The Role of Ah Receptor in Induction of Human UDP‐Glucuronosyltransferase 1A1

[5]

role of Ah

RECEPTOR IN

UGT1A1

75

Thimmulappa, R. K., Mai, K. H., Srisuma, S., Kensler, T. W., Yamamato, M., and Biswal, S. (2002). Identification of Nrf2‐regulated genes induced by the chemopreventive agent sulforaphane by oligonucleotide microarray. Cancer Res. 62, 5196–5203. Tukey, R. H., and Strassburg, C. P. (2000). Human UDP‐glucuronosyltransferases: Metabolism, expression, and disease. Annu. Rev. Pharmacol. Toxicol. 40, 581–616. Uchaipichat, V., Mackenzie, P. I., Guo, X. H., Gardner‐Stephen, D., Galetin, A., Houston, J. B., and Miners, J. O. (2004). Human UDP‐glucuronosyltransferases: Isoform selectivity and kinetics of 4‐methylumbelliferone and 1‐naphthol glucuronidation, effects of organic solvents, and inhibition by diclofenac and probenecid. Drug Metab. Disp. 32, 413–423. Vyhlidal, C. A., Rogan, P. K., and Leeder, J. S. (2004). Development and refinement of pregnane X receptor (PXR) DNA binding site model using information theory. J. Biol. Chem. 279, 46779–46786. Watt, A. J., Garrison, W. D., and Duncan, S. A. (2003). HNF4: A central regulator of hepatocyte differentiation and function. Hepatology 37, 1249–1253. Weissbach, H., Lovenberg, W., Redfield, B. G., and Udenfriend, S. (1961). In vivo metabolism of serotonin and tryptamine: Effect of monoamine oxidase inhibition. J. Pharmacol. Exp. Ther. 131, 26–30. Xie, W., Yeuh, M. F., Radominska‐Pandya, A., Saini, S. P. S., Negishi, Y., Bottroff, B. S., Cabrera, G. Y., Tukey, R. H., and Evans, R. M. (2003). Control of steroid, heme, and carcinogen metabolism by nuclear pregnane X receptor and constitutive androstane receptor. Proc. Natl. Acad. Sci. USA 100, 4150–4155. Yang, Y., Griffiths, W. J., Midtvedt, T., Sjo¨vall, J., Rafter, J., and Gustafsson, J. A. (1999). Characterization of conjugated metabolites of benzo(a)pyrene in germ‐free rat urine by liquid chromatography/electrospray tandem mass spectrometry. Chem. Res. Toxicol. 12, 1182–1189. Yu, R., Tan, T. H., and Kong, A. N. T. (1997). Butylated hydroxyanisole and its metabolite tert‐butylhydroquinone differentially regulate mitogen‐activated protein kinases. J. Biol. Chem. 272, 28962–28970. Zheng, Z., Fang, J. L., and Lazarus, P. (2002). Glucuronidation: An important mechanism for detoxification of benzo(a)pyrene metabolites in aerodigestive tract tissues. Drug Metab. Disp. 30, 397–403.

[5] The Role of Ah Receptor in Induction of Human UDP‐Glucuronosyltransferase 1A1 By MEI‐FEI YUEH, JESSICA A. BONZO , and ROBERT H. TUKEY Abstract

UDP‐glucuronosyltransferases (UGTs) catalyze a major metabolic pathway initiating the transfer of glucuronic acid from uridine 50 ‐ diphosphoglucuronic acid to endogenous and exogenous substances. Endogenous substances include bile acids, steroids, phenolic neurotransmitters, and bilirubin. Xenobiotic substances include dietary substances,

METHODS IN ENZYMOLOGY, VOL. 400 Copyright 2005, Elsevier Inc. All rights reserved.

0076-6879/05 $35.00 DOI: 10.1016/S0076-6879(05)00005-4

76

phase ii conjugation enzymes and transport systems

[5]

therapeutics, and environmental compounds. The versatility in the selection of substrates for glucuronidation results from the multiplicity of the UGTs in addition to the ability of these genes to be regulated. UDP‐ glucuronosyltransferase 1A1 (UGT1A1), responsible for the glucuronidation of bilirubin, is controlled in a tissue‐specific manner and can be regulated following environmental exposure. This chapter describes materials and methods for the examination of molecular interactions that control UGT1A1 expression and induction in response to 2,3,7,8‐ tetrachlorodibenzo‐p‐dioxin (TCDD). Using an in vitro cell culture system, we mapped a regulatory sequence that contains a xenobiotic response element core sequence in the enhancer region of the UGT1A1 gene. Similar to regulation of CYP1A1, the transcriptional activation of UGT1A1 he aryl hydrocarbon receptor. Introduction

Induction of drug‐metabolizing enzymes is one important way of enhancing or attenuating the in vivo effects of endogenous or xenobiotic compounds that are substrates for these enzymes. Aryl hydrocarbon (Ah) receptor‐mediated induction of CYP1 genes (i.e., CYP1A1, CYP1A2, and CYP1B1) represents a classical mechanism of upregulation of drug‐ metabolizing enzymes. Without ligand stimulation, the Ah receptor is present in the cytosol in an inactive complex containing Hsp90, p23, and XAP2 (Kazlauskas et al., 2000). Many structurally diverse compounds, including polycyclic aromatic hydrocarbons (PAHs) and halogenated aromatic hydrocarbons (HAHs), are capable of binding to and activating the Ah receptor. The activated Ah receptor subsequently translocates to the nucleus and heterodimerizes with the nuclear protein Ah receptor nuclear translocator (Arnt) to form an Ah receptor–Arnt complex that acts as a transcription factor to turn on a battery of target genes (Nebert et al., 2000). The nuclear receptors pregnane xenobiotic receptor (PXR), constitutive active receptor (CAR), and peroxisome proliferator‐ activated receptor  (PPAR) have also been linked to the regulation of drug‐metabolizing enzymes (Waxman, 1999). Glucuronidation, catalyzed by the superfamily of UDP‐glucuronosyltransferase (UGT) enzymes, is a major metabolic pathway for xenobiotics and steroids. Previously, 2,3,7,8‐tetrachlorodibenzo‐p‐dioxin (TCDD) and PAHs have been reported to induce UGT activity in rodents (Emi et al., 1996; Kessler and Ritter, 1997; Malik and Owens, 1981) and in human cell lines (Bock et al., 1999), but the involvement of specific UGT isoforms and the underlying mechanisms have not been elucidated clearly. This study

[5]

role of Ah

RECEPTOR IN

UGT1A1

77

was initiated by the observation in our laboratory that UGT1A1 was regulated in HepG2 cells in response to the Ah receptor ligands, TCDD and ‐naphthoflavone (BNF), as monitored by increases in protein levels and catalytic activity, as well as UGT1A1 mRNA. Considering the ability of these conjugation enzymes to metabolize endogenous bilirubin and therapeutics, the alteration of UGT1A1 levels might have a profound impact on physiological and pathological consequences. Normally, gene function is influenced by a combination of cis‐acting elements and trans‐ acting factors. Advances in the understanding of promoter–enhancer sequences and external transcription regulatory proteins involved in the control of gene expression continue to evolve using methods in molecular biology. In the systems explored here, cell culture provides a convenient in vitro model to dissect and analyze regulatory regions of a gene, to define functional enhancer sequences, and to monitor gene expression levels in the presence or absence of chemical inducers. Materials

1‐Naphthol, 17‐ethynylestradiol, and BNF are from Sigma. TCDD, benzo[a]pyrene (B[a]P) and its derivatives are from the National Cancer Institute, National Institutes of Health, Chemical Carcinogen Reference Standard Repository (Kansas City, MO). The Bradford assay for protein concentration analysis is from Bio‐Rad. Restriction enzymes and T4 DNA ligase are from New England Biolabs (Beverly, MA). Taq polymerase, dual luciferase reporter assay system, and reporter plasmids—pGL3‐basic vector, pGL3‐promoter vector, and pRL‐TK vector—are from Promega (Madison, WI). Lipofectamine 2000 for transfection and medium for cell culture are from Invitrogen. Custom oligonucleotides used in polymerase chain reaction (PCR) cloning, subcloning, DNA sequencing, and gel shift assay are from Genbase (San Diego, CA). Thin‐layer chromatography (TLC) plates for glucuronidation activity are from Whatman (Clifton, NJ). Methods and Results

Cell Culture and Treatment Human hepatoma‐derived HepG2 cells, obtained from ATCC, are grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS). TV101 cells are HepG2 cells stably integrated with a reporter gene that carries the CYP1A1 regulatory region, containing multiple XREs and luciferase reporter (Postlind et al., 1993). Luciferase expression is driven by the promoter activity of CYP1A1.

78

phase ii conjugation enzymes and transport systems

[5]

TV101 cells are grown in the same medium with HepG2 in the presence of neomycin (800 g/ml). Cell lines are trypsinized, and 2
106 cells are seeded in P100 plates. Chemicals are dissolved in DMSO, and the DMSO concentration in media never exceeds 0.1% (v/v). Cells are treated for 24–72 h with TCDD (10 nM), BNF (20 M), or DMSO. For transient transfection experiments, 1
105 cells/well are seeded on 24‐well plates a day before transfection followed by chemical treatment for 48 h a day after transfection. Fresh media and chemical treatments are changed every 24 h. Detection of UGT1A1 Levels Glucuronidation Activity by TLC Assay. UGT1A1 activities are determined using 1‐naphthol and 17‐ethynylestradiol as substrates by TLC assay according to the method of Bansal and Gessner (1980) with modification. 1. HepG2 cells are grown to 70% confluency in DMEM supplemented with 10% FBS. 2. Whole cell lysates are prepared by washing and scraping with ice‐ cold phosphate‐buffered saline (PBS) after 24–72 h of treatment. Cell pellets are then dissolved in a fivefold volume of lysis buffer [50 mM Tris‐HCl (pH 7.6), 10 mM MgCl2]. 3. Each UGT assay contains 50 mM Tris‐HCl (pH 7.6), 10 mM MgCl2, 100 M UDPGlcA, 0.04 Ci [14C]UDPGlcA (0.14 nmol), 8.5 mM sacchrolactone, 100 M substrate, and 100 g of protein from HepG2 cell extracts in a total volume of 100 l. 4. Reactions are performed at 37 in a shaking water bath for 90 min. 5. At the end of the incubation, 100 l of ethanol is added to the sample, centrifuged briefly to spin down cell lysates, and 100 l of the supernatant applied to the TLC plate. 6. Glucuronides in the TLC plate are visualized with a Molecular Dynamics Storm 820 phosphorimager. 7. Resident glucuronides are then removed by scraping and are quantitated by liquid scintillation counting. The small phenolic compound 1‐naphthol is used as a substrate to examine UGT activity in HepG2 cells. Simple phenols have been shown to be glucuronidated by most of the UGT1A proteins (Tukey and Strassburg, 2000), with a preference for UGT1A1, UGT1A6, UGT1A8, and UGT1A9. Treatment of HepG2 cells with TCDD (10 nM) or BNF (20 M) for 72 h leads to a time‐dependent increase in 1‐naphthol UGT activity of 3‐ and 4.5 fold, respectively (Fig. 1). Glucuronidation of 17 ‐ethynylestradiol, a

[5]

role of Ah

RECEPTOR IN

UGT1A1

79

FIG. 1. Time‐dependent induction of glucuronidation activity in response to TCDD and BNF. HepG2 cells were treated for 24, 48, and 72 h with DMSO, 10 nM TCDD, or 20 M BNF and whole cell lysates were collected. Assays for UGT activity toward 1‐naphthol and 17‐ethynylestradiol were performed using 100 g protein. Glucuronides formed were scraped from TLC plates and counted. Each reaction was performed in triplicate and average activity displayed.

substrate that is preferentially glucuronidated by UGT1A1, is increased 2.5‐ to 5‐fold in TCDD‐ or BNF‐treated cells (Fig. 1). UGT1A1 RNA Transcripts. Quantization of UGT1A1 mRNA is conducted by Northern blot analysis with a gene‐specific cDNA probe. 1. Total RNA is isolated from TCDD‐, BNF‐, or DMSO‐treated HepG2 cells using Trizol (Invitrogen). 2. Total RNA (15 g) is separated through 1% formaldehyde agarose gels. RNA is subsequently blotted onto a GeneScreen membrane (PerkinElmer) by capillary transfer.

80

phase ii conjugation enzymes and transport systems

[5]

3. After transfer, the blot is stained with 0.01% methylene blue in 0.5 M sodium acetate (pH 5.2) to visualize RNA for loading and transfer efficiency. 4. For cDNA probe labeling, a 423‐bp fragment recovered by digesting the UGT1A1 cDNA (GenBank NM_000463, bases 299 to 722) with AvaI/EcoRI is 32P labeled by random priming (Invitrogen). After labeling, the cDNA probe is purified using a nucleotide removal kit (Qiagen). 5. Total RNA is fixed onto the membranes with a cross‐linker (Stratagene). The blot is prehybridized with the hybridization solution (Stratagene) at 68 for 30 min and then with denatured hybridization solution containing the UGT1A1 cDNA probe at 68 for 2 h. The membrane is then washed in 0.1
SSC (0.15 M NaCl and 0.015 M sodium citrate) and 0.1% SDS at 60 for 30 min. 6. RNA is visualized on each membrane by a phosphorimager. Results of Northern blot analysis demonstrate that both TCDD‐ and BNF‐treated HepG2 cells lead to a time‐dependent increase in UGT1A1 mRNA (Fig. 2). Analysis of UGT1A1 Protein by Western Blot 1. After treatment, HepG2 cells are collected by scraping, washed in cold PBS, and resuspended in 5 volumes of PBS. 2. Cell suspensions are homogenized 20 times with a Kontes Potter– Elvehjem tissue grinder, and homogenates are centrifuged at 5000g in a Sorvall RT 6000B refrigerated centrifuge. 3. The supernatant is collected and centrifuged at 150,000g for 1 h in a Beckman TL100 tabletop ultracentrifuge. The microsomal pellet is resuspended in 500 l of 50 mM Tris‐HCl, pH 7.4, 10 mM MgCl2, and 1 mM phenylmethylsulfonyl fluoride (PMSF). 4. Protein (10 g) is loaded onto Nupage Bis‐Tris 10% polyacrylamide gels (Invitrogen). Electrophoresis is conducted at 200 V for 50 min, and the protein is transferred at 30 V for 1 h to nitrocellulose membranes (Millipore). 5. The membranes are blocked with 5% nonfat dry milk in Tris‐buffered saline (10 mM Tris, pH 8.0; 150 mM NaCl, 0.05% Tween 20) for 1 h followed by incubation with anti‐human UGT1A1 (1:1000) (Ritter et al., 1999) or anti‐human CYP1A1 (1:5000) (Soucek et al., 1995) prepared in Tris‐buffered saline with 5% bovine serum albumin (Sigma) overnight at 4 . 6. The membranes are washed and then treated with horseradish peroxidase‐conjugated antimouse (Cell Signaling) (1:5000) for UGT1A1 or antirabbit (1:5000) for CYP1A1 antibody for 1 h.

[5]

role of Ah

RECEPTOR IN

UGT1A1

81

FIG. 2. UGT1A1 transcript levels after TCDD and BNF treatment. Northern blot of UGT1A1 RNA in HepG2 cells after treatment with DMSO (untreated), 10 nM TCDD, and 20 M BNF for 8, 24, 48, and 72 h. RNA (15 g) was separated on a formaldehyde agarose gel, transferred to a nitrocellulose membrane, and incubated with a 423‐bp probe from UGT1A1 cDNA. RNA was visualized by a phosphoimager.

7. The membranes are washed again with Tris‐buffered saline. Protein is visualized using the renaissance Western blot chemiluminescence reagent according to the manufacturer’s instructions (PerkinElmer Life Science) followed by exposure to X‐ray film. In HepG2 cells, TCDD and BNF induce UGT1A1 as shown by increased levels of UGT1A1 protein in Western blot analysis (Fig. 3). In addition, TCDD and BNF are capable of inducing CYP1A1. Because induction of CYP1A1 by TCDD and BNF has been linked to activation of the Ah receptor, this result indicates that induction of UGT1A1 might be an Ah receptor‐dependent event. Identification and Genotyping of UGT1A Locus and Amplification of UGT1A1 Regulatory Fragments from a BAC Clone Characterization of the UGT1A genomic cluster revealed that the locus consists of multiple first exons encoding isoform‐specific sequences that are located at intervals of 3–15 kb apart and followed by a single set of common exons (exon 2, 3, 4, and 5) encoding the sequence that is identical in all UGT1A proteins (Gong et al., 2001). The expression of each enzyme is regulated independently by splicing of the first exon to the common exons. An 11‐kb region of the UGT1A1 promoter is amplified by PCR from a BAC clone encoding the UGT1A locus with primers corresponding to sites on the promoter sequence, as published in NCBI GenBank accession number AF297093 (Gong et al., 2001). The transcription start site is designated as þ1. The PCR products for the 3712/7 UGT1A1 promoter

82

phase ii conjugation enzymes and transport systems

[5]

FIG. 3. Protein analysis of UGT1A1 and CYP1A1. Microsomal fractions were collected from HepG2 cells treated with DMSO (D), 10 nM TCDD, or 20 M BNF for 48 and 72 h. Western blots were performed using 10 g protein and blotted using anti‐UGT1A1 or anti‐ CYP1A1 antibodies.

and individual enhancer sequences containing bases 10998/8134 (enhancer 1, E1), 8533/4738 (enhancer 2, E2), and 3712/2081 (enhancer 3, E3) are amplified using primers with sequences as follows: UGT1A1 promoter, 50 ‐tttaggagctcTCAGACAAAAGGAA‐30 and 50 ‐tcctgctcgagGTTCGCCCTCTCCT‐30 ; E1, 50 ‐atatggagctcAAAGAAGAG0 0 AACT‐3 and 5 ‐atctactcgaGGGAATGATCCTTT‐30 ; E2, 50 ‐atattgagctc TTGCTTGCTGC‐30 and 50 ‐aatttctcgagACCATGGCTGGTT‐30 ; and E3, 50 ‐tttaggagctcTCAGACAAAAGGAA‐30 and 50 ‐ttacactcgagAACCACTACTAAGC‐30 . The restriction enzyme sites SacI and XhoI are incorporated at the 50 end of sense and antisense primers (lower‐case), respectively, and PCR products are subcloned into the SacI/XhoI‐digested pGL3 vector. Transient Transfections with Reporter Constructs for Promoter Function Assay To determine the ability of the 50 ‐flanking region of the UGT1A1 gene to confer transcriptional activity in response to TCDD, luciferase reporter constructs containing promoter or enhancer sequences of UGT1A1 are transiently transfected into HepG2 cells, and the expression of luciferase activity is determined after treatment of cells for 48 h with TCDD, BNF, or DMSO. 1. Cells are seeded in a 24‐well plate (2
105 cells/well) and grown to 70% confluency by the following day. 2. DNA and Lipofectamine 2000 (Invitrogen) are diluted separately with OptiMEM (Invitrogen). Luciferase DNA constructs (100 ng) are combined with 50 ng pRL‐TK (internal control) and diluted with OptiMEM (50 l).

[5]

role of Ah

RECEPTOR IN

UGT1A1

83

FIG. 4. Promoter activity of UGT1A1 in response to TCDD and BNF by luciferase reporter assay. Four DNA fragments that cover the entire UGT1A1 promoter and enhancer (11 kb) were cloned from a BAC library and subcloned into the pGL3 reporter plasmid. HepG2 cells were transiently transfected with the reporter plasmids, and firefly luciferase activity was measured in the cytosolic fraction after 48 h of treatment. Values were normalized to renilla luciferase activity and shown as fold over DMSO treatment.

3. Lipofectamine 2000 (2 l) is diluted with 50 l OptiMEM and added to the DNA mixture. The DNA–Lipofectamine complex is incubated for 30 min at room temperature. 4. Medium containing FBS is removed from cells prior to transfection. HepG2 cells are transfected by adding 100 l OptiMEM and 100 l DNA–Lipofectamine complex to each well. 5. After overnight incubation, transfection medium is removed. Transfected HepG2 cells are treated with chemical inducers or DMSO for 48 h. 6. Cells are harvested with 1
permissive lysis buffer (Promega), and the supernatant is collected by brief centrifugation. 7. Promoter activity is determined by expression of firefly luciferase and is normalized to the renilla luciferase levels by using a dual luciferase reporter assay (Promega). The UGT1A1 3712/7 promoter‐luciferase fragment is induced after treatment with TCDD and BNF (Fig. 4). An enhancer sequence from 3712 to 2081 (E3) relative to the transcriptional start site is also responsive. Enhancer sequences E2 and E1, which cover the region from 10998 to 4738, are refractory to both TCDD and BNF. Generation of UGT1A1‐Luciferase MH1A1L Cells 1. The neomycin gene is subcloned into the SalI site of the 3712/7 UGT1A1 promoter‐pGL3 basic vector to generate the pLUGT1A1neo plasmid (Postlind et al., 1993; Yueh et al., 2003).

84

phase ii conjugation enzymes and transport systems

[5]

2. HepG2 cells are trypsinized, and 5
106 cells are seeded in P150 plates 1 day before transfection. 3. The pLUGT1A1neo plasmid is transfected into HepG2 cells using Lipofectamine 2000 according to the manufacturer’s instruction. 4. After 48 h, neomycin (800 g/ml) selection is initiated. 5. Stable transformants are obtained at approximately 3 weeks after neomycin selection. Positive transformants containing pLUGT1A1 are chosen by detecting luciferase activity. Previously, HepG2 cells were stably integrated with the CYP1A1 promoter that contains multiple xenobiotic response elements (XREs) to create TV101 cells that have been utilized as a convenient in vitro biomarker for detecting Ah receptor ligands (Allen et al., 2001). TCDD and BNF are capable of inducing CYP1A1‐luciferase in TV101 cells as shown in Fig. 5A indicating their ability to activate the Ah receptor. Induction of the UGT1A1 3712/7 promoter‐luciferase construct with TCDD indicates that transcriptional activation may occur through an Ah receptor‐dependent mechanism. MH1A1L cells carrying the UGT1A1 promoter‐luciferase demonstrate that classic PAHs are capable of inducing UGT1A1 promoter‐driven luciferase (Fig. 5B). Along with TCDD induction, B[a]P metabolites including the 1‐, 2‐, 3‐, 4‐, 6‐, 8‐, 9‐, and 10‐hydroxylated B[a]P isomers and B[a]P cis‐ and trans‐4,5‐dihydrodiol increase luciferase activity two‐ to fivefold. The 3‐ and 9‐hydroxy B[a]P and trans‐4,5‐dihydrodiol B[a]P serve as the most efficient inducers. UGT1A1 reporter gene assays with PAHs further suggest that these agents might elicit transcriptional activation of UGT1A1 through an Ah receptor‐ dependent pathway. Localization of cis‐Acting Response Element by 50 /30 Deletion Analysis and Site‐Directed Mutation Assay To localize the region on the UGT1A1 gene that controls TCDD‐ and BNF‐mediated induction, an additional series of expression plasmids, E4 (3529/3143), E5 (3430/3285), and E6 (3430/3337) are generated by progressive truncation of the UGT1A1 3712/2081 fragment. The sequences of the primers used for these enhancers are as follow: E4, 50 ‐ tccttgagctcTTTTTGACACTGGA‐30 and 50 ‐aaattctcgagCTCATTCCTCCTCT‐30 ; E5, 50 ‐aaagggagctcTAACGGTTCATAAA‐30 and 50 ‐aaattctcgag CTTACTATGACTG‐30 ; and E6, 50 ‐aaagggagctcTAACGGTTCATAAA‐ 30 and 50 ‐aatggctcgagGTTATGTAACTAGA‐30 . Each of these amplified inserts is digested with SacI and XhoI and subcloned into the SacI/XhoI‐ digested pGL3‐promoter vector. Each plasmid is transiently transfected

[5]

role of Ah

RECEPTOR IN

UGT1A1

85

FIG. 5. Induction of CYP1A1‐and UGT1A1‐luciferase in stably transfected HepG2 cells. (A) The CYP1A1 promoter luciferase plasmid that contains multiple XREs was used to establish TV101 cells. Luciferase activity was measured at various times after treatments. Activity is expressed as relative light units (RLU)/g of protein. (B) HepG2 cells were stably transfected with a 3.7‐kb UGT1A1 promoter luciferase plasmid to generate the MH1A1L cell line. Treatment of cells was carried out for 48 h with 5 M of each B[a]P metabolite. Luciferase activity is expressed as RLU/g of protein.

86

phase ii conjugation enzymes and transport systems

[5]

into HepG2 cells, and expression of luciferase activity is determined after treatment of transfected cells for 48 h. Mutational analysis on the E4 clone demonstrates that a sharp drop in induction is observed between bases 3337 and 3285 (Fig. 6A). Sequence analysis in this region reveals the presence of a single copy of the Ah receptor XRE motif (CACGCA) starting at position 3309. Using DNA fragments spanning 3529 to 3143, site‐directed mutagenesis is carried out on the conserved UGT1A1 XRE sequence, altering CACGCA to ACCGCA. The reporter plasmid containing either wild type or the mutated UGT1A1‐XRE is inserted into the pGL3‐promoter vector and used in transient transfections. CA to AC mutation within the XRE results in a lack of TCDD‐dependent induction of transcriptional activity (Fig. 6B), confirming a role for the Ah receptor in control and expression of UGT1A1.

FIG. 6. Identification of a TCDD‐responsive region in the UGT1A1 promoter. (A) Using plasmid E3 as a DNA template, E4, E5, and E6 were generated by progressive truncation of the 50 and 30 ends. Transient transfections were conducted with these truncated plasmids, and promoter responsiveness to 48 h treatment with TCDD was determined by luciferase expression. (B) The core sequence of the XRE, CACGCA, was mutated to ACCGCA by site‐directional mutagenesis PCR. The luciferase reporter plasmid containing either wild‐type or mutated UGT1A1‐XRE was transiently transfected into HepG2 cells. Cells were treated for 48 h with 10 nM TCDD and 20 M BNF. Results shown are fold activity over DMSO.

[5]

role of Ah

RECEPTOR IN

UGT1A1

87

Analysis of Ah Receptor/Arnt Binding to UGT1A1 XRE Sequence by Electrophoretic Mobility‐Shift Assay (EMSA) and Antibody Competition Assay EMSA is used to analyze TCDD‐inducible protein–DNA interactions to confirm that the UGT1A1 CACGCA motif is a binding site for the Ah receptor. In addition, to determine whether the induced nuclear proteins are the Ah receptor/Arnt complex, binding reactions are carried out in the presence of antibodies generated against the human Ah receptor (Anti‐ AhR) or Arnt (Anti‐Arnt). 1. HepG2 cells are treated with TCDD or DMSO for 24 h. Nuclear extracts from HepG2 cells are isolated as outlined (Chen and Tukey, 1996). 2. Cells are washed twice with 10 mM HEPES buffer, pH 7.5, collected by scraping into MDH buffer [3 mM MgCl2, 1 mM dithiothreitol (DTT), 25 mM HEPES, pH 7.5, 10 g/ml aprotinin, 10 g/ml leupeptin, 0.2 mM PMSF] and homogenized. 3. The homogenates are centrifuged at 5000g for 5 min, and the pellet is washed with MDHK buffer (3 mM MgCl2, 1 mM DTT, 25 mM HEPES, pH 7.5, 0.1 M KCl, 10 g/ml aprotinin, 10 g/ml leupeptin, 0.2 mM PMSF). This procedure is repeated three times. 4. The cell pellet is then lysed in HDK buffer (25 mM HEPES, pH 7.5, 1 mM DTT, 0.4 M KCl, 10 g/ml aprotinin, 10 g/ml leupeptin, 0.2 mM PMSF) and centrifuged at 105,000g for 60 min, and the supernatant is designated as the nuclear extract. 5. A complementary pair of oligonucleotides containing the consensus core sequence of the UGT1A1 XRE (underlined) is synthesized (50 ‐GCT AGGCACTTGGTAAGCACGCAATGAACATGCA‐30 and 50 ‐GCTA TGACTGTTCATTGCGTGCTTACCAAGTGCC‐30 ). In addition, the human CYP1A1 XRE oligonucleotides (50 ‐GATCCGGCTCTTGTCAC GCAACTCCGAGCTCA‐30 and 50 ‐GATCTGAGCTCGGAGTGCGTGAGAAGAGCCG‐30 ) are used as described previously (Chen and Tukey, 1996). 6. Double‐stranded oligonucleotides are assembled by annealing at 80 equal concentrations of the sense and antisense XRE strands in a total of 20 l sterile water. Double‐stranded oligonucleotides are labeled for 20 min at room temperature in a 20‐l reaction containing 2l double‐stranded oligonucleotides, 25 M dATP, 25 M dGTP, 25 M dTTP, 5 l 10 mCi/ml [ ‐32P]dCTP, and 1 l Klenow fragment. The reaction is terminated by the addition of NaCl, and double‐stranded oligonucleotides are purified using the Qiagen nucleotide removal kit. The activity of double‐stranded oligonucleotides is determined by liquid scintillation counting.

88

phase ii conjugation enzymes and transport systems

[5]

FIG. 7. Confirmation of Ah receptor/Arnt‐binding complex on UGT1A1 XRE. HepG2 cells were treated for 24 h with DMSO or TCDD, and nuclear extracts were collected (DMSO‐NP, TCDD‐NP). Ten micrograms of protein was used in binding reactions with ‐32P‐dCTP‐labeled oligonucleotides. Specificity of binding was confirmed using 200‐fold excess unlabeled probe. One hundred nanograms of antibodies against the Ah receptor and Arnt was used for competition experiments.

7. Binding assays containing HEDG (25 mM HEPES, pH 7.5, 1.5 mM EDTA, 1 mM DTT, 10% glycerol), 10 g of nuclear extract, 2 g of poly dI‐dC), and 1 g of salmon sperm DNA in a final reaction volume of 20–25 l are carried out on ice for 15 min. The binding reaction is further continued for 20 min at room temperature with the addition of 1
106 cpm of labeled oligonucleotide. 8. Competition assays are performed by adding a 200‐fold excess of unlabeled CYP1A1 XRE or UGT1A1 XRE oligonucleotide to the binding reaction.

[5]

role of Ah

RECEPTOR IN

UGT1A1

89

9. The specificity of the Ah receptor/Arnt complex binding is examined by adding 100 ng of anti‐Ah receptor or anti‐Arnt antibody (a generous gift from Christopher Bradfield) to the binding reaction. 10. Protein–DNA complexes are separated on a 6% nondenaturing polyacrylamide gel for ~2 h at 180 V using 45 mM Tris‐borate, 10 mM EDTA (1
TBE) as running buffer. 11. The gels are separated from glass plates, rinsed with 1
TBE, placed on a stack of Whatman paper, wrapped in plastic wrap, and exposed to a phosphorimager plate for 2 h. Protein–DNA complexes are visualized by a Molecular Dynamics Storm 840 phosphorimager. When a nuclear extract prepared from TCDD‐treated HepG2 cells is incubated with a 32P‐labeled UGT1A1‐XRE probe, an induced DNA– protein complex is detected (Fig. 7). Excess unlabeled UGT1A1‐XRE competes efficiently for the labeled XRE, suggesting that TCDD induction of nuclear protein specifically binds to the UGT1A1‐XRE. Competition experiments with Ah receptor and Arnt antibodies confirmed involvement of the Ah receptor/Arnt complex. Control experiments with CYP1A1‐ XRE as a probe show similar results to that of the UGT1A1‐XRE, further confirming the presence of a classically functional XRE in the UGT1A1 promoter.

Summary

Several recent findings confirm that UGTs are capable of undergoing differential regulation by environmental influences, resulting in an enhanced glucuronidation capacity. In primary human hepatocytes, treatments with phenobarbital, oltipraz, and 3‐methylcholanthrene led to the induction of UGT1A1 mRNA and protein (Ritter et al., 1999). In addition, exposure of HepG2 and Caco‐2 cells to flavonoids induces UGT1A1 (Galijatovic et al., 2001; Walle and Walle, 2002; Walle et al., 2000). The UGT1A1 gene has been shown to be inducible by the nuclear receptors PXR and the CAR. This chapter described the procedures, reagents, and DNA constructs used to characterize Ah receptor‐mediated UGT1A1 induction. The UGT1A locus was first characterized by screening a human BAC library. DNA constructs covering the entire enhancer and promoter segments that were amplified and established in a luciferase reporter gene were analyzed in transient transfection assays in the presence or absence of inducers. Results identified the 3712/7 promoter‐luciferase construct as inducible with TCDD and BNF treatments. A series of deletion mutants then generated from the original reporter construct confirmed that region–3529/–3142 of the UGT1A1 gene is essential for

90

phase ii conjugation enzymes and transport systems

[5]

TCDD‐induced luciferase activity. Nucleotide sequence analysis revealed axenobiotic response element core sequence CACGCA starting at position 3309. When the XRE core sequence was deleted or mutated, inducibility with the Ah receptor ligand was lost, suggesting that the XRE exists as a functional response element. EMSA and competition experiments with Ah receptor and Arnt antibodies demonstrated that the TCDD‐activated nuclear protein specifically binds the UGT1A1‐XRE and that the Ah receptor/Arnt complex is responsible for this increase in binding. HepG2 cells exposed to TCDD and BNF induce CYP1A1 as shown by Western blot analysis. Reporter assay of a CYP1A1‐luciferase promoter, as well as EMSA assay with the CYP1A1 XRE as a probe, confirmed this induction. These control experiments suggest that the Ah receptor is functional in these cells and that Ah receptor ligands may regulate UGT1A1 in a manner comparable with CYP1A1. Combined, these experiments reveal that the Ah receptor is involved in human UGT1A1 induction. References Allen, S. W., Mueller, L., Williams, S. N., Quattrochi, L. C., and Raucy, J. (2001). The use of a high‐volume screening procedure to assess the effects of dietary flavonoids on human Cyp1a1 expression. Drug Metab. Disp. 29, 1074–1079. Bansal, S. K., and Gessner, T. (1980). A unified method for the assay of uridine diphosphoglucuronyltransferase activities toward various aglycones using uridine diphospho[U‐14C]glucuronic acid. Anal. Biochem. 109, 321–329. Bock, K. W., Gschaidmeier, H., Heel, H., Lehmkoster, T., Munzel, P. A., and Bock‐Hennig, B. S. (1999). Functions and transcriptional regulation of PAH‐inducible human UDP‐ glucuronosyltransferases. Drug Metab. Rev. 31, 411–422. Chen, Y.‐H., and Tukey, R. H. (1996). Protein kinase C modulates regulation of the CYP1A1 gene by the Ah receptor. J. Biol. Chem. 271, 26261–26266. Emi, Y., Ikushiro, S., and Iyanagi, T. (1996). Xenobiotic responsive element‐mediated transcriptional activation in the UDP‐glucuronosyltransferase family 1 gene complex. J. Biol. Chem. 271, 3952–3958. Galijatovic, A., Otake, Y., Walle, U. K., and Walle, T. (2001). Induction of UDP‐ glucuronosyltransferase UGT1A1 by the flavonoid chrysin in Caco‐2 cells: Potential role in carcinogen bioinactivation. Pharm. Res. 18, 374–379. Gong, Q. H., Cho, J. W., Huang, T., Potter, C., Gholami, N., Basu, N. K., Kubota, S., Carvalho, S., Pennington, M. W., Owens, I. S., and Popescu, N. C. (2001). Thirteen UDPglucuronosyltransferase genes are encoded at the human UGT1 gene complex locus. Pharmacogenetics 11, 357–368. Kazlauskas, A., Poellinger, L., and Pongratz, I. (2000). The immunophilin‐like protein XAP2 regulates ubiquitination and subcellular localization of the dioxin receptor. J. Biol. Chem. 275, 41317–41324. Kessler, F. K., and Ritter, J. K. (1997). Induction of a rat liver benzo[a]pyrene‐trans‐7, 8‐dihydrodiol glucuronidating activity by oltipraz and beta‐naphthoflavone. Carcinogenesis 18, 107–114.

[5]

role of Ah

RECEPTOR IN

UGT1A1

91

Malik, N., and Owens, I. S. (1981). Genetic regulation of bilirubin‐UDP‐glucuronosyltransferase induction by polycyclic aromatic compounds and phenobarbital in mice association with aryl hydrocarbon (benzo[a]pyrene) hydroxylase induction. J. Biol. Chem. 256, 9599–9604. Nebert, D. W., Roe, A. L., Dieter, M. Z., Solis, W. A., Yang, Y., and Dalton, T. P. (2000). Role of the aromatic hydrocarbon receptor and [Ah] gene battery in the oxidative stress response, cell cycle control, and apoptosis. Biochem. Pharmacol. 59, 65–85. Postlind, H., Vu, T. P., Tukey, R. H., and Quattrochi, L. C. (1993). Response of human CYP1‐ luciferase plasmids to 2,3,7,8‐tetrachlorodibenzo‐p‐dioxin and polycyclic aromatic hydrocarbons. Toxicol. Appl. Pharmacol. 118, 255–262. Ritter, J. K., Kessler, F. K., Thompson, E. T., Grove, A. D., Auyeung, D. J., and Fisher, R. A. (1999). Expression and inducibility of the human bilirubin UDP‐glucuronosyltransferase UGTLA1 in liver and cultured primary hepatocytes: Evidence for both genetic and environmental influences. Hepatology 30, 476–484. Soucek, P., Martin, M. V., Ueng, Y., and Guengerich, F. P. (1995). Identification of a common cytochrome P450 epitope near the conserved heme‐binding peptide with antibodies raised against recombinant cytochrome P450 family 2 proteins. Biochemistry 34, 16013–16021. Tukey, R. H., and Strassburg, C. P. (2000). Human UDP‐glucuronosyltransferases: Metabolism, expression, and disease. Annu. Rev. Pharmacol. Toxicol. 581–618. Walle, T., Otake, Y., Galijatovic, A., Ritter, J. K., and Walle, U. K. (2000). Induction of UDP‐ glucuronosyltransferase UGT1A1 by the flavonoid chrysin in the human hepatoma cell line Hep G2. Drug Metab. Disp. 28, 1077–1082. Walle, U. K., and Walle, T. (2002). Induction of human UDP‐glucuronosyltransferase UGT1A1 by flavonoids: Structural requirements. Drug Metab. Disp. 30, 564–569. Waxman, D. J. (1999). P450 Gene induction by structurally diverse xenochemicals: Central role of nuclear receptors CAR, PXR, and PPAR. Arch. Biochem. Biophys. 369, 11–23. Yueh, M. F., Huang, Y. H., Hiller, A., Chen, S. J., Nguyen, N., and Tukey, R. H. (2003). Involvement of the xenobiotic response element (XRE) in Ah receptor‐mediated induction of human UDP‐glucuronosyltransferase 1A1. J. Biol. Chem. 278, 15001–15006.