The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins

STOTEN-21621; No of Pages 8 Science of the Total Environment xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv

The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins Noé Ferreira-Rodríguez a,b,⁎, Ignacio Fernández c,⁎⁎, Simone Varandas d, Rui Cortes d, M. Leonor Cancela c,e, Isabel Pardo a,b a

Departamento de Ecología y Biología Animal, Facultad de Biología, Campus As Lagoas – Marcosende, Universidad de Vigo, 36310 Vigo, Spain ECIMAT - Estación de Ciencias Mariñas de Toralla, Illa de Toralla, 36331 Vigo, Spain Centre of Marine Sciences (CCMAR), University of Algarve, Campus of Gambelas, 8005-139 Faro, Portugal d Centre for Research and Technology of Agro-Environmental and Biological Sciences, University of Trás-os-Montes and Alto Douro, 5001-801 Vila Real, Portugal e Department of Biomedical Sciences and Medicine, University of Algarve, 8005-139 Faro, Portugal b c

H I G H L I G H T S

G R A P H I C A L

A B S T R A C T

• C. fluminea's is found in a wide range of environmental Ca2 + concentration. • Ca2 + concentration in clam's soft body depend on its environmental concentration. • Low Ca2 + concentrations might induce oxidative stress conditions in C. fluminea. • Low environmental Ca2 + concentrations decreased growth rate of C. fluminea. • Environmental Ca 2 + concentration might affect invasive success of C. fluminea.

a r t i c l e

i n f o

Article history: Received 1 October 2016 Received in revised form 14 December 2016 Accepted 14 December 2016 Available online xxxx Editor: D. Barcelo Keywords: Alien species Calcium Corbicula fluminea Gene expression Growth rate Invasiveness

a b s t r a c t The natural variation of environmental factors in freshwater basins determines their biodiversity. Among them, calcium is a key physiological compound for freshwater invertebrates. It is required for shell formation, muscle contraction, it mediates gene expression and allows counteracting acidosis during stress periods, among other functions. Although the distribution of different freshwater species has been suggested to be linked with the environmental calcium concentration, as yet, no research studies have confirmed this. Identifying whether environmental calcium concentrations might determine the invasion success of alien species would be critical in developing and implementing effective management strategies to control them. Here, a multidisciplinary approach integrating field surveys, analytical chemistry techniques, molecular biology analyses and a lab-scale experiment was taken to decipher whether the environmental calcium concentration might hamper the establishment of Corbicula fluminea in northwestern Iberian rivers. A Principal Component Analysis on water chemistry variables from 13 water bodies identified environmental calcium concentration, among others, as one key factor that best characterized the distribution area of C. fluminea. The calcium content in animals' bodies from two representative rivers was dependent on the environmental calcium concentration of freshwater basins; the lower the concentration, the lower the body's content. The expression of stress- and calcium homeostasis-related genes was higher in C. fluminea from low calcium concentration environments than in those from calcium-

⁎ Correspondence to: N. Ferreira-Rodríguez, Departamento de Ecología y Biología Animal, Facultad de Biología, Campus As Lagoas, Marcosende, Universidad de Vigo, Vigo 36310, Spain. ⁎⁎ Correspondence to: I. Fernández, Centre of Marine Sciences (CCMAR), University of Algarve, Campus of Gambelas, 8005-139 Faro, Portugal. E-mail addresses: [email protected], [email protected] (N. Ferreira-Rodríguez), [email protected], [email protected] (I. Fernández).

http://dx.doi.org/10.1016/j.scitotenv.2016.12.100 0048-9697/© 2016 Published by Elsevier B.V.

Please cite this article as: Ferreira-Rodríguez, N., et al., The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.12.100

2

N. Ferreira-Rodríguez et al. / Science of the Total Environment xxx (2016) xxx–xxx

rich freshwater basins. Finally, under experimental conditions, lower water calcium concentrations decreased C. fluminea growth rates. The present data suggest, for the first time, that environmental calcium concentration may act as a determinant factor on the invasion success of C. fluminea in freshwater environments. Our results provide new clues for the identification of basins with increased risk of potential invasion by C. fluminea based on environmental calcium levels. © 2016 Published by Elsevier B.V.

1. Introduction From terrestrial environments to aquatic ecosystems, alien species are one of the major drivers of biodiversity loss worldwide (Gurevitch and Padilla, 2004). Therefore, predicting the probability of their successful establishment and dispersal is a fundamental tool for biodiversity conservation, native species protection and alien species invasion risk assessment (Mooney and Cleland, 2001; Ficetola et al., 2007). In this regard, knowledge of the biological traits of invasive species and the natural environmental barriers controlling their distribution could lead to the identification of their weaknesses and enable effective management strategies to be developed and implemented (Hulme, 2009). The Asian clam Corbicula fluminea (Müller, 1744) is among the most “efficient” freshwater invaders worldwide (Araujo et al., 1993). It is well known that the invasion success and subsequent dispersion of C. fluminea, and other invasive freshwater mussels such as the zebra mussel (Dreissena polymorpha (Pallas, 1771)), partially rely on their natural biological characteristics (McMahon, 2002; Sousa et al., 2008). Nevertheless, particular environmental factors favor or constrain the survival, distribution and establishment of these species. Several studies conducted in the Northern and Central Iberian Peninsula have related the potential invasiveness of C. fluminea to a variety of environmental conditions (Vidal et al., 2002; Sousa et al., 2006, 2008; Ferreira-Rodríguez and Pardo, 2014). Particularly, C. fluminea survival has been shown to be affected by temperature, food, turbidity, salinity and/or dissolved oxygen conditions (McMahon, 1979; Clarke, 1999; Müller and Baur, 2011; Avelar et al., 2014; Ferreira-Rodríguez and Pardo, 2016). Studies on the survival, growth and dispersion rates of C. fluminea under different levels of a number of environmental factors such as nitrites, nitrates, ammonium, pH and/or calcium (Ca2+) concentration, among others, are scarce or geographically restricted. Thus, uncovering whether the physiology of C. fluminea might be affected by those environmental factors and understanding their underlying mechanisms might open new avenues for pest monitoring, control and invasion risk assessment. The Iberian Peninsula has a complex geology that affects the biogeochemistry of its waters (Sabater et al., 2009). Its rivers vary greatly in environmental factors, but particularly in Ca2+ content (Armengol et al., 1991); runoff (the major source of Ca2+) being responsible for such differences in average water Ca2+ concentration (Araujo et al., 1993). In general, Ca2+ concentration in bivalves (and other organisms) depends on its concentration in the water column (concentration factor concept; De Bortoli et al., 1968). Molluscs depend on Ca2+ concentration for shell formation (Machado and Lopes-Lima, 2011) as well as other biological processes such as muscle contraction (Pekkarinen, 1997) and cell differentiation (Plattner and Verkhratsky, 2015). Moreover, Ca2+ has been largely related to oxidative stress (reviewed in Hidalgo and Donoso, 2008). Therefore, the environmental concentration of Ca2+ might impact the physiological stage of freshwater mussels not only at cellular levels but also at molecular levels. Interestingly, Ca2 + concentration has been linked with the distribution of different freshwater crustacean species (Carlsson, 2000; Rukke, 2002), and particularly to risk assessment of D. polymorpha (Whittier et al., 2008). Nevertheless, no previous research work has specifically evaluated the impact of environmental Ca2+ concentrations on growth in alien freshwater bivalves. Invasive species monitoring and potential control measures are based on different experimental and field sampling studies. While

niche-based models (NBMs) are increasingly used to predict the biological distribution of species (Gama et al., 2016), field surveys are largely used as effective monitoring, early detection, data collection and feeding sources for those predictive models. Although both approaches enable the identification of potential key environmental factors in alien species invasiveness, lab scale experiments are needed to confirm these predictions. Furthermore, unveiling the potential underlying mechanisms by which the physiology of alien species might be hampered under a particular environmental factor, might provide new clues to their potential for invading new environments. For instance, the study of the different transcriptomic responses to heat stress provided new clues for the outcompetitive performance of Mytilus galloprovincialis Lamarck, 1819 (a successful invader on the coasts of California) over its native congener Mytilus trossulus Gould, 1850 in marine ecosystems (Lockwood et al., 2010). Furthermore, this kind of approach will provide suitable biomarkers for the assessment of the physiological state of species. In this sense, heat shock proteins (Hsp) synthesis, activity and/or gene expression level, particularly that of Hsp70, have been used as a nonspecific biomarker of stress in different species (Lewis et al., 1999). Other examples could be glutathione S-transferase (Gst), a well established biomarker for oxidative stress in aquatic animals due to its antioxidant role against reactive oxygen species (ROS) (reviewed in Hellou et al., 2012); glutathione peroxidase (Gpx) as a hallmark of Ca2+ exposure (Tsuzi et al., 2004); or calmodulin (Cam) and the endoplasmic reticulum (ER) luminal Ca2+-buffering chaperone calreticulin (Calret), two accurate sensor proteins of Ca2 + levels (Marshall et al., 2015; Michalak et al., 2009). Here, a multidisciplinary and integrative approach was used to decipher whether environmental calcium concentration might hamper C. fluminea establishment. Field surveys provided data on C. fluminea distribution and density as well as biological material for the in situ Ca2+ content assessment, molecular biology analyses and to run lab-scale experiments. In this work, the possibility that C. fluminea distribution was related to environmental calcium concentrations in freshwaters was hypothesized; while potential signaling pathways by which low environmental Ca2 + concentrations may hamper C. fluminea's physiology potentially limiting its invasive success - were evaluated. Finally, a labscale experiment was run to test how environmental Ca2+ concentrations might affect the growth rate of C. fluminea individuals of different sizes. This paper provides valuable information regarding (i) the impact of Ca2 + concentration in freshwaters on the invasive success of C. fluminea in the northwestern Iberian Peninsula and (ii) the identification river basins most susceptible to being invaded based on environmental Ca2+ concentration.

2. Material and methods 2.1. Study area Based on our previous (non-published) knowledge and data on C. fluminea distribution and environmental factors in the biogeographic Atlantic region of the Iberian Peninsula, a total of twenty-three sites in eleven rivers and two lagoons located between the River Ulla (Galicia, Spain) and the River Mira (Central Portugal) were sampled once during spring 2014 or 2015 (Fig. 1).

Please cite this article as: Ferreira-Rodríguez, N., et al., The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.12.100

N. Ferreira-Rodríguez et al. / Science of the Total Environment xxx (2016) xxx–xxx

3

2.2. Field sampling

2.3. Calcium content and gene expression

Data were collected following invertebrate sampling protocols (Pardo et al., 2010). C. fluminea was sampled with a kick-net (1 mm mesh size), and each sample was composed of twenty sub-samples. The sub-samples were distributed proportionally to the area occupied by the most representative habitats and defined by an area of 0.5 m × 0.25 m (total area for 20 kick samples of 2.5 m2) in a fixed river stretch length (100 m). Samples were immediately fixed with formalin (4%), and transported to the Limnology laboratory of the University of Vigo, where they were counted and measured on the anteroposterior axis with a digital caliper. Water temperature, electrical conductivity, dissolved oxygen and salinity were measured in situ with portable meters. Temperature and oxygen were measured with a YSI 556 MPS oxygen meter, conductivity and salinity with an Orion Model 115 at 25 °C. To analyze water composition, water samples were collected in triplicate into polyethylene bottles. For environmental calcium analysis, water samples were acidified by adding ultra-pure nitric acid (5 mg L− 1) to obtain a pH b2 to minimize adsorption and precipitation. For nutrient analysis, water samples were immediately frozen in the facilities of a motorhome. Samples were externally analyzed for nutrients and calcium at the Scientific and Technological Research Assistance Centre (CACTI, University of Vigo; http://cactiweb.webs.uvigo.es/ 3 Joomla/index.php). Phosphate [P-PO− μg L − 1 ], nitrate [N-NO − 4 3 −1 −1 −1 − μg L ], nitrite [N-NO2 μg L ] and ammonia [N-NH+ ] were 4 μg L analyzed following the specific ISO standard methods for water samples by means of a continuous-flow analyzer (Auto-Analyzer 3, Bran + Luebbe, Germany). Inductively coupled plasma optical emission spectrometry (ICP-OES) was used for the analysis of environmental Ca2 + concentration.

The River Ferro was sampled as representative of freshwater basins with high Ca2+ content, while the River Miño was sampled as the correspondent for low content. Data on calcium concentration per each water body are shown in Table S1. Samples of C. fluminea were taken on the same day to determine Ca2+ content in soft tissues and evaluate the expression of relevant Ca2+ and stress-related genes in clams from these two representative rivers. Five individuals were collected for Ca2+ content analysis in soft tissues and snap frozen in liquid nitrogen. Another 3 individuals were collected from each river, their soft tissues dissected, immersed in RNAlater® (Thermo Scientific) in a 2 ml tube and snap frozen for gene expression analysis. Samples were transported in liquid nitrogen to the CCMAR BioSkel lab, and stored at − 80 °C until analysis. For Ca2+ content analysis, all of the soft tissues were dissected from each animal and dried at 60 °C for three days. The dry weight (DW) for each individual was then recorded while dry matter was obtained after burning samples twice at 500 °C during two 7 h cycles. The ashes were dissolved in nitric acid 6 N and stored until Ca2+ analysis. A 1:2 dilution was finally prepared in 5% chloric acid and Ca2 + was measured by atomic emission spectrometry (Agilent 4200 MP-AES, Agilent Technologies). A calibration curve was run at the same time with the appropriate standards (from 0.25 to 10.0 ppm). Calcium content was evaluated at a wavelength of 393.366 nm and expressed as μg mg−1 DW. Total RNA was extracted from 3 C. fluminea individuals from each river using TRIzol reagent (Invitrogen®, San Diego, CA, USA) as specified by the manufacturer. RNA integrity was confirmed using the Experion Automated Electrophoresis system (Bio-Rad) and quantity was determined using a NanoDrop spectrophotometer (Thermo Scientific). Total RNA (1 μg) was subjected to RQ1 RNase-Free DNase (Promega)

Fig. 1. Map showing the location of sampled stations in this study. Sampling took place in 13 water bodies in the biogeographic Atlantic region in the Northwest of the Iberian Peninsula. Water chemistry variables, Corbicula fluminea density and average size are detailed for each sampling site in Table S1.

Please cite this article as: Ferreira-Rodríguez, N., et al., The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.12.100

4

N. Ferreira-Rodríguez et al. / Science of the Total Environment xxx (2016) xxx–xxx

treatment before being reverse-transcribed for 1 h at 37 °C using MMLV reverse transcriptase (Invitrogen), oligo-d(T) primer and RNase OUT (Invitrogen). All quantitative real-time PCR (qPCR) reactions were performed in triplicate using SsoFast EvaGreen Supermix (BioRad), 0.25 μM of isoform-specific primers (Table 1) and 1:10 dilution of reverse-transcribed RNA, in a CFX qRT-PCR Detection System (BioRad). PCR amplification was as follows: an initial denaturation step of 2 min at 95 °C and 45 cycles of amplification (5 s at 95 °C and 10 s at 60 °C). A final dissociation reaction (melting curve) was performed with the following steps: 95 °C for 15 s, 60 °C for 1 min, and 15 s at incremental temperatures of 0.5 °C until 95 °C. Efficiency of amplification was close to 100% for each pair of primers. Real time qPCR was performed for each gene following MIQE guidelines such as including a calibrator sample within each plate (Bustin et al., 2009). The relative gene expression ratio for each gene was based on PCR efficiency (E) and Ct of a sample compared with the reference sample (one sample from the River Ferro), and expressed in comparison with the reference gene, according to Pfaffl (2001). Relative gene expression was normalized using β-actin (B-act) as the reference gene.

− northwestern Iberian Peninsula. Nitrite (N-NO− 2 ), nitrate (N-NO3 ) and ammonia (N-NH− 4 ) were pooled as dissolved inorganic nitrogen (DIN) to reduce the complexity of second-tier variables to a more manageable number. Salinity was excluded from the analysis due to collinearity with conductivity. Data were log (Ca2+), square-root (DIN) or inverse of the square (conductivity and temperature) transformed to obtain normality and homoscedasticity of the data. Calcium content, gene expression and growth rate experiment - Normality and homogeneity of variance of data were previously tested using the Kolmogorov-Smirnov and Levenne tests, respectively. Differences in Ca2 + content and gene expression in C. fluminea from the Ferro and Miño rivers were evaluated using the Student's t-test. Differences in the C. fluminea growth rate at different Ca2+ concentrations were detected by one-way ANOVA. When significant differences were detected, the Tukey multiple-comparison test was used to detect differences among experimental groups within the same size class. Differences were considered significant when P b 0.05. All analyses were performed with SPSS v.20 or GraphPad Prims 5.0 (GraphPad Software, Inc.).

2.4. Growth experiment

3. Results

A total of 90 clams, 30 for each of three size classes (average size ± SE; Size 1: 6.47 ± 0.115 mm, Size 2: 15.599 ± 0.042 mm, Size 3: 24.962 ± 0.068 mm) were collected from the River Miño (41° 55′ 31.84″ N, 8° 46′37.93″ W, datum WGS 84) in February 2015. Individuals were pooled by size classes and randomly distributed in nine 30-litre aquariums (10 one-size specimens per aquarium) and each clam was considered a biological replicate. The aquariums were maintained with constant aeration and with a supply of freshwater microalgae (Raphidocelis subcapitata (Korshikov, 1953) Nygaard, Komárek, J. Kristiansen & O. M. Skulberg (10,000 cells·ml−1) every 48 h. The experiment tested C. fluminea growth using a two factor design with three size classes and three Ca2+ concentrations (average Ca2+ concentrations: 4.5, 39.5 and 74.19 mg L−1). The different concentrations were obtained by adding Ca2+ chloride dehydrate (CaCl2 ∗ 2H2O, EMSURE®). Experiments were done at 20 °C, representative of spring water temperatures in the study area (SAICA water quality networkStation N015; Miño-Sil River Basin Authority), under a 12 h:12 h light:dark photoperiod. The growth experiment lasted three months, 10% of the aquarium's volume being changed each week maintaining experimental Ca2+ concentrations. The growth rate was calculated as the difference between the initial and final measurements in the anterior-posterior axis divided by the months of exposure (3 months).

3.1. Environmental factor analysis

2.5. Data analysis Environmental factor analysis –Principal Components Analysis (PCA) was used to characterize the C. fluminea distribution area in the

The range of values of the water chemistry variables measured is shown in Supplementary Table 1 (Table S1). A wide range in conductivity, salinity, nitrites, nitrates, ammonia and Ca2+ was found, showing at least one order of magnitude difference between minimum and maximum values recorded. The PCA revealed that the distribution area of C. fluminea in the northwestern Iberian Peninsula was best characterized by two components. These components represented 61.29% of the variance (Fig. 2). The first component, representing 25.65% of the variance, consisted of the single indicator related to phosphorous concentration (P-PO−3 4 ). The second component, representing 35.64% of total variance, was related to dissolved inorganic nitrogen (DIN), dissolved oxygen, and calcium (Ca2+) concentration. 3.2. Calcium content in Corbicula fluminea at two representative rivers Five individuals showing a homogeneous size (10.65 ± 0.54 mm) and dry weight (25.18 ± 5.48 mg) were considered for calcium content analysis in order to avoid analysis bias due to size variation. Calcium content in whole C. fluminea soft tissues from the River Ferro (representative of sampled stations with a high environmental Ca2+ concentration) presented an average of 9.89 ± 3.9 μg Ca mg− 1 DW, while individuals from the River Miño (low environmental concentration) had a significantly lower average Ca2+ content (4.08 ± 1.52 μg Ca mg−1 DW; Student's t-test, t = 3.095, P = 0.021).

Table 1 Gene name, accession numbers (GenBank), primers and expected amplicon size used for relative quantification of gene expression in Corbicula fluminea from Ferro and Miño rivers. Gene name – abbreviation

Accession numbera

Component

5′ to 3′ nucleotide sequences

Expected amplicon size (bp)

Β-actin – B-act

EF446608 KC979064

Glutathione S-transferase – Gst

EF446610

Glutathione peroxidase A – Gpxa

KF218345

Calmodulin – Cam

KJ001783

CGCCATCCAGGCTGTGCTTTCA ATGGCGTGTGGAAGGGCGTA CAGGGCAACAGGACCACACC GCCTGCCACCGACGCTTATT GCCAGGTGCCGGTAGTGAAG TCTTTTCCTGCTTCATAGTTCTGGT GCCACAAAGGCTGGACGAAGG GCGGCATCTTTCTCATCAGGGT AAGCATTCCGTGTGTTTGAC ACCCTTCGTCCGTGAGTTTC TGAGAAGATTGATGACCCTGATGA TGGTTTCCACTCGCCCTTGT

123

Heat shock protein 70 – Hsp70

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Calreticulin – Calret a b

SRA062349

b

205 199 133 102 128

GenBank. Sequence reconstructed from Sequence Read Archive SRA062349 deposited in NCBI.

Please cite this article as: Ferreira-Rodríguez, N., et al., The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.12.100

N. Ferreira-Rodríguez et al. / Science of the Total Environment xxx (2016) xxx–xxx

5

Fig. 2. Principal Component Analysis (PCA) ordination plot of sampled water bodies (Table S1) with respect to physicochemical variables – temperature (Temp), conductivity (EC), dissolved oxygen concentration (DO), dissolved inorganic nitrogen (DIN), phosphates and calcium (Ca2+).

3.3. Gene expression of relevant calcium and stress-related genes in Corbicula fluminea at two representative rivers When the expression level of relevant Ca2+ and stress-related genes in C. fluminea individuals from the two sampled stations was compared, most of the genes analyzed showed statistical differences (Fig. 3; Student's t-test, P b 0.05). In particular, heat shock protein 70 (Hsp70) expression was higher in C. fluminea individuals from the River Miño than in those from the River Ferro (2.14 ± 0.41 vs 1.28 ± 0.24 folds, respectively; Student's t-test, t = 3.07, P = 0.037). Similarly, glutathione Stransferase (Gst) and Glutathione peroxidase A (Gpxa) were up-regulated in C. fluminea from the River Miño compared to that of the River Ferro (3.35 ± 0.77 vs 1.41 ± 0.36 folds, Student's t-test, t = 3.93, P = 0.017; and 1.46 ± 0.16 vs 1.09 ± 0.08 folds, Student's t-test, t = 3.469, P = 0.026; respectively). Finally, and regarding the analyzed genes of the calcium-related signaling pathway, expression levels of Calmodulin (Cam) were also found to be significantly higher in individuals from the River Miño than those from the River Ferro (2.91 ± 0.53 vs 1.41 ± 0.44 folds, respectively; Student's t-test, t = 3.721, P = 0.02). In contrast, and although higher average expression levels of Calreticulin (Calret) were found in clams from the River Miño compared to Ferro specimens (1.75 ± 0.37 vs 0.93 ± 0.58 folds, respectively), they were not statistically different (Student's t-test, t = 2.051, P = 0.109).

3.4. Growth experiment After three months maintenance of C. fluminea in experimental tanks, the average growth rates of clams ranged from − 0.092 to 0.634 mm month− 1, depending on the initial size (Fig. 4). While the highest growth rate (0.634 mm month− 1) occurred in the smallest clams (6.47 ± 0.115 mm), and particularly in those maintained at greatest Ca2 + concentration (74.19 mg L−1); a negative growth rate (− 0.092 mm month− 1) in the largest clams (24.962 ± 0.068 mm) kept at the lowest Ca2+ levels (4.5 mg L−1) was observed. Interestingly, significant differences the in growth rate were found in different C. fluminea size classes at different Ca2 + concentrations (Size class 1:

F2,29 = 30.175, P b 0.01; Size class 2: F2,25 = 4.426, P = 0.024). In particular, C. fluminea at size classes 1 and 2 maintained at the highest Ca2+ concentration showed higher a growth rate than those maintained at the lowest and intermediate Ca2+ concentrations. Moreover, such differences were more evident in C. fluminea clams from the largest size class (Size class 3: F2,27 = 30.104, P b 0.01). In this sense, individuals at a lower Ca2+ concentration showed a negative growth rate significantly different from those kept at intermediate and high Ca2+ concentrations. Moreover, the positive growth rate in C. fluminea maintained at intermediate Ca2 + concentration was significantly lower than in the case of C. fluminea kept at highest Ca2+ concentration. 4. Discussion In this study the influence of environmental factors over C. fluminea establishment was evaluated in rivers from the biogeographic Atlantic region in the northwestern Iberian Peninsula. A multidisciplinary approach with field data surveys, analytical chemistry techniques, transcriptomic evaluation of key biomarkers of stress and Ca2+ signaling pathways, and biometric growth under increasing levels of Ca2 +, provided strong evidence to consider environmental Ca2+ concentrations as a determining factor in the invasion success of C. fluminea in freshwater environments. Field survey data revealed that the distribution area of C. fluminea in the northwestern Iberian Peninsula is characterized by differences in several environmental factors such as nutrient concentration (phosphorous and nitrogen compounds), oxygen and Ca2 + concentrations. In particular, the influence of nutrient concentration in C. fluminea populations has been analyzed since the end of the twentieth century (Dauble et al., 1985; Foe and Knight, 1985). More recently, NH+ 4 has been related to C. fluminea physiology and mortality (Oliveira et al., 2015), although Costa and Guilhermino (2015) reported low sensitivity of C. fluminea to ammonia. Nevertheless, stress values (1 mg L−1) were higher than the concentrations found in our field study (b0.5 mg L− 1). Likewise, our field data reported mean oxygen concentrations of 9.7 mg L−1 (minimum values of 6.16 mg L−1), greater than those considered stressful for C. fluminea (b 1 mg L−1; Belanger, 1991). In contrast, very few

Please cite this article as: Ferreira-Rodríguez, N., et al., The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.12.100

6

N. Ferreira-Rodríguez et al. / Science of the Total Environment xxx (2016) xxx–xxx

Fig. 4. Average growth rate values (in mm month−1) ± standard deviation of Corbicula fluminea with different size classes during 3 months exposure under different calcium concentrations. Different letters at the top of the bars within each size class denote significant differences in growth when exposed to different calcium concentrations (ANOVA, P b 0.05; N = 10 per size class and concentration).

Fig. 3. Relative expression of relevant Ca2+ and stress-related genes in Corbicula fluminea specimens sampled at the Ferro and Miño rivers. Histogram bars represent mean relative gene expression values from each sampled station, while errors bars correspond to standard deviation values. Hsp70, heat shock protein 70; Gst, Glutathione S-transferase; Gpxa, Glutathione peroxidase A; Cam, Calmodulin; Calret, Calreticulin. Transcript levels were determined by qPCR from three biological replicates (with 3 technical replicates each) and normalized using the Β-actin (B-act) housekeeping gene. Levels in one of the biological replicates from the River Ferro were used as reference and set to 1. An asterisk denotes statistically significant differences among sampled groups (Student's ttest, P b 0.05; N = 3).

analyses have been carried out on the effect of environmental Ca2+ concentration on C. fluminea. Calcium is a key physiological compound in eukaryotes mediating gene expression, cell differentiation and trafficking, exocytosis, endocytosis, amoeboid movement and chemotaxis, ciliary and flagellar beat (Plattner and Verkhratsky, 2015). To obtain further insights into the hypothesis of Ca2+ being a key factor determining C. fluminea dispersion, specimens from two representative rivers (Miño and Ferro) of low and high environmental Ca2+ concentrations in the northwestern Iberian Peninsula were sampled. Ca2 + content in the soft bodies of C. fluminea was coherent with the low and high Ca2+ concentrations in water from both sampled stations, confirming the notion that Ca2+ concentrations in bivalves (and other organisms) depend on Ca2+ concentrations in the environmental water (De Bortoli et al., 1968). Moreover, since Ca2 + has been largely related to oxidative stress (reviewed in Hidalgo and Donoso, 2008), lower body Ca2 + concentration could imply a condition of stress in C. fluminea individuals from low Ca2+ concentration basins. Biomarker approaches have been largely used to assess the physiological condition of aquatic organisms under particular conditions, e.g. polluted versus clear environments (Cajaraville et al., 2000). In the present manuscript, this procedure was conducted to have some evidence on the physiological state of C. fluminea from rivers with high and low environmental Ca2+ concentrations. Hsp70 is known to assist misfolded proteins to regain their native states, protecting the proteome from stress, and recovering proteins from aggregates (Clerico et al., 2015) and its increase in expression has been interpreted as a protective mechanism in cells under stress (Ackerman et al., 2000). Present results with a higher gene expression of Hsp70 in C. fluminea from the River Miño might suggest that clams are under general stress. However, since Hsp70 synthesis can be triggered in response to several environmental and pathological stressors, it is considered as a nonspecific biomarker of stress (Lewis et al., 1999). Thus, the evaluation of other biomarkers provided further information about the occurrence of a specific stress condition in C. fluminea. The expression of Gst and Gpxa genes - biomarkers of oxidative stress condition (Hellou et al., 2012) - in C. fluminea from the River Miño was higher in comparison with that of individuals from the River Ferro, suggesting clams from the Miño could be under oxidative stress due to low Ca2+ concentration. In fact, exposure to different Ca2+ concentrations has been demonstrated to differentially regulate the transcription of Gpx gene (Tsuzi et al., 2004). A more specific set of biomarkers of Ca2+ homeostasis were evaluated to obtain further evidence on whether low/high environmental Ca2+ concentrations might have an impact on C. fluminea physiology. Calmodulin (Cam) is a multi-functional cytoplasmic Ca2+ sensor with a remarkable

Please cite this article as: Ferreira-Rodríguez, N., et al., The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.12.100

N. Ferreira-Rodríguez et al. / Science of the Total Environment xxx (2016) xxx–xxx

ability to interact with and regulate a plethora of structurally diverse target proteins (Marshall et al., 2015) and which might control the intake and secretion of Ca2+ ions (Friedberg and Rhoads, 2001; Ren et al., 2013). An up-regulation in C. fluminea when exposed to low environmental Ca2+ concentrations was reported. This result was in agreement with the up-regulation of Cam in specimens under low environmental Ca2 + concentrations to help maintain Ca2 + homeostasis (Ren et al., 2013). On the other hand, the ER (endoplasmic reticulum) luminal calcium-buffering chaperone calreticulin (Calret), a sensor protein responsive to a specific range of Ca2 + levels, involved in Ca2 +-dependent transcriptional pathways during embryonic development and in the folding of newly synthesized proteins and glycoproteins (Michalak et al., 2009), was not found to be differentially expressed in C. fluminea from both sampled stations. Few studies have been carried out on Calret in invertebrate species and contradictory results were reported when those organisms were exposed to osmotic stress. While relatively low osmotic stress promoted its transcription in the nematode Aphelenchoides besseyi Christie, 1942 (Feng et al., 2015) and in the crustacean Litopenaeus vannamei (Boone, 1931) (Gao et al., 2016); higher expression in gills has been detected when exposed to higher salinity conditions in the Japanese blue crab Portunus trituberculatus (Miers, 1876) (Lv et al., 2015). The overall biomarker approach applied in situ to C. fluminea from low and high environmental Ca2 + concentrations suggested that those specimens from the River Miño are under calcium-related oxidative stress at the molecular level. In fact, since the sampled stations were pollution free (Perraes in the Ferro River basin and Tui in the Miño River basin; Costa and Guilhermino, 2015), the biomarker evaluation results did not appear to be related to the presence of particular pollutants. Furthermore, although Gst activity has been related to the age of C. fluminea in Serbian rivers (Vrankovic, 2016), the use of similar sized (age) individuals in the biomarker approach also excluded this last hypothesis. Nevertheless, since differential Gst activity was found to be related to the increase of nutrients and ammonia concentrations in water, water temperature and conductivity when C. fluminea from 3 River Miño stations and one River Lima stations (Oliveira et al., 2015) were compared; we cannot completely rule out the effect of nutrients and ammonia concentrations, temperature and conductivity in water from both stations on the observed gene expression values. Thus, a particular lab-scale experiment was needed to clearly decipher whether environmental Ca2+ concentrations might have an impact on C. fluminea physiology. The lab-scale experiment demonstrated that Ca2+ availability had an important effect on growth, confirming the hypothesis of differential physiological state in C. fluminea individuals from both rivers due to the altered gene expression found in situ. On the one hand, the higher recorded growth rates in the smallest size class (independently of Ca2+ concentration tested) is in agreement with previous reports, where clams with smaller initial shell lengths grew at greater rates than larger ones (Ituarte, 1985; Welch and Joy, 1984). Nevertheless, lower growth rates in clams in the present experiment were observed in comparison with those recorded in the environment (1.6 mm month−1) by Sousa et al. (2008). These results could be explained, at least in part, by the limited food resource condition and/or a deficiency in specific nutrients. Indeed, clams were fed on only one microalgae species, which might not fulfill all the nutritional requirements of clams. In this sense, physiological rates and the assimilatory balance of biochemical components as well as growth, especially during shell formation and gametogenesis, have been found to differ greatly depending on the microalgae diet fed to the bivalve species (Fernández-Reiriz et al., 2015). On the other hand, negative growth rates in C. fluminea individuals from the biggest size class maintained at the lowest environmental Ca2+ concentrations might be due to the reabsorption of the shell in a Ca2+ limited medium as previously reported (Hincks and Mackie, 1997). Furthermore, since these size class clams might have attained sexual maturity, the observed decrease in shell growth rate could also be a consequence of an energetic inversion shift from growth towards gonadal development (Welch

7

and Joy, 1984; Dauble et al., 1985; Foe and Knight, 1985). In this sense, the low Ca2 + content in the body of the clams from the River Miño might force them to mobilize Ca2+ from shells during reproduction. Moreover, greater susceptibility of older animals to oxidative stress (Vrankovic, 2016), suggested by the biomarker approach, might increase the magnitude of the impact of low environmental Ca2+ concentrations in those C. fluminea individuals. Since the growth rate is one of the biological traits of invasive species contributing to their invasion success (dispersal and recruitment success; Le Cam et al., 2009), lower growth rates in clams from lower Ca2 + concentrations might limit their establishment upstream, where lower calcium levels were recorded. This is in agreement with the presence of small individuals at relatively low densities and the absence of larger clams in sites with Ca2+ concentrations below the supposed minimum threshold for C. fluminea occurrence (River Pavia, Portugal - Ca2 + concentration: 0.86– 1.32 mg L−1; Sousa et al., 2013). The results presented in this study provide new clues for freshwater basin management and their invasion by C. fluminea. In particular, some rivers from the northwestern Iberian Peninsula presented high Ca2+ levels, more similar to the Mediterranean calcareous basins, linked to anthropogenic-related events or activities (wildfires, agricultural land uses or mining activities; Costa et al., 2014). Thus, on the one hand the present research study highlights the benefits of creating a map for risk assessment regarding the potential invasion of C. fluminea taking into account the environmental Ca2 + concentration of the different freshwater basins in the Iberian Peninsula. On the other hand, results here presented regarding the potential effect of environmental Ca2+ levels on the C. fluminea growth rate suggest the potential benefits of regulatory measures to limit the anthropogenic Ca2+ inputs in freshwater basins for better freshwater basin management to reduce/avoid C. fluminea invasion. 5. Conclusion The present study not only evidences Ca2+ as an important environmental factor determining growth of C. fluminea, but also contributes to the understanding of the underlying mechanisms by which environmental Ca2+ availability might be critical for its invasion success. Firstly, Ca2+ concentration in the clam's soft body has been found to depend on its environmental concentration. Furthermore, the biomarker approach applied suggests that low environmental Ca2+ concentrations might induce oxidative stress conditions in C. fluminea; while a lab scale experiment finally demonstrated how low environmental Ca2 + concentrations decrease the growth rate of C. fluminea and thus, might negatively affect its survival and invasion success in low Ca2+ freshwater basins. The present results highlight the need of more detailed studies in order to (i) correlate Ca2+ (and other environmental factors) with Asian clam invasiveness, through the analysis of a more field stations throughout the entire Iberian Peninsula; (ii) test a wider range of environmental Ca2+ concentrations and study their effects on different biological traits of C. fluminea such as reproductive performance; (iii) evaluate the specific and wide transcriptomic response of C. fluminea to environmental Ca2+ concentrations, for instance through Next-Generation Sequencing technologies; and/or (iv) assess the impact of Ca2+ anthropogenic inputs on the establishment of invasive bivalves. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.scitotenv.2016.12.100. Acknowledgements This work was co-funded by the European Regional Development Fund (ERDF) through the COMPETE Program and by National Funding through the Portuguese Science and Technology Foundation (FCT) under the UID/Multi/04326/2013 project. This study was conducted as part of the FRESCHO project: Multiple implications of invasive species on Freshwater Mussel co-extinction processes, supported by FCT

Please cite this article as: Ferreira-Rodríguez, N., et al., The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.12.100

8

N. Ferreira-Rodríguez et al. / Science of the Total Environment xxx (2016) xxx–xxx

(contract: PTDC/AGRFOR/1627/2014). NF-R was supported by a predoctoral fellowship from the Autonomous Government of Galicia (Xunta de Galicia Plan I2C, PRE/2013/400) and a Scholarship for a research stay abroad from the IACOBUS Program under the European Group of Territorial Cooperation Galicia-North of Portugal (GNP-AECT). IF was supported by a post-doctoral grant (SFRH/BPD/82049/2011) from the FCT. The authors thank J. Iglesias and A. Pedreira for their assistance in the field; and V. Gomes for her assistance on calcium content assessment. References Ackerman, P.A., Forsyth, R.B., Mazur, C.F., Iwama, G.K., 2000. Stress hormones and the cellular stress response in salmonids. Fish Physiol. Biochem. 23, 327–336. Araujo, R., Moreno, D., Ramos, M.A., 1993. The Asiatic clam Corbicula fluminea (Müller, 1774) (Bivalvia: Corbiculidae) in Europe. Am. Malacol. Bull. 10, 39–49. Armengol, J., Riera, J.L., Morguí, J.A., 1991. Major ionic composition of the Spanish reservoirs. Verhandlungen des Internationalen Verein Limnologie 24, 1363–1366. Avelar, W.E.P., Neves, F.F., Lavrador, M.A.S., 2014. Modelling the risk of mortality of Corbicula fluminea (Müller, 1774) (Bivalvia: Corbiculidae) exposed to different turbidity. Braz. J. Biol. 74, 509–514. Belanger, S.E., 1991. The effect of dissolved oxygen, sediment, and sewage treatment plant discharges upon growth, survival and density of Asiatic clams. Hydrobiologia 218, 113–126. Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55, 611–622. Cajaraville, M.P., Bebianno, M.J., Blasco, J., Porte, C., Sarasquete, C., Viarengo, A., 2000. The use of biomarkers to assess the impact of pollution in coastal environments of the Iberian Peninsula: a practical approach. Sci. Total Environ. 247, 295–311. Carlsson, R., 2000. The distribution of the gastropods Theodoxus fluviatilis (L.) and Potamopyrgus antipodarum (Gray) in lakes on the Aland Islands, southwestern Finland. Boreal Environ. Res. 5, 187–196. Clarke, M., 1999. The effect of food availability on byssogenesis by the zebra mussel (Dreissena polymorpha Pallas). J. Molluscan Stud. 65, 327–333. Clerico, E.M., Tilitsky, J.M., Meng, W., Gierasch, L.M., 2015. How Hsp70 molecular machines interact with their substrates to mediate diverse physiological functions. J. Mol. Biol. 427, 1575–1588. Costa, M.R., Calvão, A.R., Aranha, J., 2014. Linking wildfire effects on soil and water chemistry of the Marão River watershed, Portugal, and biomass changes detected from Landsat imagery. Appl. Geochem. 44, 93–102. Costa, S., Guilhermino, L., 2015. Influence of long-term exposure to background pollution on the response and recovery of the invasive species Corbicula fluminea to ammonia sub-lethal stress: a multi-marker approach with field estuarine populations. Water Air Soil Pollut. 226, 1–14. Dauble, D.D., Daly, D.S., Abernethy, C.S., Cardwell, R.D., Purdy, R., Bahner, R.C., 1985. Factors affecting growth and survival of the Asiatic clam, Corbicula sp., under controlled laboratory conditions. 7th Symposium Aquatic Toxicology and Hazard Assessment ASTM STP 854. American Society for Testing and Materials, Philadelphia, pp. 134–144. De Bortoli, M., Gaglione, P., Malvicini, A., Polvani, C., 1968. Concentration factors for strontium and caesium in fish of the lakes in the region of Varese (Northern Italy). Giornale di Fisica Sanitaria e Protezione contro le Radiazioni 12, 324–331. Feng, H., Wei, L., Chen, H., Zhou, Y., 2015. Calreticulin is required for responding to stress, foraging, and fertility in the white-tip nematode, Aphelenchoides besseyi. Exp. Parasitol. 155, 58–67. Fernández-Reiriz, M.J., Garrido, J., Irisarri, J., 2015. Fatty acid composition in Mytilus galloprovincialis organs: trophic interactions, sexual differences and differential anatomical distribution. Mar. Ecol. Prog. Ser. 528, 221–234. Ferreira-Rodríguez, N., Pardo, I., 2014. Abiotic controls on population structure of the invasive Corbicula fluminea (Müller, 1774) in the River Miño estuary. Fundam. Appl. Limnol. 184, 329–339. Ferreira-Rodríguez, N., Pardo, I., 2016. An experimental approach to assess Corbicula fluminea (Müller, 1774) resistance to osmotic stress in estuarine habitats. Estuar. Coast. Shelf Sci. 176, 110–116. Ficetola, G.F., Thuiller, W., Miaud, C., 2007. Prediction and validation of the potential global distribution of a problematic alien invasive species — the American bullfrog. Divers. Distrib. 13, 476–485. Foe, C., Knight, A., 1985. The effect of phytoplankton and suspended sediment on the growth of Corbicula fluminea (Bivalvia). Hydrobiologia 127, 105–115. Friedberg, F., Rhoads, A.R., 2001. Evolutionary aspects of calmodulin. IUBMB Life 51, 215–221. Gama, M., Crespo, D., Dolbeth, M., Anastácio, P., 2016. Predicting global habitat suitability for Corbicula fluminea using species distribution models: the importance of different environmental datasets. Ecol. Model. 319, 163–169. Gao, W., Tian, L., Huang, T., Yao, M., Xu, Q., Guo, T.L., 2016. Molecular cloning and expression of the calreticulin gene of the Pacific white shrimp, Litopenaeus vannamei, in response to acute hypo-osmotic stress. Aquaculture 454, 265–271. Gurevitch, J., Padilla, D.K., 2004. Are invasive species a major cause of extinctions? Trends Ecol. Evol. 19, 470–474. Hellou, J., Ross, N.W., Moon, T.W., 2012. Glutathione, glutathione S-transferase, and glutathione conjugates, complementary markers of oxidative stress in aquatic biota. Environ. Sci. Pollut. Res. 19, 2007–2023.

Hidalgo, C., Donoso, P., 2008. Crosstalk between calcium and redox signaling: from molecular mechanisms to health implications. Antioxid. Redox Signal. 10, 1275–1312. Hincks, S.S., Mackie, G.L., 1997. Effects of pH, calcium, alkalinity, hardness and chlorophyll on the survival, growth, and reproductive success of zebra mussels (Driessena polymorpha) in Ontario Lakes. Can. J. Fish. Aquat. Sci. 54, 2049–2057. Hulme, P.E., 2009. Trade, transport and trouble: managing invasive species pathways in an era of globalization. J. Appl. Ecol. 46, 10–18. Ituarte, C.F., 1985. Growth dynamics in a natural population of Corbicula fluminea (Bivalvia Sphaeriacea) at Punta Atalaya, Rio de La Plata, Argentina. Stud. Neotropical Fauna Environ. 20, 217–225. Le Cam, S., Pechenik, J.A., Cagnon, M., Viard, F., 2009. Fast versus slow larval growth in an invasive marine mollusc: does paternity matter? J. Hered. 100, 455–464. Lewis, S., Handy, R.D., Cordi, B., Billinghurst, Z., Depledge, M.H., 1999. Stress proteins (HSP's): methods of detection and their use as an environmental biomarker. Ecotoxicology 8, 351–368. Lockwood, B.L., Sanders, J.G., Somero, G.N., 2010. Transcriptomic responses to heat stress in invasive and native blue mussels (genus Mytilus): molecular correlates of invasive success. J. Exp. Biol. 213, 3548–3558. Lv, J., Wang, Y., Zhang, D., Gao, B., Liu, P., Li, J., 2015. Cloning and characterization of calreticulin and its association with salinity stress in P. trituberculatus. Cell Stress Chaperones 20, 811–820. Machado, J., Lopes-Lima, M., 2011. Calcification mechanism in freshwater mussels: potential targets for cadmium. Toxicol. Environ. Chem. 93, 1778–1787. Marshall, C.B., Nishikawa, T., Osawa, M., Stathopulos, P.B., Ikura, M., 2015. Calmodulin and STIM proteins: two major calcium sensors in the cytoplasm and endoplasmic reticulum. Biochem. Biophys. Res. Commun. 460, 5–21. McMahon, R.F., 1979. Response to temperature and hypoxia in the oxygen consumption of the introduced Asiatic freshwater clam Corbicula fluminea (Müller). Comp. Biochem. Physiol. A Physiol. 63, 383–388. McMahon, R.F., 2002. Evolutionary and physiological adaptations of aquatic invasive animals: r selection versus resistance. Can. J. Fish. Aquat. Sci. 59, 1235–1244. Michalak, M., Groenendyk, J., Szabo, E., Gold, L.I., Opas, M., 2009. Calreticulin, a multi-process calcium-buffering chaperone of the endoplasmic reticulum. Biochem. J. 417, 651–666. Mooney, H.A., Cleland, E.E., 2001. The evolutionary impact of invasive species. PNAS 98, 5446–5451. Müller, O., Baur, B., 2011. Survival of the invasive clam Corbicula fluminea (Müller) in response to winter water temperature. Malacologia 53, 367–371. Oliveira, C., Vilares, P., Guilhermino, L., 2015. Integrated biomarker responses of the invasive species Corbicula fluminea in relation to environmental abiotic conditions: a potential indicator of the likelihood of clam's summer mortality syndrome. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 182, 27–37. Pardo, I., García, L., Delgado, C., Costas, N., Abraín, R., 2010. Protocolos de muestreo de comunidades biológicas acuáticas fluviales en el ámbito de las Confederaciones Hidrográficas del Cantábrico y Miño-Sil. Convenio entre la Universidad de Vigo y las Confederaciones Hidrográficas del Cantábrico y Miño-Sil. NIPO 783-10-001-8, p. 60. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29, e45. Pekkarinen, M., 1997. Seasonal changes in calcium and glucose concentrations in different body fluids of Anodonta anatina (l.) (Bivalvia: Unionidae). Netherlands J. Zool. 47, 31–45. Plattner, H., Verkhratsky, A., 2015. The ancient roots of calcium signalling evolutionary tree. Cell Calcium 57, 123–132. Ren, G., Hu, X., Tang, J., Wang, Y., 2013. Characterization of cDNAs for calmodulin and calmodulin-like protein in the freshwater mussel Hyriopsis cumingii: differential expression in response to environmental Ca2+ and calcium binding of recombinant proteins. Comp. Biochem. Physiol. B 165, 165–171. Rukke, N.A., 2002. Effects of low calcium concentrations on two common freshwater crustaceans, Gammarus lacustris and Astacus astacus. Funct. Ecol. 16, 357–366. Sabater, S., Feio, M.J., Graça, M.A.S., Muñoz, I., Romaní, A.M., 2009. The Iberian rivers. In: Tockner, K., Uehlinger, U., Robinson, C.T. (Eds.), Rivers of Europe. Academic, London, pp. 113–150. Sousa, R., Antunes, C., Guilhermino, L., 2006. Factors influencing the occurrence and distribution of Corbicula fluminea (Müller, 1774) in the River Lima estuary. Annales de Limnologie. Int. J. Limnol. 42, 165–171. Sousa, R., Antunes, C., Guilhermino, L., 2008. Ecology of the invasive Asian clam Corbicula fluminea (Müller, 1774) in aquatic ecosystems: an overview. Ann. Limnol. - Int. J. Limnol. 44, 85–94. Sousa, R., Amorim, A., Sobral, C., Froufe, E., Varandas, S., Teixeira, A., Lopes-Lima, M., 2013. Ecological status of a Margaritifera margaritifera (Linnaeus, 1758) population at the Southern edge of its distribution (River Paiva, Portugal). Environ. Manag. 52, 1230–1238. Tsuzi, D., Maeta, K., Takatsume, Y., Izawa, S., Inoue, Y., 2004. Distinct regulatory mechanism of yeast GPX2 encoding phospholipid hydroperoxide glutathione peroxidase by oxidative stress and a calcineurin/Crz1-mediated Ca2+ signaling pathway. FEBS Lett. 569, 301–306. Vidal, M.L., Bassères, A., Narbonne, J.F., 2002. Seasonal variations of pollution biomarkers in two populations of Corbicula fluminea (Muller). Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 13, 133–151. Vrankovic, J., 2016. Age-related changes in antioxidant and glutathione S-transferase enzyme activities in the Asian clam. Biochemistry 81, 224–232. Welch, K.J., Joy, J.E., 1984. Growth rates of the Asiatic clam, Corbicula fluminea (Müller), in the Kanawha River, West Virginia. Freshw. Invertebr. Biol. 3, 139–142. Whittier, T.R., Ringold, P.L., Herlihy, A.T., Pierso, S.M., 2008. A calcium-based invasion risk assessment for zebra and quagga mussels (Dreissena spp). Front. Ecol. Environ. 6, 180–184.

Please cite this article as: Ferreira-Rodríguez, N., et al., The role of calcium concentration in the invasive capacity of Corbicula fluminea in crystalline basins, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.12.100