The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase

BBAPAP-39506; No. of pages: 9; 4C: 4, 5, 6 Biochimica et Biophysica Acta xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbapap

The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase☆ Natalya V. Anufrieva a, Nicolai G. Faleev b, Elena A. Morozova a, Natalia P. Bazhulina a, Svetlana V. Revtovich a, Vladimir P. Timofeev a, Yaroslav V. Tkachev a, Alexei D. Nikulin c, Tatyana V. Demidkina a,⁎ a b c

Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, ul. Vavilova 32, Moscow 119991, Russia A.N. Nesmeyanov Institute of Organoelement Compounds, Russian Academy of Sciences, ul. Vavilova 28, Moscow 117813, Russia Institute of Protein Research, Russian Academy of Sciences, ul. Institutskaya 4, Pushchino, Moscow Region 142290, Russia

a r t i c l e

i n f o

Article history: Received 6 November 2014 Received in revised form 29 December 2014 Accepted 30 December 2014 Available online xxxx Keywords: Methionine γ-lyase Pyridoxal 5′-phosphate Mutant form Cofactor-binding residue Three-dimensional structure Guiding role

a b s t r a c t In the spatial structure of methionine γ-lyase (MGL, EC 4.4.1.11) from Citrobacter freundii, Tyr58 is located at H-bonding distance to the oxygen atom of the phosphate “handle” of pyridoxal 5′-phosphate (PLP). It was replaced for phenylalanine by site-directed mutagenesis. The X-ray structure of the mutant enzyme was determined at 1.96 Å resolution. Comparison of spatial structures and absorption spectra of wild-type and mutant holoenzymes demonstrated that the replacement did not result in essential changes of the conformation of the active site Tyr58Phe MGL. The Kd value of PLP for Tyr58Phe MGL proved to be comparable to the Kd value for the wild-type enzyme. The replacement led to a decrease of catalytic efficiencies in both γ- and β-elimination reactions of about two orders of magnitude as compared to those for the wild-type enzyme. The rates of exchange of C-α- and C-β- protons of inhibitors in D2O catalyzed by the mutant form are comparable with those for the wild-type enzyme. Spectral data on the complexes of the mutant form with the substrates and inhibitors showed that the replacement led to a change of rate the limiting step of the physiological reaction. The results allowed us to conclude that Tyr58 is involved in an optimal positioning of the active site Lys210 at some stages of γ- and β-elimination reactions. This article is part of a Special Issue entitled: Cofactor-dependent proteins: evolution, chemical diversity and bio-applications. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Citrobacter freundii methionine γ-lyase (EC 4.4.1.11, MGL) is a homotetrameric pyridoxal 5′-phosphate (PLP)-dependent enzyme catalyzing the γ- elimination and γ- replacement reactions of L-methionine and its analogs as well as β-elimination and β-replacement reactions of L-cysteine and S-substituted L-cysteines (Scheme 1) [1]. The enzyme has been found in many microorganisms. Some of them are pathogenes, including bacteria causing botulism, colitis, and tooth decay [2]. The enzyme is absent in mammalian cells. Thus, MGL is considered to be an attractive target in pathogenes for rational drug design. MGL is of special interest as an anticancer agent since the growth

Abbreviations: MGL, methionine γ-lyase; PLP, pyridoxal 5′-phosphate; Tyr58Phe, mutant enzyme with Tyr58 replaced by Phe; LDH, lactate dehydrogenase; HOHxoDH, D -2-hydroxyisocaproate dehydrogenase ☆ This article is part of a Special Issue entitled: Cofactor-dependent proteins: evolution, chemical diversity and bio-applications. ⁎ Corresponding author. Tel.: +7 499 135 98 58; fax: +7 499 135 14 05. E-mail address: [email protected] (T.V. Demidkina).

of malignant cells of various origins (unlike the growth of normal cells) is accompanied by obligatory L-methionine utilization [3,4]. The structure of C. freundii MGL holoenzyme has previously been determined at 1.9 Å resolution [5] and later by modification of the crystallization procedure it has been improved to 1.35 Å resolution [6]. MGL belongs to the aspartate aminotransferase (AspAT) family of PLP-dependent enzymes with a type I fold [7,8] and has features characteristic for enzymes of the cystathionine β-lyase subclass [9]. Tetrameric enzyme is composed of two so-called catalytic dimers in which two active sites are formed by the residues from both subunits. The main “anchor” of the cofactor is its phosphate group. The tyrosine residue interacting with the phosphate handle of PLP is conserved in the AspAT family. In C. freundii, MGL Tyr58 residue from one subunit is involved in H-bonding of the cofactor in other subunit [6]. To investigate the role of Tyr58 in the catalytic mechanism of MGL from C. freundii, we replaced it with Phe, studied kinetic and spectral properties of the mutant enzyme, and determined its spatial structure. The results allowed us to conclude that Tyr58 residue is involved in a proper positioning of side chain of active site Lys210 at some stages of the β- and γ-elimination reactions.

http://dx.doi.org/10.1016/j.bbapap.2014.12.027 1570-9639/© 2015 Elsevier B.V. All rights reserved.

Please cite this article as: N.V. Anufrieva, et al., The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbapap.2014.12.027

2

N.V. Anufrieva et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx

Η2 Ο RX CH2 CH2 CH

RXH

CH3 CH2 C

COOH

NH3

O γ−elimination

COOH NH2 R'X'H

RXH

R'X'

CH2 CH2 CH

COOH NH2

γ−replacement

Η2Ο RX CH2 CH

RXH

CH3 C

COOH

NH3

O β−elimination

COOH NH2 R'X'H

RXH

R'X'

CH2 CH

COOH NH2

β−replacement Scheme 1. Reactions catalyzed by MGL (X = S, O or Se; X' = S or Se).

2. Materials and methods

was recloned from mglBlue to the plasmid pET28. Replacement was confirmed by two-directional sequencing.

2.1. Reagents and materials L-Methionine, L-norvaline, L-norleucine, L-α-aminobutyric acid, glycine, L-alanine, DL-homoserine, L-methionine sulfone, L-phenylalanine, DL-penicillamine, phenylmethylsulfonyl fluoride, lactate dehydrogenase (LDH) from rabbit muscle, dithiothreitol (DTT), nicotinamide adenine dinucleotide reduced form (NADH), and D2O were from Sigma (USA); pyridoxal 5′-phosphate (PLP) from Merck (Germany); S-ethyl-L-cysteine, S-methyl-L-cysteine, S-benzyl-L-cysteine, ethylenediaminetetraacetic acid (EDTA), and protamine sulfate from Serva (USA); lactose from Panreac (Spain); glucose, glycerol, magnesium sulfate, ammonium sulfate, potassium phosphate monobasic, sodium phosphate bibasic, acetic acid, acetic anhydride, triethanolamine, and HClO4 from Reakhim (Russia); yeast extract and tryptone from Difco (USA); DEAE-cellulose from Whatman (England); and Superdex 200 from Amersham Biosciences (Sweden). O-acetyl-L-homoserine was prepared by acetylation of L-homoserine as described by Nagai and Flavin [10]. The 6-Histagged D-2-hydroxyisocaproate dehydrogenase (HOHxoDH) (kind gift of K. Muratore) was expressed and purified as described previously [11].

2.2. Site-directed mutagenesis MglBlue plasmid was obtained by cloning the mgl gene into Bluescript II vector SK(±). Site-directed mutagenesis at Tyr58 was created by overlap extension with two DNA fragments obtained by PCR using mglBlu as template and primers F1/R1 and F2/R2, where primer sequences were as follows:

(F1) (F2) (R1) (R2)

GATATCCATGGCTGACTGTCGTAC AGTCCGGATACATTTTCACCCG CGGGTGAAAATGTATCCGGACT TTCGGCATGCTGTGCGACAAAAACGCGTG.

Overlap extension amplification was completed with primer pair F1/R2. The product was incubated with NcoI and SphI and ligated via these sites into mglBlue. The fragment containing the Tyr58/Phe replacement

2.3. Growth of cells and purification of the enzymes Escherichia coli BL21(DE3) cells containing the plasmids with the genes of the wild-type MGL and mutant Tyr58Phe MGL were grown and the enzymes were purified as described previously [12]. Concentration of the purified enzymes was determined from the absorbance at 278 nm, using the absorption coefficient A1%1cm = 0.8 [13]. Assay of wild-type MGL during the purification was performed using 2.5 mM S-ethyl-L-cysteine as described previously [13]. Assay of the mutant enzyme during the purification was performed by the same procedure with 80 mM S-ethyl-L-cysteine. One unit of activity was determined as an amount of an enzyme catalyzing a transformation of 1 μmol of a substrate per one min. The preparations of wild-type and mutant enzymes were about 95% homogeneous as determined by SDS–PAGE electrophoresis [14] with specific activity 10 and 3.91 U/mg, respectively.

2.4. Preparation of holoenzymes and apoenzymes Holoenzymes of wild-type MGL and Tyr58Phe MGL were obtained by adding a fifty-fold molar excess of PLP to an enzyme solution in 50 mM potassium phosphate buffer, pH 8.0, containing, 0.5 mM DTT, 1 mM EDTA. After incubation for 1 h at 25 °C, the excess of PLP was removed by dialysis against the same buffer. To obtain apoenzymes, a hundred-fold molar excess of DL-penicillamine was added to an enzyme solution in 100 mM potassium phosphate buffer, pH 8.0, containing, 1 mM DTT [15]. The mixture was incubated for 1 h at 25 °C, DL-penicillamine was removed by dialysis against the buffer mentioned above. The treatment by DL-penicillamine was repeated until the specific activity of the apoenzymes was less than 1% of that observed with an excess of added PLP. The PLP content in the enzyme preparations was determined in 0.1 M NaOH taking 6600 M−1·cm−1 as the molar absorption coefficient of PLP at 390 nm [16].

Please cite this article as: N.V. Anufrieva, et al., The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbapap.2014.12.027

N.V. Anufrieva et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx

2.5. Determination of the dissociation constant of PLP Kd values of the coenzyme for wild-type MGL and the mutant enzyme were measured by an ultrafiltration method [17]. Aliquots of PLP solution were added to solutions of the apoenzymes (8 × 10−6 M) in 100 mM potassium phosphate buffer, pH 8.0, containing 1 mM DTT. The concentration of PLP was varied from 5 × 10−6 M to 1.2 × 10−4 M. After 30 min incubation at 30 °C, free PLP was removed by ultrafiltration with a Centricon-30 microconcentrator (Amicon) by centrifugation at 5000×g at 4 °C for 5 min. The content of PLP in each fraction was determined in 0.1 M NaOH. The data were fitted to the Scatchard plot [18]. 2.6. Kinetic studies Kinetic parameters of the β- and γ-elimination reactions for wild-type and mutant enzymes were determined at 30 °C in the coupled assay with LDH or with HOHxoDH, respectively, by measuring a decrease in the optical density of NADH at 340 nm (ε = 6220 M − 1·cm− 1 ) [19]. The reaction mixtures contained 100 mM potassium phosphate buffer, pH 8.0, 0.2 mM PLP, 1 mM DTT, 0.2 mM NADH, 10 U of LDH or 70 U of HOHxoDH, and variable concentrations of the substrates in total volume of 1 ml. The reaction was started by addition of 1 μg wild-type MGL or 10 μg Tyr58Phe MGL. Steady-state kinetic parameters of the β- and γ-elimination reactions and inhibition of the γ-elimination reaction of L-methionine by amino acids were determined by fitting the data to the Michaelis– Menten equation using the EnzFitter program [20]. The molecular weight of the enzyme subunit was taken as 43 kDa [21]. 2.7. 1H NMR isotope exchange experiments The kinetics of the isotope exchange of C-α- and C-β-protons of inhibitors for deuterium catalyzed by the mutant enzyme was studied by 1H NMR spectroscopy. The reaction mixture contained 50 mM potassium phosphate buffer in D2O, pD 7.6, 0.1 mM PLP, and inhibitor in total volume of 0.5 ml. Concentrations of glycine, L-alanine, and L-norleucine were 62.5 mM, 291.7 mM, and 104.6 mM, respectively. The reactions were initiated by addition of 0.3–3 mg of the enzyme at 30 °C. 1H NMR spectra were recorded using a Bruker AMXIII-400 spectrometer with operating frequency 400 MHz. A series of spectra were recorded at certain time intervals. Signals of C-α- and C-β-protons were integrated using

3

the modified “enzkin” automation program, which is a part of the XWIN-NMR programs. Kinetic curves of accumulation of deuturated products were calculated using the method described by Faleev et al. [22]. Stereospecificity of the isotopic exchange of the enantiotopic protons of glycine in D2O under the action of the mutant enzyme was determined in the reaction mixture containing 60 mg of ordinary glycine in 0.05 M potassium phosphate buffer in D2O, pD 7.6, 0.1 mM PLP, and 1.7 mg of the mutant enzyme. After the incubation for 72 h at 30 °C, the enzyme was inactivated by heating (90 °C, 5 min) and separated by centrifugation. The solvent was evaporated under vacuum. To assign the absolute configurations of the deuterated product, it was transformed into a dipeptide, L-phenylalanyl-[D]-glycine by the reaction with Boc-L-Phe-ONp [23]. The dipeptide was dissolved in 0.5 ml of D2O, and the 1H NMR spectrum was recorded using a Bruker AMXIII-400 spectrometer with operating frequency 400 MHz. 2.8. Spectral studies Absorption spectra of the holoenzymes and their complexes with substrates and inhibitors were recorded at 25 °C in 50 mM potassium phosphate buffer, pH 8.0 with 0.5 mM DTT, and 1 mM EDTA at a protein concentration of 2.3 × 10−2 mM (1 mg·ml−1) with Cary-50 spectrophotometer (Varian, USA). 2.9. Crystallization of Tyr58Phe MGL and data collection Crystals of Tyr58Phe MGL were obtained using the same conditions as described in [6] using PEG MME 2000 as the precipitant. Rhombicshaped crystals appeared after a week and attained dimensions about 0.3 mm within 2 weeks. Diffraction data were collected at the BESSYII beamline MX BL14.2 (Berlin, Germany) using a MAR CCD MX-225 detector and processed by the XDS program [24]. The detailed data collecting statistics are shown in Table 1. 2.10. Structure determination and refinement The structure was solved by molecular replacement using the structure of C. freundii MGL (PDB code 1Y4I) by rigid body procedure, implemented in CCP4 software suite [25]. The model was improved using manual rebuilding with a COOT [26] and maximum likelihood refinement using REFMAC5 [27]. Flexible

Table 1 Data collection and refinement statistics. Values in parentheses are for the highest resolution shell.

Fig. 1. Absorption spectrum of the Tyr58Phe MGL in 50 mM potassium phosphate buffer, pH 8.0 with 0.5 mM DTT, 1 mM EDTA at a protein concentration 2.3 × 10−2 mM (1 mg·ml−1). The inset shows two tautomers of internal aldimine.

Space group

I222

Unit cell parameters (Å) Wavelength (Å) Resolution (Å) Completeness (%) Redundancy Rmerge (%) Disordered protein residues No. of non-H protein atoms No. of water atoms No. of unique reflections R/Rfree Mean temperature factor B (Å2) RMS deviation from ideal values Bond lengths (Å) Bond angles (°) Chirality angles (°) Planar angles (°) Ramachandran plot Favoured region (%) Allowed region (%) Outlier region (%)

a = 57.55, b = 124.53, c = 129.87 0.8943 28.79–1.96 (2.07–1.96) 97.3 (84.6) 6.2 (4.1) 7.0 (32.8) 1398 3268 203 32873 0.174/0.216 (0.252/0.335) 35.54 0.021 1.961 0.123 0.010 97.2 2.3 0.5

Please cite this article as: N.V. Anufrieva, et al., The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbapap.2014.12.027

4

N.V. Anufrieva et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx

Table 2 Absorption spectrum band parameters of internal aldimine of Tyr58Phe MGL. Structure

E (eV)

ν × 10−3 (cm−1)

λ (nm)

ε × 10−3 (M−1·cm−1)

W × 10−3 (cm−1)

ρ

f

n (%)

II1 II∠ I II II2⁎ ⁎

2.92 3.24 3.63 3.80 4.28 4.49

23.58 ± 0.02 26.15 ± 0.01 29.28 ± 0.01 30.61 ± 0.01 34.55 ± 0.01 36.19

424.1 ± 0.3 382.4 ± 0.2 341.5 ± 0.1 326.9 ± 0.1 289.4 ± 0.1 276.3

10.56 ± 0.03 9.04 ± 1.93 9.53 ± 0.58 8.62 ± 1.67 6.54 ± 1.15 13.52 ± 5.76

3.53 4.00 3.65 3.47 5.06 4.60

1.58 1.37 1.23 1.29 1.20 1.40 ± 0.05

0.21 ± 0.01 0.02 ± 0.01 0.04 0.05 ± 0.01 0.18 ± 0.03 0.55 ± 0.29

61.7 ± 1.2 7.4 ± 1.8 13.0 ± 1.1 17.9 ± 3.2

Designations: E, electron transition energy; ν, wave number; λ, wavelength; ε, molar absorption coefficient; W, half-width; ρ, asymmetry; f, oscillation strength; n, the tautomer and conformer contents. Above-line indices (1, 2) correspond to the first and second electron transitions of structure II. Above-line indices (⊥,∠) correspond to two conformers of structure II (the conformer with the aldimine group in the plane perpendicular to the pyridine cycle plane and the conformer with the aldimine bond released from the coenzyme ring plane but with retained coupling and hydrogen bond between the aldimine nitrogen atom and the coenzyme 3′-hydroxygroup). ⁎ Experimental information about these bands is insufficient.

loops of the protein and water molecules were removed from the initial model to exclude model bias during the first round of refinement. The final model, refined to 1.96 Å, incorporated 3268 nonhydrogen atoms. An excess of electron density at the S-atom of Cys4 forced us to change this residue to 3-sulfenoalanine. Also, the model included the external aldimine, two PEG molecules, and 203 water molecules converged to Rwork of 17.4% and Rfree of 21.6% for the data between 28.79 Å and 1.96 Å (Table 1). The structure has been submitted to the Protein Data Bank with PDB entry 4P7Y.

3. Results and discussion 3.1. Purification of the mutant enzyme The method of purification developed for wild-type enzyme [12] yields homogeneous mutant enzyme. There was about 28% of mutant enzyme to total protein in a cell extract. The specific activities of the mutant enzyme in β- and γ-elimination reactions were 3.91 and 3.25 U/mg, respectively. The specific activities of the wild-type enzyme in β- and γ-elimination reactions were 8 U/mg and 11 U/mg, as it was obtained earlier [12,13].

3.2. Dissociation constants of PLP for the wild-type MGL and mutant enzyme and spectral parameters of the internal aldimine of Tyr58Phe MGL The Kd values of the wild-type and Tyr58Phe MGL proved to be rather similar, 6.24 × 10 − 7 M for the wild-type enzyme and 2.70 × 10− 6 M for the mutant form. The replacement of tyrosine 58 with phenylalanine increases the Kd value a little more than 4-fold, which corresponds to a reduction of ΔG of the cofactor binding of only 0.86 kcal/mol. The absorption spectrum of the mutant holoenzyme (Fig. 1) contains the predominant band with maximum at 420–425 nm and minor band with maximum in the region 325–330 nm. Distribution analysis of holoenzyme spectrum (data not shown) demonstrated that internal aldimine of the mutant enzyme is described by four structures, the ketoenamine (Fig. 1, structure II), its tautomer, enolimine (Fig. 1, structure I), and two conformers of the ketoenamine, one with the aldimine bond out of the plane of the cofactor with an hydrogen bond with aldimine nitrogen being maintained, and another one with the aldimine bond located in the plane perpendicular to the pyridine ring of PLP. The content of the structures and the parameters of the bands (Table 2) are similar to those for the internal aldimine of wild-type MGL [13]. This analysis indicates that the replacement of

Fig. 2. Stereoview of the superposition of Tyr58Phe MGL (PDB code 4P7Y, blue) and wild-type MGL (PDB code 2RFV, green) active sites fragments. Active site hydrophobic pocket formed by residues of an adjacent subunit is colored by gray color and the residues of adjacent subunit are marked with asterisk. Water molecule belongs to the active site of the mutant enzyme.

Please cite this article as: N.V. Anufrieva, et al., The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbapap.2014.12.027

N.V. Anufrieva et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx

5

Fig. 3. Active site hydrophobic pocket: (А) Michaelis complex of the wild-type MGL with S-ethyl-L-cysteine (PDB code 3JW9); (B) modeled Michaelis complex of Tyr58Phe MGL with S-ethyl-L-cysteine, based on the structures of wild-type MGL with S-ethyl-L-cysteine and holoenzyme Tyr58Phe MGL (PDB code 4P7Y).

cofactor-binding Tyr58 by Phe did not significantly change either the conformation or the microenvironment of the cofactor in the active site of Tyr58Phe MGL. 3.3. Spatial structure of mutant holoenzyme Spatial structure of the Tyr58Phe MGL was determined at 1.96 Å resolution. The replacement did not influence the overall polypeptide chain fold of a subunit as compared to that of the wild-type enzyme and intersubunit contacts in a catalytic dimer. In the three-dimensional structure of wild-type MGL [6], Tyr58 is at H-bond (2.50 Å) distance to OP2-atom of the phosphate handle. A loss of this interaction did not influence the conformation of the phosphate moiety of PLP. Positions of PLP pyridine rings and the conformation of aldimine bonds in structures of wild-type and Tyr58Phe holoenzymes are practically the same. One may assume that almost the same efficiency of the cofactor binding in the mutant enzyme may be explained by a formation of H-bond of OP2-atom with water molecule (Fig. 2). This molecule occupies a part of the space where Tyr58 was located. In the present structure, angle χ1 of the side chain of Phe58 is changed for about 125° as compared to angle χ1 of side chain of Tyr58 in the crystal structure of the wild-type holoenzyme. This results in a positioning of Phe58 ring in a hydrophobic substratebinding area (Fig. 2). Modeling of the Michaelis complex of Tyr58Phe MGL with S-ethyl-L-cysteine demonstrated that the turn shortens the active site cavity and may hinder the optimal disposition of a substrate in the active site (Fig. 3). 3.4. Kinetic studies The principal chemical mechanisms of the γ- and β-elimination reactions catalyzed by PLP-dependent enzymes are shown in the Scheme 2 [28,29]. Due to presence of the coenzyme, PLP-dependent enzymes possess unique spectral features, which allow the identification of individual intermediates of the enzymatic reactions [30]. The γ- and β-elimination reactions are performed by the involvement of a basic group at the stages of abstraction of C-α- and C-β-protons from a substrate (Scheme 2, intermediates 2 and 6) and by acidic catalysis at the stages of elimination of leaving groups (Scheme 2, intermediates 3 and 7). It was suggested [31] that in the γ-elimination reaction, the C-α-proton abstraction and its transfer to the C4′-atom of the coenzyme and the C-β-proton abstraction are realized by the side chain amino group of the active site lysine residue, which forms the internal aldimine with carbonyl group of PLP in the holoenzyme and is liberated when external aldimine is formed (Scheme 2, intermediate 1). Crystal data on the external aldimine of C. freundii MGL with glycine showed that the side chain of active site Lys210 is in a proper position to perform an

abstraction of C-α-proton and a protonation of C4′-atom of PLP [32]. Two conservative in the cystathionine β-lyase subclass residues, tyrosine residue (Tyr113 of C. freundii MGL) and active site lysine, were proposed to be general acid catalysts at the stages of γ- and β-substituents elimination correspondingly [33,34]. The steady-state kinetic parameters of the γ-elimination and β-elimination reactions catalyzed by the Tyr58Phe MGL together with data for the wild-type enzyme [12,13] are compared in Table 3. The substitution of the Tyr58 by Phe decreased kcat and Km values for γ- and β-elimination reactions. A decrease of catalytic efficiency (k cat /K m ) of about two orders of magnitude for both reactions is mainly a result of a decrease of affinities of the mutant enzyme for substrates. This may be due to the shortening of the active site cavity of the Tyr58Phe MGL. Competitive inhibitors of the wild-type enzyme were found also to be competitive inhibitors of the mutant enzyme (Table 4). Ki values for most of the inhibitors increased 10–30-fold similar to the increase of Km values of the substrates. Surprisingly, the Ki value for glycine decreased 8-fold.

3.5. 1H NMR isotope exchange experiments MGL catalyzes the isotopic exchange of the C-α- and C-β-protons of substrates and inhibitors for deuterons in D2O [13,23,35]. Table 5 presents kinetic parameters of isotopic exchange of C-α- and C-βprotons of inhibitors catalyzed by the mutant enzyme, together with data for the wild-type MGL. The mutant enzyme catalyzed the exchange of the C-α- and C-β-protons of L-alanine and L-norleucine with rates 2–4-fold lower than wild-type MGL does. In the case of glycine, the exchange rate proved to be 43-fold lower than that for the wild-type enzyme. Strict stereoselectivity of exchange of C-α-protons of glycine catalyzed by wild-type MGL was demonstrated. The ratio of exchange rates of the pro-(R)- and pro-(S)-protons was determined as 1440:1 [23]. To assign the absolute configurations of the product of isotopic exchange, Gly was transformed into a dipeptide, L-phenylalanyl-[D]glycine. According to Kainosho et al. [36], in 1H NMR spectra of such dipeptides, the chemical shifts of the signals of the diastereotopic protons of the methylene group of glycine fragments are considerably different. In good agreement with 1H NMR spectra of chiral dipeptide L-phenylalanyl-[D]-glycine,

we observed a well distinguishable singlet at 3.4 ppm, which should belong to pro-(R)-proton (data not shown). We failed to detect an exchange of the pro-(S)-proton after a reasonable incubation time of the mutant enzyme with ordinary glycine without an inactivation of the enzyme. Thus, mutant enzyme predominantly catalyzes the exchange of pro-(R)-proton as wild-type MGL does.

Please cite this article as: N.V. Anufrieva, et al., The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbapap.2014.12.027

6

N.V. Anufrieva et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx

β-lyase and has been proposed to be a general acid catalyst at the stage of γ-substituent elimination [40]. Possibly, an increase of a hydrophobicity of the active site of Tyr58Phe MGL by the replacement of Tyr58 for Phe may increase the pKa value of Tyr113, which leads to a retardation of the stage of γ-substituent elimination for the mutant enzyme. The addition of S-ethyl-L-cysteine to wild-type enzyme does not produce noticeable changes in the spectrum of the complex (Fig. 4B) as compared to that of the holoenzyme [13]. The predominant band in the region of 420 nm must belong to the external aldimine (Scheme 2, intermediate 2) of wild-type and the mutant enzymes with S-ethyl-Lcysteine. After the formation of an external aldimine, quinonoid (Scheme 2, intermediate 3) and an aminoacrylate species (Scheme 2, intermediate 4) are intermediates in the β-elimination reaction if it proceeds via an E1cB mechanism. If β-elimination reaction proceeds via an E2 mechanism, then an aminoacrylate intermediate is formed by a concerted mechanism involving simultaneous C-α-proton abstraction and elimination of a leaving group [41]. Neither quinonoid nor aminoacrylate species (Scheme 2, intermediates 3 and 4) are observed in the spectrum of the complex of wild-type enzyme. It could

3.6. Absorption spectra of complexes of wild-type MGL and Tyr58Phe MGL with substrates Previously, it was shown that in the absorption spectrum of the complex of the wild-type enzyme with L-methionine, there is a band with maximum at 440 nm and a shoulder at 480 nm [13]. For PLP-dependent enzymes involved in γ- and β- elimination reactions, absorbance bands in the region of 440–480 nm usually are assigned to the aminocrotonate or aminoacrylate intermediate [37,38]. Spectral and kinetic data on the interaction of wild-type enzyme with a number of substrates and inhibitors indicated that the deamination of aminocrotonate may be the rate-determining stage of γ-elimination reaction [13,39]. In the spectrum of mutant enzyme complexed with L-methionine, there is no absorbance in the region 440–480 nm (Fig. 4A). The predominant band in the region of 425 nm likely belongs to the external aldimine with the substrate. Thus, the replacement of Tyr58 leads to a change of ratelimiting step of the γ-elimination reaction. The active site tyrosine residue (Tyr113 in C. freundii MGL) is conserved in the subclass of cystathionine

Lys210 Lys210

H2N R

(CH2)n

S

+N

R

S

COO-

(CH2)n

NH3+

+

N

O-

O

-HO

3P

O

+

-

R

COO H O-

+

CH3 N H internal aldimine (1) λmax ∼ 420 nm

substrate n= 1; 2

+H N 3

CH3 N H external aldimine (2) λmax ∼ 420 nm

H2N

(CH2)n

S

COO +N

-

HO3P

COO-

-

+

H -HO P 3

H

Lys210

Lys210

O

+N

H O- β-elimination

-HO P 3

O

H O-

+

CH3 N RSH H quinonoid intermediate (3) λmax ∼ 500 nm

N CH3 H α-aminoacrylate (4) λmax ∼ 460−480nm

γ-elimination NH4+ Lys210 Lys210

Lys210

Lys210

COO-

COO-

H

COO+N -HO P 3

O

H O-

CH3 N H vinylglycine quinoid (9) λmax ∼ 500 nm

CH3 H2N

+N

H -HO

3P O

H O-

+

CH3 N RSH H β,γ- unsaturated ketimine (8) λmax ∼ 320 nm

R

S

HB -HO P 3

N

O +

H O-

CH3 N H enamine (7) λmax ∼ 320 nm

R

-

S

COO +N

-HO P 3

O

MGL + COO-

O pyruvate (5) λmax ∼ 320 nm

H O-

+

CH3 N H ketimine intermediate (6) λmax ∼ 320 nm

Lys210 H2N

COO-

CH3 +N -HO P 3

O +

H O-

CH3 N H α-aminocrotonate (10) λmax ∼ 460−480 nm

NH4+

MGL +

CH3

COO-

O α-ketobutyrate (11) λmax ∼ 320 nm

Scheme 2. Speculative mechanisms of PLP-dependent β- and γ-elimination reactions [28,29]. Absorbances of intermediates are indicated according to reference [30].

Please cite this article as: N.V. Anufrieva, et al., The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbapap.2014.12.027

N.V. Anufrieva et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx

7

Table 3 Steady-state kinetic parameters of the γ- and β-elimination reactions. Substrate

Wild-type MGL

L-Methionine DL-Homocysteine

S-Ethyl-L-homocysteine L-Methionine

sulfone O-acetyl-L-homoserine S-Methyl-L-cysteine S-Ethyl-L-cysteine S-Benzyl-L-cysteine O-acetyl-L-serine

Tyr58Phe MGL

kcat (s−1)

Km (mM)

kcat/Km (М−1 s −1)

kcat (s −1)

Km (mM)

kcat/Km (М−1 s −1)

6.2 ± 0.42⁎

0.7 ± 0.11⁎

8.85 × 103

2.66 ± 0.047

19.65 ± 1.26

1.35 × 102

8.51 ± 0.41⁎ 6.78 ± 0.02⁎ 2.09 ± 0.14⁎⁎

0.97 ± 0.15⁎ 0.54 ± 0.01⁎ 4.02 ± 0.59⁎⁎

8.77 × 103

0.88 ± 0.011

3.46 ± 0.29

2.54 × 102

1.25 × 10 5.2 × 102

2.07 ± 0.072 0.16 ± 0.0038

8.11 ± 0.78 52.1 ± 3.74

2.55 × 102 3.07

2.1 ± 0.053⁎⁎ 4.6 ± 0.29⁎ 5.03 ± 0.16⁎ 8.16 ± 0.23⁎ 2.13 ± 0.037

2.91 ± 0.18⁎⁎ 0.71 ± 0.11⁎ 0.17 ± 0.02⁎ 0.18 ± 0.02⁎ 4.28 ± 0.33

7.21 × 102 6.48 × 103 2.96 × 104 4.53 × 104 4.98 × 102

0.75 ± 0.06 1.67 ± 0.053 2.38 ± 0.033 3.34 ± 0.063 1.17 ± 0.03

23.8 ± 1.54 30.19 ± 2.55 8.19 ± 0.42 2.75 ± 0.15 13.39 ± 1.03

3.15 × 101 5.53 × 101 2.91 × 102 1.21 × 103 8.73 × 101

4

⁎ Data from Manukhov et al. [12]. ⁎⁎ Data from Morozova et al. [13].

probably mean that the rates of their formation are lower or equal to their decomposition rates. Neither quinonoid nor aminoacrylate species may be а rate-limiting stage of β-elimination reaction. In the spectrum of Tyr58Phe MGL complexed with S-ethyl-L-cysteine, a decrease of the band at 420 nm and an increase of absorbance in the regions 320–340 nm and 480–500 nm were observed (Fig. 4B). The increase of absorbance at 320–340 nm should be assigned to the absorbance of pyruvic acid. Both quinonoid and aminoacrylate intermediates absorb in the region 460–500 nm [37,38]. Up to now, little is in known about the mechanism of β-elimination reactions catalyzed by MGL, and reliable assignment of the absorbance in the region of 480–500 nm to any definite intermediate is practically impossible.

of the C-β-proton by active site Lys210 guided by Tyr58, this residue is involved in proton transfers at the stages after the elimination of γsubstituent, and these stages are hampered in the mutant enzyme. In the β-elimination reaction, Tyr58 may provide stabilization of the optimal position of Lys210 at the stages of C-α-proton abstraction and

3.7. The role of Tyr58 in the mechanisms of β- and γ-elimination reactions The X-ray structure of the external aldimine of C. freundii MGL formed with glycine allowed us to suppose that in the γelimination reaction the 1,3-prototropic shift of the C-α-proton to the C4′-atom of the cofactor, and the abstraction of the C-β-protons (Scheme 2) may proceed with participation of the side chain of the Lys210 residue. H-bonding interaction of the side chain of Lys210 with the side chain of Ser207 (3.39 Å) mainly ensures optimal positioning of Lys210 side chain [32]. In this structure, the hydroxyl group of Tyr58 is at 3.98 Å distance to Lys210. One may assume that in the complex with physiological substrate the hydroxyl group of Tyr58 may be H-bonded to the amino group of Lys210, and along with the side chain of Ser207, supports optimal position of the side chain of Lys210 to perform the 1,3-prototropic shift of the C-α-proton to the C4′-atom of the cofactor and the abstraction of the C-β-protons. The decreases of the rates of isotopic exchange of C-α- and C-β-protons of inhibitors are in an agreement with this supposition. Presumably after abstraction

Table 4 Inhibition of the γ-elimination reaction of L-methionine. Inhibitor

Wild-type MGL

Glycine L-Alanine L-α-Aminobutyric

acid

L-Norvaline L-Norleucine

⁎ Data from Morozova et al. [13].

Tyr58Phe MGL

Ki, mМ

Ki, mМ

48.49 ± 4.37⁎ 3.41 ± 0.40⁎ 8.01 ± 0.76⁎

6.13 ± 0.85 35.34 ± 4.79

4.60 ± 0.43⁎ 0.95 ± 0.06⁎

110.71 ± 20.26

63.73 ± 5.97 31.89 ± 4.79

Fig. 4. Absorption spectra of the wild-type MGL (short dashed line) and the mutant enzyme (dash-dotted line) complexes with substrates: L-methionine (A) and S-ethyl-L-cysteine (B). Absorption spectra were recorded in 50 mM potassium phosphate buffer, pH 8.0 with 0.5 mM DTT, 1 mM EDTA, 2.3 × 10−2 mM (1 mg·ml−1) enzyme, 214.86 mM L-methionine or 75 mM S-ethyl-L-cysteine for Tyr58Phe MGL; 62 mM L-methionine or 50 mM S-ethyl-Lcysteine for wild-type MGL. Spectra for wild-type MGL were recorded immediately after an addition of the amino acids, and spectra for Tyr58Phe MGL were recorded after 10 min of incubation with the amino acids.

Please cite this article as: N.V. Anufrieva, et al., The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbapap.2014.12.027

8

N.V. Anufrieva et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx

Table 5 Kinetic parameters of isotope exchange of C-α- and C-β-protons of L-amino acids. Amino acid

Wild-type MGL Km = Kp, mM

Glycine L-Alanine L-Norleucine

Tyr58Phe MGL kex, s−1

Km = Kp, mM

α-H

β-H

49⁎ 3.4⁎

20.2⁎ 2.71⁎

0.6⁎

41.78⁎

– 2.63⁎ 4.74⁎

Number of exchanged C-αand C-β-protons

kex, s−1 α-H

β-H

6.13 35.34

0.47 0.83

– 0.76

1; – 1; 3

31.89

19.4

1.08

1; 2

⁎ Data from Morozova et al. [13].

leaving group elimination. The guiding of the active site lysine by homologous Tyr56 of cystathionine β-lyase from E. coli to catalyze β-substituent elimination was postulated by analysis of the crystal structure of the enzyme [34]. The tyrosine residue H-bonded to the phosphate group of PLP is conserved in many PLP-dependent enzymes of the AspAT fold type. It plays a different role in the catalytic transformations catalyzed by these enzymes. The most impact of this residue on the catalytic properties was observed for tyrosine phenol-lyase from C. freundii and tryptophan indole-lyase from Proteus vulgaris. It was demonstrated that Tyr71 in tyrosine phenol-lyase plays a critical role in both PLP binding and as a general acid catalyst in the elimination of leaving groups from quinonoid intermediates [42]. For Tyr72 in tryptophan indolelyase, it was shown that its replacement for Phe significantly reduces PLP binding and results in a rearrangement in the active site accompanied by a significant change in the mutual orientation of the bound substrates and active site residues. Moreover, this residue is capable of playing the role of the general acid catalyst [43]. The study of mutant forms with the replacement of Tyr56 in cystathionine β-lyase from E. coli [44] and Tyr46 in cystathionine γ-synthase from E. coli [45] for Phe showed that catalytic efficiencies of these mutant forms in the physiological reactions are decreased by about three orders of magnitude. The main function of Tyr 70 in E. coli AspAT was proposed to be a stabilization of the holoenzyme [46]. It was proposed to be involved in internal Schiff base formation [46], in stabilization of the transition state of the transamination reaction, and in the correct positioning of substrates at the active site of the enzyme [47]. A stabilization of the holoenzyme was demonstrated for Tyr121 in aminolevulinate synthase [48]. As in the case of Tyr58 in C. freundii MGL, Tyr64 in Treponema denticola cystalysin [49], Tyr55 in C-S lyase from Corynebacterium diphtheria [50], and Tyr60 in C-S lyase from Streptococcus anginosus [51] all are supposed to be involved in stabilizing the proper orientation of the active site lysine for general acid catalysis at the stage of a side chain group elimination. Transparency Document The Transparency document associated with this article can be found, in the online version.

Acknowledgments This work was supported by the Russian Academy of Sciences, the Russian Foundation for Basic Researches (grant nos. 14-04-00349 and 14-04-31398), and the program of the President of the Russian Federation “Leading Scientific Schools” (SS 2064.2014.4). Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.bbapap.2014.12.027.

References [1] H. Tanaka, N. Esaki, K. Soda, A versatile bacterial enzyme: L-methionine γ-lyase, Enzym. Microb. Technol. 7 (1985) 530–537. [2] S.M. Finegold, H.M. Wexler, Present studies of therapy for anaerobic infections, Clin. Infect. Dis. 1 (1996) 9–14. [3] R.M. Hoffman, R.W. Erbe, High in vivo rates of methionine biosynthesis in transformed human and malignant rat cells auxotrophic for methionine, Proc. Natl. Acad. Sci. U. S. A. 73 (1976) 1523–1527. [4] Y. Tan, M. Xu, R.M. Hoffman, Broad selective efficacy of recombinant methioninase and polyethylene glycol-modified recombinant methioninase on сancer сells in vitro, Anticancer Res. 30 (2010) 1041–1046. [5] D.V. Mamaeva, E.A. Morozova, A.D. Nikulin, S.V. Revtovich, S.V. Nikonov, M.B. Garber, T.V. Demidkina, Structure of Citrobacter freundii L-methionine γ-lyase, Acta Crystallogr. F61 (2005) 546–549. [6] A. Nikulin, S. Revtovich, E. Morozova, N. Nevskaya, S. Nikonov, M. Garberb, T. Demidkina, High-resolution structure of methionine γ-lyase from Citrobacter freundii, Acta Crystallogr. D64 (2008) 211–218. [7] N.V. Grishin, M.A. Phillips, E.J. Goldsmith, Modeling of the spatial structure of eukaryotic ornithine decarboxylases, Protein Sci. 4 (7) (1995) 1291–1304. [8] J.N. Jansonius, Structure, evolution and action of vitamin B6-dependent enzymes, Curr. Opin. Struct. Biol. 8 (6) (1998) 759–769. [9] H. Käck, J. Sandmark, K. Gibson, G. Schneider, Y. Lindqvist, Crystal structure of diaminopelargonic acid synthase: evolutionary relationships between pyridoxal5′-phosphate-dependent enzymes, J. Mol. Biol. 291 (4) (1999) 857–876. [10] S. Nagai, M. Flavin, Acetylhomoserine. An intermediate in the fungal biosynthesis of methionine, J. Biol. Chem. 242 (17) (1967) 3884–3895. [11] D.J.K. Morneau, E. Abouassaf, J.E. Skanes, S.M. Aitken, Development of a continuous assay and steady-state characterization of Escherichia coli threonine synthase, Anal. Biochem. 423 (2012) 78–85. [12] I.V. Manukhov, D.V. Mamaeva, E.A. Morozova, S.M. Rastorguev, N.G. Faleev, T.V. Demidkina, G.B. Zavilgelsky, L-Methionine γ-lyase from Citrobacter freundii: cloning of the gene and kinetic parameters of the enzyme, Biochem. Mosc. 71 (4) (2006) 361–369. [13] E.A. Morozova, N.P. Bazhulina, N.V. Anufrieva, D.V. Mamaeva, Y.V. Tkachev, S.A. Streltsov, V.P. Timofeev, N.G. Faleev, T.V. Demidkina, Kinetic and spectral parameters of interaction of Citrobacter freundii methionine γ-lyase with amino acids, Biochem. Mosc. 75 (10) (2010) 1272–1280. [14] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (5259) (1970) 680–685. [15] Y. Morino, E.E. Snell, The subunit structure of tryptophanase. I. The effect of pyridoxal phosphate on the subunit structure and physical properties of tryptophanase, J. Biol. Chem. 242 (1967) 5591–5601. [16] E.A. Peterson, H.A. Sober, Preparation of crystalline phosphorylated derivatives of vitamin B6, J. Am. Chem. Soc. 76 (1954) 169–175. [17] A.L. Osterman, H.B. Brooks, J. Rizo, M.A. Phillips, Role of Arg-277 in the binding of pyridoxal 5′-phosphate to Trypanosoma brucei ornithine decarboxylase, Biochemistry 36 (1997) 4558–4567. [18] G. Scatchard, The attraction of proteins for small molecules and ions, Ann. N. Y. Acad. Sci. 51 (1949) 660–672. [19] Y. Morino, E.E. Snell, Tryptophanase (E. coli B), Methods Enzymol. 17A (1970) 439–446. [20] W.W. Cleland, Statistical analysis of enzyme kinetic data, Methods Enzymol. 63 (1979) 103–138. [21] I.V. Manukhov, D.V. Mamaeva, S.M. Rastorguev, N.G. Faleev, E.A. Morozova, T.V. Demidkina, G.B. Zavilgelsky, A gene encoding L-methionine γ-lyase is present in Enterobacteriaceae family genomes: identification and characterization of Citrobacter freundii L-methionine γ-lyase, J. Bacteriol. 187 (2005) 3889–3893. [22] N.G. Faleev, S.B. Ruvinov, V.I. Bakhmutov, T.V. Demidkina, I.V. Miagkikh, Substrate specificity of tyrosine phenol-lyase. Electron and steric control at the stage of aromatic moiety elimination, Mol. Biol. (Mosk) 21 (6) (1987) 1636–1644. [23] V.V. Koulikova, L.N. Zakomirdina, O.I. Gogoleva, M.A. Tsvetikova, E.A. Morozova, V.V. Komissarov, Y.V. Tkachev, V.P. Timofeev, T.V. Demidkina, N.G. Faleev, Stereospecificity of isotopic exchange of C-α-protons of glycine catalyzed by three PLP-dependent lyases: the unusual case of tyrosine phenol-lyase, Amino Acids 41 (5) (2011) 1247–1256. [24] W. Kabsch, Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants, J. Appl. Crystallogr. 26 (1993) 795–800. [25] M.D. Winn, C.C. Ballard, K.D. Cowtan, E.J. Dodson, P. Emsley, P.R. Evans, R.M. Keegan, E.B. Krissinel, A.G. Leslie, A. McCoy, S.J. McNicholas, G.N. Murshudov, N.S. Pannu, E.A.

Please cite this article as: N.V. Anufrieva, et al., The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbapap.2014.12.027

N.V. Anufrieva et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx

[26] [27]

[28]

[29]

[30] [31]

[32]

[33]

[34]

[35]

[36]

[37] [38]

Potterton, H.R. Powell, R.J. Read, A. Vagin, K.S. Wilson, Overview of the CCP4 suite and current developments, Acta Crystallogr. D Biol. Crystallogr. D67 (2011) 235–242. P. Emsley, B. Lohkamp, W. Scott, K. Cowtan, Features and development of coot, Acta Crystallogr. D Biol. Crystallogr. D66 (2010) 486–501. G.N. Murshudov, P. Skubák, A.A. Lebedev, N.S. Pannu, R.A. Steiner, R.A. Nicholls, M.D. Winn, F. Long, A.A. Vagin, REFMAC5 for the refinement of macromolecular crystal structures, Acta Crystallogr. Sect. D: Biol. Crystallogr. D67 (2011) 355–367. P. Brzoviс, E.L. Holbrook, R.C. Greene, M.F. Dum, Reaction mechanism of Escherichia coli cystathionine γ-synthase: direct evidence for a pyridoxamine derivative of vinylglyoxylate as a key intermediate in pyridoxal phosphate dependent γelimination and γ-replacement reactions, Biochemistry 29 (2) (1990) 442–451. A. Messerschmidt, M. Worbs, C. Steegborn, M.C. Wahl, R. Huber, B. Laber, T. Clausen, Determinants of enzymatic specificity in the Cys-Met-metabolism PLP-dependent enzymes family: crystal structure of cystathionine γ-lyase from yeast and intrafamiliar structure comparison, Biol. Chem. 384 (3) (2003) 373–386. L. Davis, D. Metzler, The Enzymes, in: P.D. Boyer (Ed.), 3rd ed., vol. 7, Academic Press, N. Y, 1972, pp. 33–74. C. Steegborn, A. Messerschmidt, B. Laber, W. Streber, R. Huber, T. Clausen, The crystal structure of cystathionine γ-synthase from Nicotiana tabacum reveals its substrate and reaction specificity, J. Mol. Biol. 290 (5) (1999) 983–996. S.V. Revtovich, N.G. Faleev, E.A. Morozova, N.V. Anufrieva, A.D. Nikulin, T.V. Demidkina, Crystal structure of the external aldimine of Citrobacter freundii methionine γ-lyase with glycine provides insight in mechanisms of two stages of physiological reaction and isotope exchange of α- and β-protons of competitive inhibitors, Biochimie 101 (2014) 161–167. C. Steegborn, B. Laber, A. Messerschmidt, R. Huber, T. Clausen, Crystal structures of cystathionine γ-synthase inhibitor complexes rationalize the increased affinity of a novel inhibitor, J. Mol. Biol. 311 (4) (2001) 789–801. T. Clausen, R. Huber, B. Laber, H.D. Pohlenz, A. Messerschmidt, Crystal structure of the pyridoxal-5′-phosphate dependent cystathionine β-lyase from Escherichia coli at 1.83 Å, J. Mol. Biol. 262 (2) (1996) 202–224. N. Esaki, T. Nakayama, S. Sawada, H. Tanaka, K. Soda, 1H NMR Studies of substrate hydrogen exchange reactions catalyzed by L-methionine γ-lyase, Biochemistry 24 (1985) 3857–3862. M. Kainosho, K. Ajisaka, M. Kamisaku, A. Murai, Y. Kyogoku, Conformational analysis of amino acids and peptides using specific isotope substitution. I. Conformation of L-phenylalanylglycine, Biochem. Biophys. Res. Commun. 64 (1) (1975) 425–432. C.M. Metzler, A.G. Harris, D.E. Metzler, Spectoscopic studies of quinonoid species from pyridoxal 5′-phosphate, Biochemistry 27 (1988) 4923–4933. E.U. Woehl, Ch.-H. Tai, M.F. Dunn, P.F. Cook, Formation of α-aminoacrylate intermediate limits the overall reaction catalyzed by O-acetylserine sulfhydrylase, Biochemistry 35 (15) (1996) 4776–4783.

9

[39] H. Inoue, K. Inagaki, N. Adachi, T. Tamura, N. Esaki, K. Soda, H. Tanaka, Role of tyrosine 114 of L-methionine γ-lyase from Pseudomonas putida, Biosci. Biotechnol. Biochem. 64 (11) (2000) 2336–2343. [40] T. Clausen, R. Huber, L. Prade, M.C. Wahl, A. Messerschmidt, Crystal structure of Escherichia coli cystathionine γ-synthase at 1.5 Å resolution, EMBO J. 17 (23) (1998) 6827–6838. [41] C.H. Tai, P.F. Cook, Pyridoxal 5′-phosphate-dependent α, β-elimination reactions: mechanism of O-acetylserine sulfhydrylase, Acc. Chem. Res. 34 (1) (2001) 49–59. [42] H.Y. Chen, T.V. Demidkina, R.S. Phillips, Site-directed mutagenesis of tyrosine-71 to phenylalanine in Citrobacter freundii tyrosine phenol-lyase: evidence for dual roles of tyrosine-71 as a general acid catalyst in the reaction mechanism and in cofactor binding, Biochemistry 34 (38) (1995) 12276–12283. [43] V.V. Kulikova, L.N. Zakomirdina, I.S. Dementieva, R.S. Phillips, P.D. Gollnick, T.V. Demidkina, N.G. Faleev, Tryptophanase from Proteus vulgaris: the conformational rearrangement in the active site, induced by the mutation of Tyrosine 72 to phenylalanine, and its mechanistic consequences, Biochim. Biophys. Acta 1764 (4) (2006) 750–757. [44] P.H. Lodha, S.M. Aitken, Characterization of the side-chain hydroxyl moieties of residues Y56, Y111, Y238, Y338, and S339 as determinants of specificity in E. coli cystathionine β-lyase, Biochemistry 50 (45) (2011) 9876–9885. [45] A.F. Jaworski, P.H. Lodha, A.L. Manders, S.M. Aitken, Exploration of the active site of Escherichia coli cystathionine γ-synthase, Protein Sci. 21 (11) (2012) 1662–1671. [46] M.D. Toney, J.F. Kirsch, Kinetics and equilibria for the reactions of coenzymes with wild type and the Y70F mutant of Escherichia coli aspartate aminotransferase, Biochemistry 30 (30) (1991) 7461–7466. [47] K. Inoue, S. Kuramitsu, A. Okamoto, K. Hirotsu, T. Higuchi, H. Kagamiyama, Sitedirected mutagenesis of Escherichia coli aspartate aminotransferase: role of Tyr70 in the catalytic processes, Biochemistry 30 (31) (1991) 7796–7801. [48] D. Tan, M.J. Barber, G.C. Ferreira, The role of tyrosine 121 in cofactor binding of 5aminolevulinate synthase, Protein Sci. 7 (5) (1998) 1208–1213. [49] B. Cellini, M. Bertoldi, R. Montioli, C. Borri Voltattorni, Probing the role of Tyr 64 of Treponema denticola cystalysin by site-directed mutagenesis and kinetic studies, Biochemistry 44 (42) (2005) 13970–13980. [50] A. Astegno, A. Giorgetti, A. Allegrini, B. Cellini, P. Dominici, Characterization of C-S Lyase from C. diphtheriae: a possible target for new antimicrobial drugs, Biomed. Res. Int. (2013). http://dx.doi.org/10.1155/2013/701536 (ID 701536), (Epub 2013 Sep. 11). [51] Y. Kezuka, Y. Yoshida, T. Nonaka, Structural insights into catalysis by βC-S lyase from Streptococcus anginosus, Proteins 80 (2012) 2447–2458.

Please cite this article as: N.V. Anufrieva, et al., The role of active site tyrosine 58 in Citrobacter freundii methionine γ-lyase, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbapap.2014.12.027