2

; SmoI

1 I?

,,.2

IT.3

13.5

1.0

f

Ram HI

I ‘4.8 I I39

31.7

2.3

z

t

I3 3

21.2

1 20.4

q SmoI t HlndIU

91

31

1

I

f

I.0

t

j&7

‘I’ I”~“1

I?‘.5

15.2

!

23.1

hdilv-

tt

20.1

1

IIB

7 1’:s

’ HlndlII :EcoRI

1.4 l.!l

5 S rRRA

1. Restriction Map of the Transducing Phages AdaroE and AdiM. and Fine Restriction Map of a Portion of the 3’ End of the rfnD’ Operon (A) Restriction map of the transducing phages AdaroE and AdiM. Heavy lines represent A DNA. Open boxes represent the ribosomal RNA (rrn) operons (rrnD* in AdaroE and rrnX in AdiM; see text). The thin lines represent other E. coli DNA. The lengths are in units of % A genome (1% = 465 bp). From Young et al. (1979). (8) Fine restriction map of a portion of the 3’ end of the rrnD’ operon. Cross-hatched areas represent mature gene sequences. Open regions stand for spacer DNA. Numbers in parentheses refer to approximate locations (as deduced by mapping) of restriction cuts in the vicinity of the 3’ end of the 23s gene. rrnX is identical to rrnD* from the Ava I site through the 5-S gene, except for the presence of an additional Hae III site near the 5’ end of the 5S gene.

RNAase-Ill 395

Site in Pre-rRNA

-1,30

-1120

-1,lO

-I,00

-30

-80

-10

-po

-50

-fO

CPyCGPuGATGAGTTCTCCCTGACTCCTCC~GA~GTCCTG~G~CGTTG~GACGACGACGTTGATAG~C~GTGTGT~GC~AG(~)ATGCGTTGAGCT GPuGCPyCTACTCMGAGGGACTGAGG~CTCT~~AC~CCTT~~CTTCTGCT~TGC~CTATCC~CCACACATTCGCGTC(CG)TACGCAACTCGA

-130 -TO -fO to 20 30 40 AACCGGTACTAATGAACCGTGAGGCTTAACCTTACAACGCCG~G~TG~TT~~ATGAG~G~GATTTT~AGCCTGATA~A~TT~T~AG~CGCAG~ TTGGCCATGATTACTTGGCTCCGAATTGGAATGTTGCGCGTCTT

SO

90

100

2. The 23S-5s

rRNA Spacer

Region

50

60

70 =

110

GCGGTCTGiT 6 AAACAGAiTTTGCCTGGhXC~GTAGChCGGTGGTCC CGCCAGACTACTTTGTCTTAAACGGACCGCCGGCATCGCGCCACCAGG Figure

23s

Is

in the rrnX Operon

Sequence of the Ava I/Ava II fragment is presented. Data was derived by reading from the Ava I end on the top strand and from the Ava II end on the bottom strand. 23s rRNA and 5s rRNA sequences are underlined. rrnD* sequences in this region are identical to rrnX except for the nucleotide pair marked l , which is 2, and the nucleotide pairs marked X, which are both :. At positions -46 and -47, the order of the two residues could not be definitely determined by reading either strand. The sequence of the Ava I/Ava II fragment from rrnX and rfnD* is identical to that of rrn8. except at the positions noted by l and # and betieen residues - 102 and - 111, a region of 23s rRNA which may be particularly heterogeneous 979; Br gnlant et al .) 1979). (Brosius, Dull and Noller,

C

Figure 3. Ethidium Stain Pattern of 30s pre-rRNA Isolated from RNAase Ill- Cells (A) and afler Incubation in vitro with Purified RNAase Ill (B) The two major bands migrate slightly more slowly than marker mature 16s and 23s rRNAs. Lanes A and 0 each have 1 pg RNA loaded into a 2% polyacrylamide/OS% agarose composite gel [50 mM NaPO, (pli 6.6) buffer]. Lane C shows an autoradiograph of the 3’ endlabeled products of RNAase Ill cleavage of 30s pre-rRNA fractionated on a 3.5% TBE polyacrylamide gel. Bands 4 and 5 were eluted and sequenced by the chemical modification procedure (see Figures 7A and 78). They correspond in size to the lengths predicted for 16S23s spacer RNAs containing tRNA:” and tRNA$ (Band 4) and tRNAy (Band 5). X marks the position of xylene cyanol ff marker dye.

rl?NA was lightly 32P-labeled, only those oligonucleotides possessing 3’-32P-pCp are of high enough specific activity to be visualized. Approximately 90% of the radioactive label is contained in spot 1, which comigrates with marker oligonucleotides 3 residues in

length in the second dimension [homochromatography on a polyethyleneimine (PEI) thin layer]. The major spot was further treated with pancreatic RNAase, generating a labeled product that migrates with Cp on DEAE paper at pH 3.5 (data not shown). Since the labeled 5’ phosphate from pCp is transferred to C rather than AC upon pancreatic RNAase cleavage, the sequence of the trinucleotide produced by the original Tl digest must be PyCpCp. Finally, on the fingerprint shown in Figure 4A, the major labeled oligonucleotide migrates more slowly in the first dimension (cellulose acetate pH 3.5) than the spot CpCpGp (position indicated by arrow), indicating that the 5’ pyrimidine cannot be uridine. Thus the 3’ terminal sequence of 23SIr rRNA labeled by 32P-pCp must be G-p-C-p-C32p-cp. Because the oligonucleotide GCC occurs twice in the 23S-5s spacer DNA sequence, more extensive sequence information was required to pinpoint the exact site of RNAase Ill cleavage 3’ to 23s. Partial alkaline hydrolysis of 238rI- 32pCp followed by two dimensional fractionation (Figure 5) gave a “wandering spot” pattern compatible with the sequence preceding GCC at position 6 in Figure 2 and not with that preceding GCC at position 42. Furthermore, sequencing by chemical modification of the 3’-labeled 23S,,, species (not shown) best agreed with a major 23SaI 3’ terminal sequence of UUACAACGC&. The 5’ end of 23SIII rRNA was analyzed as follows. RNAase Ill cleavage products were kinased with y32P-ATP and 23&r rRNA was isolated. Digestion with pancreatic RNAase followed by two-dimensional electrophoresis gave the pattern shown in Figure 6A. The major spot (40% of the label) co-electrophoreses with PUG, the 5’ terminus of 16SIII rRNA (Ginsburg and Steitz, 1975). RNAase Pl digestion of this spot

Cell 396

Figure

5. Wandering

Spot Analysis

of 23S.-32pCp

The RNA from Figure 3C was treated with alkali and the products were fractionated as described by Keene et al. (19761, except that the second dimension was homochromatography on PEI (see legend to Figure 4). B and Y indicate the positions of the blue and yellow dyes. The most reasonable interpretations of the mobility shifts are indicated. Note that the direction of the A shift is not standard in this particular run, but that it is appropriate relative to the shifts produced by the other three bases (see also Schubert et al., 1978); likewise, shifts observed on short C-rich oligonucleotides are known to be anomalous.

Figure 4. Two-Dimensional and 168,, (B) after Digestion The first 3.5; the homomix tions of 90% of position

Fingerprints of ‘*pCp-Ligated with RNAase Tl

23&

(A)

dimension was electrophoresis on cellulose acetate at pH second dimension was homochromatography on PEI using Cl 5 (Barrel& 1971). B and Y indicate the respective posithe blue and yellow dyes. The spots labeled I contain about the radioactivity in both cases; the arrow fin A) indicates the of CpCpGp.

yieided pG. Thus we deduce that the most prominent 5’ terminal oligonucleotide of 23811 is pGU. 23sIr rRNA obtained from different RNAase Ill digest8 of 30s rRNA gave varying amounts of a second 5’ end-labeled oligonucleotide; it was identified by, two-dimensional electrophoresis and secondary analyses as pGAU > pAGU. Finally, a Tl RNAase fingerprint (not shown) of the same V-labeled 23Sr, rRNA as analyzed in Figure 6A revealed that the prominent pup spot does not correspond to a specific 5’ sequence but arises from many minor labeled products which must begin with U. To define further the site of cleavage at the 5’ end of 23S,,, rRNA, we analyzed the 3’ ends of 16S-23s

rRNA spacer fragments released by RNAase Ill. Bands 4 and 5 (Figure 3C) were 3’ labeled with 32P-pCp and sequenced using the chemical modification technique (Peattie, 19791, The autoradiographs of the sequencing gels shown in Figures 7A and 78 reveal that the terminal sequences of both these fragments are GAAACAUCUUCGGoH before they diverge. Coupled with the analyses of 5’ end-labeled 23S,,, described above, this result strongly suggests that the major site of RNAase Ill cleavage 5’ to 23s is as shown by the arrow in Figure 8A. Because the work of Lund and Dahlberg (1979) and Lund, Dahlberg and Guthrie (1979) has indicated that RNAase Ill may not cleave the double-helical region flanking 16s rRNA exclusively at the positions designated in Figure 8, we also reinvestigated the 5’ and 3’ termini of 16Slll rRNA using the same methods applied above to 23.% rRNA. Tl RNAase digests of 32P-pCpligated 16Slll produced the expected nonomer CUCACACACp (Ginsburg and Steitz, 1975) as the only 3’ end-labeled oligonucleotide in our preprarations (Figure 4B, spot 1 I. The 5’ end of 16s~ rRNA, however, appeared slightly more heterogeneous in composition. The oligonucleotide reported to be the major 5’ end of 16Slll PUG (Ginsburg and Steitz, 1975) is most prominent in Tl RNAase fingerprints of kinased 16S,,, (Figure 6B). A second minor 5’ end oligonucleotide also appears in Figure 6; but the pGp spot was shown by a pancreatic digest of kinased 168,, to be derived from many sequences present in very minor yield.

RNAase-Ill 397

Site in Pre-rRNA

A G A>G C C+U

8 G bGCC+U

Figure 7. RNA Sequencing Gels of (A) the 16S-23s Spacer Containing tRNA:” and tRNA$! (Band 4 in Figure 3C) and (B) the 16S235 Spacer Containing tRNA?‘” (Band 5 in Figure 3C) Sequencing was done using the procedure of Peattie (1979). Gels were 25% polyacrylamide (in TBE + 7 M urea) to allow reading of the first nucleotide. The ligated pCp does not appear on these gels since its 5’ phosphate is labeled. The sequence in (B) appears to correspond to rrnB (J. Brosius. T. J. Dull and H. F. Noller. personal communication).

Figure 6. Two-Dimensional Fingerprints of 5’ End-Labeled Cleaved with Pancreatic RNAase (A) and 16S,,, RNA Digestion with RNAase Tl (B)

238~ RNA after Total

The first dimension was electrophoresis on cellulose acetate fpH 3.5). and the second dimension was electrophoresis on DEAE paper in 7% formic acid. In (A) (23&). 40% of the label is in pGU. A fingerprint of 23&r cleaved with RNAase Tl shows that the pU is derived from many 5’ end oligonucleotides with different sequences. In (B) (168r), 60% of the label is in PUG. Likewise, a pancreatic RNAase fingerprint indicated that the pG spot is derived from many 5’ terminal sequences.

Discussion We have determined the DNA sequence of the spacer region between the 23s and 5s ribosomal RNA genes

in the operons rrnX and rrnD* . The spacers are both 92 bp long, and are identical in sequence except for two heterogeneities located at positions 13 and 82. Likewise, the 23S-5s spacer region from rrnB is identical except at the two heterogeneous positions (J. Srosius, T. Dull and H. Noller, personal communication). We have also determined the DNA sequence of the last 130 bp of the 23s rRNA gene for these two operons; we find that they are identical. RNA Secondary Structures Surrounding 23s rRNA Comparison of sequences in the 23S-5s spacer with those at the 5’ end of the 23s gene (Young et al., 1979) reveals extensive complementarity between the two. This suggests that in the 30s precursor rRNA, these residues base pair to form the huge stem and loop structure depicted in Figure 8A. The isolation

* 2900 nucleotldes

I I

-----

I

\

/

,'

CGAAIJCAG~~GAGUG~~

165

\

rRNA

\ I

4600

ii AU i

AU GU

GC

ii

UA GC UA

ICG

AU

:: I GU GC

AU G*AGU

"G

it "111'~

1: r AU

:: CG

UA CG AAGUUGUUCGUG

AGUA. 5'

~CAACIULGUCACApAGUGA #

Figure cursor

UA AU AU AU AU GC UA CG

CG

UA GAUA GC UA CG UA iii AA A AVA % VA' CG UAA C ;: UA UG UA GAAGU%GG 7; GO

8. Secondary tRNA

Structures

Predicted

to Form

3' in the 30s

Pre-

Mature sequences are shown in bold type. Most of 23s and 16s rRNAs are depicted schematically. Arrows indicate the major sites of RNAase Ill cleavage. Vertical lines denote regions of homology with T7 sequences that appear at the same location relative to RNAase Ill cleavage sites. Residue numbers are from Figure 2 for the 23S-5s spacer and from Young et al. (1979) for the 16S-23s spacer. (Left) 235 and flanking spacer RNA. The italicized letters at positions 410-417 indicate a region in rrnD* and rrnX (Young et al., 1979) that is both nonconserved and of different lengths in frn8 (J. Brosius, T. J. Dull and H. F. Noller, personal communication) and in rrnE (Morgan et al, 1979). Also, nucleotides 5’ to position 324 are not conserved. (Above) 16s and flanking RNA (Young and Steitz. 1978).

AGcC AU

5'

AU UG UA UA GCAACUGCUCUUUAACAA AAUGAGCAGUAMA

3'

from RNAase Ill- cells of RNAase-resistant structures containing sequences adjacent to the cleavage sites indicated in Figure 8 nicely confirms that residues at the two ends of both 16s and 23s rRNA also base pair in vivo (Robertson and Barany, 1978; Robertson, Pelle and McClain, 1979; H. D. Robertson, personal communication). The helical region including the ends of 23s rRNA differs from that flanking 16s rRNA (Young and Steitz, 1978) in that sequences from within the mature 23s molecule comprise a portion of

RNAa?.e-Ill 399

Site in Pre-rRNA

the predicted stem; this had been noted previously in sequencing studies of mature 23s rRNA by Branlant et al. (1976). While the 16s structure has a perfectly base-paired region 26 nucleotides long (within which RNAase Ill cleaves), the 23s stem has both internal and bulge loops so that the longest uninterrupted stretch of duplex RNA is 15 bp. Our ability to draw extended (if imperfect) RNA secondary structures involving sequences quite far from the two ends of 235 rRNA may explain a previously mysterious conservation of sequence between the various E. coli rrn operons. It was noted by Morgan et al. (1979) that the 16S-23s rRNA spacers of the rrnX and rrnD* operons (both of which contain tRNA:‘e and tRNA?k genes) are homologous with that of rrnE (which contains tRNA$“) for approximately 60 nucleotides in the distal portion of the spacer. The same 80 residues are also found in the spacer for the rrnB operon, which likewise contains tRNAf’” (J. Brosius, T. Dull and H. Noller, personal communication). Interestingly, this is the very region involved in the extended stem structure shown in Figure 8A. This discovery suggests that these particular sequences may have been conserved between rrn operons in order to stabilize an RNA secondary structure feature required for processing of the 30s pre-rRNA by RNAase Ill. Points of RNAase III Cleavage Near 23s We have characterized the ends of the 23Slll rRNA released from the 30s precursor by RNAase Ill cleavage. The major 5’ and 3’ termini (40% of total 5’ label: 90% of total 3’ label) are 7 and 8 nucleotides, respectively, beyond the ends of mature 23s rRNA. Both cleavage sites occur near the guanosine loopout in the uppermost helical region of the structure shown in Figure 8A. The location of the ends of 23SI11 rRNA so close to mature sequences (Branlant et al., 1976) agrees with several previous observations. D. Charny, D. Goldberg and J. A. Steitz (unpublished observations) noted that there were no large Tl oligonucleotides present in 23SIs rRNA which were not also in the mature 23s species. Ghora and Apirion (1978) have isolated a mutant of E. coli which does not appear to cleave rRNA precursors 5’ to 5s sequences. Instead of 5s rRNA, a new 9s RNA species is produced in this strain. Most of the additional Tl oligonucleotides in 9s can be perfectly aligned with our DNA sequence for the 23S-5s spacer region. Discounting a few differences (which may reflect operon or bacterial strain heterogeneity), these oligonucleotides account for the DNA sequence from nucleotide 9 in the 23S5s spacer to the 5s gene. Since 9s RNA is obtained from RNAase Ill+ cells, it is assumed that RNAase Ill has already processed the rRNA precursor; furthermore, the 9s species has a 5’ phosphate, which is characteristic of RNAase Ill cleavage (Crouch, 1974).

Thus the 5’ end of 9s RNA could be the direct product of RNAase Ill processing of the rRNA transcript in vivo. This cleavage site is identical to the major one we observe in vitro. Recognition of Natural Substrates by RNAase Ill Our work extends the catalogue of sequenced natural cleavage sites for RNAase Ill (Oakley and Coleman, 1977; Rosenberg and Kramer, 1977; Robertson et al., 1977; Young and Steitz, 1978; J. Dunn, personal communication). Several features of the RNA seem to be required for recognition by the enzyme. All sites have some double-stranded character; at least 9 bp occur both 5’ and 3’ to each phosphodiester bond cleaved. Double cleavages, which occur only in the 16s and 23s stems of the 30s rRNA precursor and in the junction between genes 1.7 and 1.3 in the 17 mRNA precursor, are all staggered by 2 bp. Threedimensional models indicate that this staggered configuration orients the two phosphodiester bonds to be cleaved quite close to each other on the same side of The double helix. the manner in which RNAase Ill chooses its exact cleavage site(s) in any RNA stem remains unclear. It seems improbable that the mere length of the helical region could align the enzyme, since the structures surrounding 16s and 23s rRNAs are different both from each other and from the T7 sites in this respect. There are, however, limited sequence homologies between the cleavage sites in the 30s pre-rRNA and the T7 early mRNA precursor. The short sequences indicated in the p16S and p23S stems of Figure 8 frequently appear near the T7 recognition sites-at exactly the same distance from the points of chain scission. Thus the presence of such residues may facilitate RNAase Ill selection of the exact phosphodiester bond to be hydrolyzed within a double-helical region. Minor Cleavages by RNAase Ill Our experiments indicate that the major in vitro RNAase Ill cleavages near the two large ribosomal RNAs occur at the locations shown in Figure 8. Yet there are other specific ends observed in lower quantities on 23S,,1 and 1 6Sr produced by our treatment of the 30s precursor RNA. It is conceivable that contaminants in either the nuclease preparation or the RNA substrate are responsible for the additional termini. It seems more probable, however, that we are observing additional cleavages by RNAase Ill. as reported previously by other investigators studying processed regions of the 30s pre-rRNA. In the case of the 16s stem, Lund et al. (1979) and Lund and Dahlberg (1979) have identified several additional cut sites by examining termini of small cleavage products released from 30s pre-rRNA by RNAase Ill in vitro. They find that the 16s stem is often cleaved 8 residues 5’ to the 5’ cleavage site

CSII 400

indicated in Figure 86, and 4 nucleotides 3’ to the 3’ 16s cleavage. Since we find little evidence of these particular termini in our 1 6Slll preparations, it is probable either that the RNAase Ill used differs somewhat in specificity or that cleavage at the major sites can be followed by subsequent cuts lower in the 16s stem. Robertson et al. (1979) likewise observe in vitro cleavage of the isolated 16s stem region primarily at the sites indicated in Figure 86. In the case of 23SIa, our analysis does reveal termini other than those from the major cleavage sites indicated in Figure 8A. For the 3’ end, we have tentatively identified spot 2 in Figure 4A (10% of the label) by pancreatic and U2 RNAase secondary digests to be N.,-sPyC-pCp. One compatible sequence is found in the very lowest part of the 23s stem in Figure 8A; another resides within the mature 23s rRNA sequence two nucleotides 5’ to the mature 3’ end. If the latter is the minor 3’ cleavage site, then our results would be consistent with those of H. D. Robertson (personal communication), who finds that in vttro RNAase Ill treatment of the isolated 23s double-stranded stem region causes an alteration in the mobility of the 15 mer Tl oligonucleotide CUUAACCUUACAACGp. Similarly, the 5’ end of 23& appears heterogeneous (Figure 6A); but without additional data, it is not possible to assign the position of the cleavage sites. The most interesting aspect of the additional sites of RNAase Ill cleavage is that they seem to be more frequent at the 5’ end than the 3’ end of both 16S,,, and 23& rRNAs. Perhaps this observation is related to the fact that in all but one T7 early mRNA recognition region, RNAase Ill cleavage is confined to the 3’ half of the truncated hairpin loop struCture. Implications of Stem and Loop Formation for rRNA Processing Our finding that complementary sequences flank both the 16s and 23s genes in the rRNA operons of E. coli confirms the prediction of Wu and Davidson (1975), who suggested this explanation for the giant hairpin loop structures they observed in single-stranded rDNA in the electron microscope. Robertson and co-workers (Robertson and Barany, 1979; Robertson et al., 1979) have presented overwhelming evidence that such secondary structures form in rRNA precursors in vivo by isolating the two stem regions from RNAase Ill- cells. Why RNA duplexes have evolved as recognition sites for rRNA processing is not clear; however, since tRNA and 5s rRNA precursors likewise form base pairs between sequences at their mature 5’ and 3’ termini, this appears to be a common theme. Extensive RNA secondary structures might provide pro.tection for the precursor RNAs against nonspecific nuclease attack, or the device may be an important way of avoiding the formation of topological knots in immature RNA species (C. Cantor, personal commu-

nication). For all the stable RNAs mentioned above, the recognition of terminal RNA secondary (or tertiary) structures by the processing machinery requires that the entire gene be transcribed before normal maturation can begin. In this light, it will prove very interesting to discover whether rRNA precursors in either the eucaryotic cell nucleus or cytoplasmic organelles likewise fold into giant stem and loop structures during ribosomal RNA biogenesis. Experimental

Procedures

Strains and Enzymes Two E. coli strains, JF962 and NF955. lysogenic for the Arm transducing phages (AdaroE and XdilvS), were obtained from J. Friesen (York University). E. coli A8301 /105 (RNAase Ill-) was obtained from Yale University E. coli Genetic Stock Center. The restriction endonucleases Ava I, Ava II. Hae Ill and Eco RI were obtained from New England Biolabs. Hpa II was a gift from M. Rosa. Tha I and Hha I were obtained from Bethesda Research. Bam HI was donated by N. Grindley. T4 polynucleotide kinase and T4 RNA ligase were from P-L Biochemicals Inc. Ribonucleases Ti and U2 from Sankyo were used. RNAase Pl was from Yamasa Shoyu (Tokyo). Pancreatic RNAase was from Worthington Biochemicals. Bacterial alkaline phosphatase was prepared and donated by J. Chlebowski (University of Virginia). Several gifts of RNAase Ill were from J. Dunn (Brookhaven National Laboratory). DNA mapping and sequencing were performed as described by Young et al. (1979). Preparation and Analysis of rRNA Precursors 30s pre-rRNA was isolated from E. coli AB301 /IO5 according to the method of Ginsburg and Steitz (19751, except that the cells were grown in 1% bacto-peptone (Oifco), 0.5% NaCI. 0.1% glucose, 0.1 M Tris (pH 7.5), and allowed to accumulate precursor RNA for 2 hr in the presence of chloramphenicol and lo-20 $t/ml 32P04. We usually obtained 250-500 Fg 30s RNA per liter of culture with a specific activity of 20,000-l 00,000 cpm/pg RNA. 30s rRNA was cleaved by RNAaaa Ill as follows: 50 pg RNA were incubated with 20 ~1 RNAase Ill [- 600 U/ml (Dunn. 197611 in 1 ml of 20 mM Tris (pH 7.9). 10 mM MgCte. 0.1 mM EOTA. 0.2 mM OTT, 200 mM NH&I for 20 min at 37°C. 2.5 vol of ethanol were added and the RNA was precipitated at -7O’C. Products from RNAase Ill digests were end-labeled by ligation with 5’-3’P-pCp tAmersham) by the procedure of Englund and Uhlenbeck (1978). RNAs were 5’ end-labeled with Y-~‘P-ATP following the procedure of Oonis-Keller, Maxam and Gilbert (1977). except that the reaction mixture was 50 mM Tris (pH 8.5). 1 mM MgCb. 5 mM OTT. Following labeling, the RNAs were fractionated on 3.5% acrylamide cl:20 bisacrylamide:acrylamide) TBE 150 mM Tris borate, 1 mM EOTA, (pH 8.311 gels or 2% acrylamide. 0.5% agarose, 50 mM phosphate (pH 6.6) gels. RNAs were eluted from the gels and sequenced by one or more of the following methods: classical RNA sequencing techniques(Barrell, 1971); rapid RNA sequencing (Oonis-Keller et al., 1977); wandering spot analysis (Keene et al., 1978); and chemical modification (Peattie. 1979). Acknowledgments We are deeply indebted to John Dunn for his time and numerous donations of RNAase Ill. We also thank Margaret Rosa and Randy Reed for many helpful discussions. J. Brosius, H. Noller. J. Dunn and H. 0. Robertson provided many useful comments on the manuscript. Thls work was supported by two grants from the NIH. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby

RNAase-Ill 401

Site in Pre-rRNA

marked “advertisement” in accordance solely to indicate this fact. Received

October

with 18 U.S.C. Section

1734

11, 1979

Lund. E. and Dahlberg, RNA synthesis in vivo.

Barrell. B. G. (1971). Fractionation and sequence analysis of radioactive nucleotides. In Procedures in Nucleic Acid Research, 2. G. L. Cantoni and D. R. Davies, eds. (New York: Harper and Row), pp. 751-779. Boros. I., Kiss, seven ribosomal 1830.

A. and Venetianer. P. (1979). RNA genes of E. co/i. Nucl.

Physical map of the Acids Res. 6. 1817-

Branlant, C., Sri Widada. J., Krol, A. and Ebel, J.-P. (1976). Extensions of the known sequences at the 3’ and 5’ ends of 235 ribosomal RNA from Escherichia co/i. possible base pairing between these 235 RNA regions and 16s ribosomal RNA. Nucl. Acids Res. 3. 18711687. Branlant, C., Krol, A.. Machatt, M. A. and Ebel, J.-P. (1979). Structural study of ribosomal 23s RNA from Escherichia co/i. FEBS Letters 107. 177-188. Brosius, J., Dull, T. J. and Noller. H. F. (I 979). Complete sequence of a 23s ribosomal RNA gene from Escherichia Nat. Acad. Sci. USA, in press. Brownlee, G. and Cartwright. E. (1971). cursor 16s ribosomal RNA of Escherichia 50-52.

nucleotide co/i. Proc.

Sequence studies on preco/i. Nature New Biol. 232,

Donis-Keller, H., Maxam, A. M. and Gilbert, W. (1977). Mapping adenines, guanines. and pyrimidines in RNA. Nucl. Acids Res. 4. 2527-2538. of single-stranded

RNA.

J.

Dunn, J. J. and Studier, F. W. (1973b). T7 early RNAs and Escherichia co/i ribosomal RNAs are cut from large precursor RNAs in vivo by ribonuclease Ill. Proc. Nat. Acad. Sci. USA 70. 3298-3300.

Ghora, 8. K. and Apirion, D. (I 978). Structural processing to p5 rRNA of a QS RNA molecule mutant of E. coli. Cell 15. 1055-1066. Ginsburg, RNA from

D. and Steitz. J. A. (1975). E. coli. J. Biol. Chem. 250.

analysis isolated

The 30s ribosomal 5647-5654.

Hamkalo. B. and Miller, 0. (1973). Electronmicroscopy activity. Ann. Rev. Biochem. 42, 379-396.

labelling

Morgan, E. A.. Ikemura, T.. Post, L. E. and Nomura, M. (1979). tRNA genes in ribosomal RNA operons of Escherichia co/i. In tRNA, J. Abelson, P. Schimmel and D. SBII. eds. (New York: Cold Spring Harbor Laboratory), in press. Nikolaev, N.. Silengo, L. and Schlessinger, D. (1973). Synthesis large precursor to ribosomal RNA in a mutant of Escherichia Proc. Nat. Acad. Sci. USA 70, 3361-3365. Oakley, J. and Coleman, J. (1977). Structure of a promoter RNA polymerase. Proc. Nat. Acad. Sci. USA 74, 4268-4270.

Peattie, D. A. (1979). Direct chemical Proc. Nat. Acad. Sci. USA 76. 1780-l

method 764.

of a co/i.

for T7

ribonucleic

for sequencing

RNA.

Robertson, H. D. and Dunn, J. J. (I 975). Ribonucleic acid processing activity of Escherichia coli ribonuclease Ill. J. Biol. Chem. 250. 30503056.

Robertson, for double

H.. Webster, R. and Zinder, N. (1967). stranded RNA. Virology 12, 718-719.

Robertson, properties

H., Webster, of ribonuclease

A nuclease

specific

R. and Zinder. N. (1988). Purification and Ill from E. colt J. Biol. Chem. 243,82-91.

Robertson, H., Dickson, E. and Dunn. J. (1977). A nucleotide quence from a ribonuclease Ill processing site in bacteriophage RNA. Proc. Nat. Acad. Sci. USA 74, 822-826.

seT7

Robertson, H.. Pelle, E. G. and McClain. W. H. (1979). RNA processing in an Escherichia co/i strain deficient in both RNase P and RNase Ill. In tRNA. J. Abelson, P. Schimmel and D. $611. eds. (New York: Cold Spring Harbor Laboratory). in press.

Dunn, J. J. and Studier, F. W. (1973a). T7 early RNAs are generated by site specific cleavages. Proc. Nat. Acad. Sci. USA 70, 15591563.

Englund. T. E. and Uhlenbeck, 0. C. (1978). 3’-terminal RNA with T4 RNA ligase. Nature 275, 560-561.

Lund. E.. Dahlberg, J. E. and Guthrie, C. (1979). Processing of spacer tRNAs from ribosomal RNA transcripts of E. colt In tRNA, J. Abelson, P. Schimmel and D. Sdll. eds. (New York: Cold Spring Harbor Laboratory). in press.

Robertson, H. D. and Barany. F. (1978). Enzymes and mechanisms in RNA processing. In Proceedings of the 12th FEBS Congress (Oxford: Pergamon Press). pp. 285-295.

Crouch, R. (1974). Ribonuclease Ill does not degrade deoxyribonucleic-ribonucleic acid hybrids. J. Btol. Chem. 249, 1314-1316.

Ill cleavage

between New Biol.

J. E. (1979). Initiation of E. coli ribosomal Proc. Nat. Acad. Sci. USA 76, 5480-5484.

Pace, N. (1973). Structure and synthesis of the ribosomal acid of prokaryotes. Bacterial. Rev. 37, 562-603.

Brownlee. G.. Sanger, F. and Barrell, B. (1967). Nucleotide sequence of SS-ribosomal RNA from Escherichia co/i. Nature 125, 735-738.

Dunn, J. J. (1976). RNase Biol. Chem. 257. 3807-3814.

Lowry, C. and Dahlberg, J. (1971). Structural differences the 16s ribosomal RNA of E. coli and its precursor. Nature 232, 52-54.

of

and in vitro from an me precursor of genetic

Hayes, F.. Hayes, 0.. Fellner, P. and Ehresmann, C. (1971). Additional nucleotide sequences in precursor 16s ribosomal RNA from E. coli. Nature New Biol. 232, 54-55. Keene. J. D., Schubert, M.. Lazzarini, R. A. and Rosenberg, M. (1978). Nucleotide sequence homology at the 3’ termini of RNA from vesicular stomatitis virus and its defective interfering particle. Proc. Nat. Acad. Sci. USA 75.3225-3229. Kindler. P.. Keil. T. and Hofschneider. P. (1973). Isolation and characterization of a ribonuclease Ill deficient mutant of E. coli. Mol. Gen. Genet. 126, 53-69.

Rosenberg, M. and Kramer, R. (1977). Nucleotide sequence surrounding a ribonuclease Ill processing site in bacteriophage TT RNA. Proc. Nat. Acad. Sci. USA 74, 984-988. Schubert, M., Keene, J. D., Lazzarini, R. A. and Emerson, S. U. (1978). The complete sequence of a unique RNA species synthesized by a DI particle of VSV. Cell 15, 103-l 12. Sogin, M., Pace, tural relationship 232,48-49.

B.. Pace, N. and Woese. C. (1971). Primary strucof ~16 to ml6 ribosomal RNA. Nature New Biol.

Wu. M. and Davisdon. N. (I 975). Use of gene 32 protein staining of single-strand polynucleotides for gene mapping by electron microscopy: application to the +80dailvsu+7 system. Proc. Nat. Acad. Sci. USA 72,4508-4510. Young, R. and Steitz. J. (1978). Complementary sequences 1700 nucleotides apart form a ribonuclease Ill cleavage site in Escherichia co/i ribosomal precursor RNA. Proc. Nat. Acad. Sci. USA 75, 35933597. Young, R., Macklis, R. and Steitz, J. (1979). Sequence of the 16S23s spacer region in two ribosomal RNA operons of E. coli. J. Biol. Chem. 254, 3264-3271.