The role of cigarette smoking and liver enzymes polymorphisms in anti-tuberculosis drug-induced hepatotoxicity in Brazilian patients

Tuberculosis 94 (2014) 299e305

Contents lists available at ScienceDirect

Tuberculosis journal homepage: http://intl.elsevierhealth.com/journals/tube

HOST GENETICS OF SUSCEPTIBILITY

The role of cigarette smoking and liver enzymes polymorphisms in anti-tuberculosis drug-induced hepatotoxicity in Brazilian patients Camila Zaverucha-do-Valle a, Sérgio P. Monteiro b, Kênia B. El-Jaick a, e, Leonardo A. Rosadas a, Marli J.M. Costa d, Marcel S.B. Quintana c, Liane de Castro a, * a

Pharmacogenetics Research Laboratory, Evandro Chagas Clinical Research Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil Human Genetic Laboratory, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil Technical Assistance of Clinical Research and Reference Services, Evandro Chagas Clinical Research Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil d Tuberculosis and Mycobacteria Clinical Research Laboratory, Evandro Chagas Clinical Research Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil e Genetics and Molecular Biology Department of Federal University of Rio de Janeiro State, Brazil b c

a r t i c l e i n f o

s u m m a r y

Article history: Received 18 December 2013 Accepted 20 March 2014

Tuberculosis (TB) is still a major health concern and side-effects related to the treatment, especially druginduced hepatotoxicity (DIH), should be better investigated. In the present study, a possible association between anti-TB DIH and cigarette smoking, N-acetyltransferase 2 (NAT2), Cytochrome P450 2E1 (CYP2E1) and Cytochrome P450 3A4 (CYP3A4) genotypes was studied in 131 TB Brazilian patients. The NAT2 and CYP3A4 genetic polymorphisms were determined using a polymerase chain reaction (PCR) direct sequencing approach and genetic polymorphisms of CYP2E1 gene were determined by restriction fragment length polymorphism (RFLP). The risk of anti-TB DIH was lower in rapid/intermediate acetylators when compared to slow acetylators (OR: 0.34, CI 95: 0.16e0.71; p < 0.01). A decreased risk of developing anti-TB DIH was also observed in active smokers when compared to non-smokers (OR: 0.28, 95 CI: 0.11e0.64; p < 0.01). Significant association between CYP3A4 genotypes and hepatotoxicity was not observed, as well as between CYP2E1 genotype and hepatotoxicity, whose frequency of patients with wild homozygous was more prevalent. The anti-TB drugs interactions with smoking on hepatotoxicity, as well as the NAT2 phenotype, may require to adjust therapeutic regimen dosages or alarm in case of adverse event developments. Ó 2014 Elsevier Ltd. All rights reserved.

Keywords: Anti-tuberculosis drug Hepatotoxicity Liver enzymes Cigarette smoking

1. Introduction Tuberculosis (TB) is a major health issue, especially in developing countries, that account for 95% of tuberculosis cases and deaths worldwide according to the World Health Organization (WHO). In Brazil, the notifications recorded more than 70,000 new TB cases in 2012 and more than 10,000 of these new cases occurred in the state of Rio de Janeiro. Although the TB death rate dropped 41% between 1990 and 2011 (data from WHO), side-effects related to the treatment, especially DIH, still increase morbidity and mortality.

* Corresponding author. Pharmacogenetics Research Laboratory, Evandro Chagas Clinical Research Institute, Oswaldo Cruz Foundation, Avenida Brasil, 4365, Manguinhos, 21040-360 Rio de Janeiro, RJ, Brazil. Tel.: þ55 (21) 3865 9558; fax: þ55 (21) 2590 9998. E-mail address: liane.castro@ipec.fiocruz.br (L. de Castro). http://dx.doi.org/10.1016/j.tube.2014.03.006 1472-9792/Ó 2014 Elsevier Ltd. All rights reserved.

Risk factors associated to DIH include age over 60 years [1], female gender [2,3], poor nutritional status [4], alcohol intake [5e8] and treatment regimens, among others. Concerning tobacco use, it has been shown that ever smokers are more likely to have cough, dyspnea, chest radiograph appearances of upper zone involvement, cavity and miliary appearance, and positive sputum culture, but are less likely to have isolated extra-pulmonary involvement than nonsmokers. Smoking has been found to be associated with both relapse of TB and TB mortality [9]. Keshavjee et al. [10] demonstrated that smoking was associated with worse outcomes in multidrug-resistant tuberculosis patients. Constituents of cigarette smoke, including polycyclic aromatic hydrocarbons, induce several drug-metabolizing enzymes and may interfere with drug clearance [11]. However, most studies do not analyze cigarette smoking as an individual possible risk factor to DIH. In anti-TB therapy with isoniazid, rifampicin and pyrazinamide, isoniazid has been described as the most common drug associated to

300

C. Zaverucha-do-Valle et al. / Tuberculosis 94 (2014) 299e305

hepatotoxicity [8]. Concerning this, genetic polymorphisms in key enzymes associated with isoniazid metabolism also need attention. In the liver, isoniazid is initially acetylated to acetylisoniazid by the enzyme N-acetyltransferase 2 (NAT2) and then hydrolyzed into acetylhydrazine and isonicotinic acid. Acetylhydrazine is hydrolyzed into hydrazine or acetylated into diacetylhydrazine, a nontoxic residue. Alternatively, acetylhydrazine is oxidate by CYP2E1 generating toxic metabolites. Studies suggest that hydrazine is probably the cause of isoniazid-induced hepatotoxicity [12]. According to NAT2 genotype, individuals can be classified in three acetylator phenotypes: fast, intermediate and slow. The association between acetylator phenotype and isoniazid-induced hepatotoxicity is, however, still controversial. Initial studies have demonstrated that patients with a fast acetylator phenotype had a higher risk of developing hepatotoxicity [13,14]. More recently, Leiro-Fernandez et al. [15] did not find a significant correlation between acetylator phenotype and hepatotoxicity. However, Santos and et al. [16] and Gupta et al. [17] showed a high correlation between slow acetylators and hepatotoxicity. Corroborating these data, a recent meta-analysis comprising 14 studies showed that TB patients with slow acetylator profile had an increased risk of developing DIH [18]. Concerning liver enzymes other than NAT2, genetic polymorphisms in genes that codify microsomal Cytochrome P450 (CYP) enzymes family could also be related to anti-TB DIH. Different groups have looked at CYP2E1 genetic polymorphisms because this enzyme plays a role in the metabolic pathway of isoniazid [3,16,17,19], however the results have been controversial. Huang et al., for example, showed an association of the CYP2E1 wild type genotype (c1/c1) with an increased risk of DIH [20]. On the other hand, others studies revealed a negative association between hepatotoxicity and CYP2E1 genotype [3,16,17]. These differences may be related to different studied populations’ ethnicity and divergent criteria used to define hepatotoxicity. Another CYP enzyme that could be related to anti-TB DIH is CYP3A4. This enzyme is induced by rifampicin and this induction leads to increased release of toxic metabolites by isoniazid metabolism [8]. However, to our knowledge, there are no studies correlating CYP3A4 polymorphisms to anti-TB DIH. Our group has demonstrated that CYP3A4 50 region is highly conserved in the analyzed Brazilian population. However, a single nucleotide polymorphism was detected: c.-392A>G [21]. Therefore, the aim of the present study is to investigate a possible correlation between cigarette smoking and anti-TB DIH in Brazilian TB patients, as well as the contribution of NAT2 acetylation status, CYP3A4 and CYP2E1 genetic polymorphisms and clinical/demographical variants to this adverse event occurrence. 2. Methods 2.1. Study design and patients In this retrospective cohort study, we analyzed patients who were treated for tuberculosis at Evandro Chagas Clinical Research Institute (IPEC), Oswaldo Cruz Foundation (FIOCRUZ), Rio de Janeiro, Brazil from 2001 to 2008. The IPEC-FIOCRUZ Ethics Committee approved this research under the SISNEP register: 0013.0.009.000-03/2003. The eligibility criteria were: signed written consent, sputum smear with acid-fast bacilli or culture positive for Mycobacterium tuberculosis; ongoing TB treatment and laboratory tests of liver function. Exclusion criteria were: age <18 years, pregnancy and no more than one visit registered. All patients were submitted to a standardized clinical protocol, an initial visit with clinical and laboratory evaluation, follow-up at

days 15 and 30 and at least one visit monthly until the end of therapy. According to the Brazilian Ministry of Health (BMH) recommendation TB treatment at the time was 600 mg/day of rifampicin (R), 400 mg/day of isoniazid (H) and 2 g/day of pyrazinamide (Z) for all patients with corporal weight >45 kg or adjusted for corporal weight < 45 kg. After two months of therapy, Z was discontinued. Demographic, laboratorial and clinical data were obtained from medical records. Possible predictors of anti-TB DIH analyzed were age (years), gender, ethnicity, TB clinical form, defined as pulmonary, extra-pulmonary and disseminated, HIV and HCV infection based on positive serology, HBV infection defined by serological HBV surface antigen (HBsAg) detection; HAART use; tobacco use and alcoholism. Concerning ethnicity, patients were classified as White or Non-White according to personal report. Tobacco use defined as current use reported by the patient; and alcoholism defined by a positive CAGE questionnaire. Alanine transferase (ALT) values were obtained at baseline, days 15 and 30, and monthly during of TB treatment. If considered necessary by the assistant physician, ALT values were obtained more frequently. Following the Council of International Organizations of Medical Sciences (CIOMS), hepatotoxicity was defined as a 2-fold increase in the normal upper limit (ALT  42 [IU]/L) or at least a 2-fold increase in ALT initial levels for those patients with a baseline ALT of >84 IU/L, during the treatment period. The severity of hepatotoxicity was classified according to the WHO Toxicity Classification Standards [12]. 2.2. DNA sample and extraction Genomic DNA was extracted from peripheral blood samples using the QIAamp DNA Blood Mini Kit (Qiagen, Maryland, USA) according to manufacturer’s instructions. 2.3. NAT2, CYP3A4 and CYP2E1 genotyping A polymerase chain reaction (PCR) direct sequencing method was used to detect genetic polymorphisms of the NAT2 gene coding region (for acetylation status determination), following the consensus international nomenclature committee for NAT2 (http:// nat.mbg.duth.gr/and) and genotyping for CYP3A4 gene upstream region (c.-392 G>A), *1A allele (A) or *1B allele (G). Genotyping for CYP2E1 c1(*1A)/c2(*5B) were determined by restriction fragment length polymorphism (PCR-RFLP) analyzing two point mutations in the 50 -flanking region of CYP2E1, which are in complete linkage disequilibrium, RsaI (c.-1055C>T) and PstI (c.-1295G>C). The list of genes-targeting primer pairs is presented in Table 1. The 50 mL reaction mixtures were comprised of 90 ng genomic DNA, 0.4 mM each primer, 0.2 mM deoxynucleoside triphosphates (dNTPs), 1.5 mM MgCl2 and 2.5units of Platinum Taq DNA polymerase (Invitrogen, Life Technology, Carlsbad, USA). Temperature cycling was performed in an Eppendorf-Master Cycling-PCR machine with

Table 1 Primer pairs used to amplify NAT2, CYP3A4 and CYP2E1 genes and for NAT2 direct sequencing. Gene

Primers

Fragments size

NAT2

Sense 50 CTGGATTTCCAACTCCTCATGC 30 Reverse 50 GTTGGGTGATACATACACAAGGG 30 Sense 50 TACTGGGCTCTGACCACAATCG 30 Reverse 50 ACATCTGGGAGGAGCTTCCAG 30 Sense 50 -TGAGGAGCTCACCTCTGTTC-30 Reverse 50 -GAGCAACACAGAGCTGAAAGG-30 Sense 50 -CAGACTCTCCAGGGCACGCGG-30 Reverse 50 -CCCGGGACACAATAGAGCTCC-30

1178 bp

NAT2 sequencing CYP3A4 CYP2E1

689 bp 658 bp 661 bp 959 bp

C. Zaverucha-do-Valle et al. / Tuberculosis 94 (2014) 299e305

the following conditions: denaturation at 95  C for 3 min, followed by 35 cycles at 95  C for 50 s, 63  C for 60 s, 72  C for 50 s and extension at 72  C for 8 min. The restricted products were analyzed on 2% agarose gel electrophoresis followed by ethidium bromide staining. For PCR direct sequencing, the PCR’s products were excised from 1% agarose gel and purified using the Wizard SV Gel and PCR clean-Up System Kit (Promega, USA) according to manufacturer’s instructions. Big Dye TerminatorÔ Cycle Sequencing Kit (Applied Biosystem, Inc., USA) was used for further direct DNA sequencing. Base composition analyses were made on an ABI PrismÒ 3730 DNA Analyzer at an institutional genomic facility (RPT01A-PDTIS/FIOCRUZ) [22]. The GenBank sequence X14672.1 and AF280107 were used as reference for NAT2 and CYP3A4 genes respectively. The sequences were edited and assigned using Sequencer 4.1.4 software (Demo version). 2.4. Statistical analysis Deviations from HardyeWeinberg equilibrium (HWE) were accessed by Chi-square tests. Cases and controls were compared according to the frequencies of genotypes, alleles and minor allele carriers. Considering (a) the observed minor allele frequencies (MAFs) (b) anti-TB drug-induced hepatotoxicity prevalence up to 36.5%, as previously reported [12] ratio between controls and cases of 1.5; our simulations in showed that 50 cases were sufficient to accept Odds Ratios greater or equal to 3 with a power of 80%. To compare the effect of age, gender, skin color, tuberculosis form, HIV status, HBsAg, Anti-HBs, Anti-HBc, Anti-HCV, Alcohol, Tobacco, HAART in the odds of hepatotoxicity, odds ratios (ORs) and confident intervals (CL) were calculated by median-unbiased estimation [23] while the p-values were calculated by Chi-square and Exact Fisher Tests, whenever appropriate [23]. A logistic generalized linear model [24] was used on the multivariate analysis controlling for potential confounders such as variables with p-value <0.05, kept in the final model. The effect of interaction with smoking habit and all the other co variables on hepatotoxicity was also analyzed. For the outcome grade of hepatotoxicity, a Multinomial Generalized Linear Model [24] was used, evaluating the effects of the variables above on the odds of each grade. The software R version 2.15.113 was used for all the statistical analysis [25] and a p-value <0.05 was set as significant. 3. Results 3.1. Patient characteristics A total of 131 TB patients were analyzed in the present study. Among them, 66.4% were male. Most of them were non-white (58%) and the average age was 39.8 years old. The pulmonary form of TB was the most frequent (57.2%), followed by extra-pulmonary (32%) and disseminated-TB (17.5%). Not all patients had serological results for HIV, HCV and HBV. Considering that, 61/129 patients (47.3%) were HIV-positive and 45 patients were on highly active antiretroviral therapy (HAART). HCV prevalence was 7.2% (9/ 124) and HBV prevalence (anti-HBc) was 30.4% (31/102), but only 4.6% (5/108) of the patients had active HBV infection. Concerning consume of alcohol, the frequency users was 30%. Similarly, 39/130 (30%) of the patients declared themselves as active smokers and among them; the average of pack-years smoked was 22.8. 52/131 patients (39.7%) developed hepatotoxicity after treatment and 33 of them (64%) developed this adverse event in the first 30 days after the beginning of the treatment. Between the patients that developed anti-TB DIH, 28.57% presented grade 1 of hepatotoxicity, 38.78% presented grade 2, 12.24% presented grade 3 and 20.41% developed grade 4 (Table 2).

301

Table 2 Frequency of hepatotoxicity according to Grade and onset. n (frequency %) Grade of hepatotoxicity

Onset of hepatotoxicity

1 2 3 4 0e30 days 30e60 days >60 days

14 19 6 10 31 7 11

(28.57%) (38.78%) (12.24%) (20.41%) (63.26%) (14.29%) (22.45%)

Grade of hepatotoxicity was defined according to the World Health Organization (WHO) Toxicity Classification Standards [12]. Grade 1 (mild) represents an increase as high as 2.5 times over the upper limit of alanine aminotransferase (ALT) levels (ALT 51e125 U/L). Grade 2 (mild) represents increase between 2.5 and 5 times over the upper limit of alanine aminotransferase (ALT) levels (ALT 126e250 U/L). Grade 3 (moderate) represents an increase between 5 and 10 times over the upper limit of alanine aminotransferase (ALT) levels (ALT 251e500 U/L) and Grade 4 (severe) represents an increase higher than 10 times over the upper limit of alanine aminotransferase (ALT) levels (ALT > 500 U/L).

3.2. Cigarette smoking and anti-tuberculosis DIH The association between patient characteristics and the development of anti-TB DIH is demonstrated in Table 3.1. Hepatotoxicity was divided in low (grade 1 or 2) and high (grade 3 or higher), the second one being clinically relevant. Comparing patients that developed low hepatotoxicity with patients that had no hepatotoxicity during treatment, the multivariate analysis indicated an increased risk for anti-TB DIH in patients with the disseminated-TB (OR: 3.14, 95 CI: 1.00e9.92; p ¼ 0.05). However, among patients that developed high hepatotoxicity compared with patients that had no hepatotoxicity, the ones with the extrapulmonar-TB presented an increased risk for anti-TB DIH (OR: 4.81, 95 CI: 1.29e18.02; p ¼ 0.02). Surprisingly, concerning cigarette smoking, active smokers were negatively associated to anti-TB DIH. Among non-smokers, 48.35% of them developed anti-TB DIH (44/91) while only 20.5% (8/39) of active smokers had the same outcome. One patient did not have smoking information on medical records. The logistic regression analysis, showed a risk decreased for anti-TB DIH among active smokers (OR: 0.28, 95 CI: 0.11e0.64; p < 0.01) (Table 4). In the same way, the multivariate analysis showed a risk decreased for anti-TB DIH among active smokers compared to those who developed high hepatotoxicity (OR: 0.10, 95 CI: 0.01e0.81; p ¼ 0.03) and also with patients that developed low hepatotoxicity (OR: 0.34, 95 CI: 0.12e0.95; p ¼ 0.04) (Table 3.2). To verify if the amount of cigarette smoking increases the risk for anti-TB DIH, the smoking patients were divided into two groups: the ones that had less than 20 pack-years of smoking history and the ones that had 20 or more pack-years of smoking history. Using the logistic regression model, there was no statistically significant difference between the two groups of smokers (p ¼ 0.72) (Table 4). Concerning all other analyzed characteristics, there was no statistically significant difference between cases and control patients (Table 3). 3.3. CYP3A4 genetic polymorphism and hepatotoxicity Sixty-two TB patients presented homozygous wild type genotype *1A/*1A, 52 presented *1A/*1B (heterozygote) and 17 presented the homozygous mutant genotype *1B/*1B. Of the 62 TB patients with genotype *1A/*1A, 27 developed anti-TB DIH after treatment, as well as 18/52 *1A/*1B genotype carriers and 7/17 *1B/ *1B ones. There was no significant correlation between CYP3A4 genotype and anti-TB DIH. These results are summarized in Table 5.

302

C. Zaverucha-do-Valle et al. / Tuberculosis 94 (2014) 299e305

Table 3.1 Characteristics of the Brazilian population analyzed in this study. Univariate analysis. Variables

Grade of hepatotoxicity

<40 >40 M F White Non-white TBD TBE TBP P N P N P N P N P N P N P N P N

Age Gender Skin color TB form

HIV status HBsAg assay Anti-HBs assay Anti-HBc assay Anti-HCV assay Alcohol status Tobacco status HAART status

Univariate analysis*

H (n ¼ 16)

L (n ¼ 32)

N (n ¼ 79)

H vs N OR [CI 95%]

p-Value

L vs N OR [CI 95%]

p-Value

7 9 9 7 9 7 3 9 4 8 6 1 14 3 13 2 11 0 16 4 12 1 15 6 10

21 11 20 12 15 17 8 11 12 17 15 2 29 8 21 9 21 2 28 8 24 6 26 12 20

43 36 57 25 29 50 11 22 46 32 47 2 62 20 54 18 38 7 68 26 50 31 47 26 53

0.65 [0.22e1.92] Baseline 0.60 [0.20e1.78] Baseline 2.22 [0.75e6.58] Baseline 3.14 [0.61e16.09] 4.7 [1.30e16.97] Baseline 1.96 [0.62e6.18] Baseline 2.21 [0.19e26.17] Baseline 0.62 [0.16e2.42] Baseline 0.38 [0.08e1.92] Baseline e e 0.64 [0.19e2.19] Baseline 0.10 [0.01e0.80] Baseline 1.22 [0.4e3.73] Baseline

0.44

1.60 [0.68e3.75] Baseline 0.77[0.33e1.82] Baseline 1.52 [0.66e3.49] Baseline 2.79 [0.92e8.46] 1.92 [0.73e5.02] Baseline 1.66 [0.73e3.81] Baseline 2.14 [0.29e15.94] Baseline 1.03 [0.39e2.69] Baseline 0.90 [0.35e2.37] Baseline 0.69 [0.14e3.55] Baseline 0.64 [0.25e1.62] Baseline 0.35 [0.13e0.95] Baseline 1.22 [0.52e2.88] Baseline

0.28

0.35 0.15 0.17 0.02 0.25 0.53 0.49 0.24 e e 0.48 0.03 0.72

0.55 0.32 0.07 0.19 0.23 0.46 0.95 0.84 0.66 0.35 0.04 0.64

H, high; L, low; N, negative; P, positive; OR, odds ratio; CI, confidence interval; TBP, pulmonary tuberculosis; TBE, extra-pulmonary tuberculosis; TBD, disseminated tuberculosis. * Significance <0.10 at univariate analysis.

Table 3.2 Characteristics of the Brazilian population analyzed in this study. Multivariate analysis. Variables

TB form

Tobacco status

Multivariate analysis*

TBD TBE TBP P N

3.5. NAT2, acetylation profile and hepatotoxicity

H vs N OR [CI 95%]

p-Value

L vs N OR [CI 95%]

p-Value

3.80 [0.70e20.74] 4.81 [1.29e18.02] 1 0.10 [0.01e0.81] 1

0.12 0.02

3.14 [1.00e9.92] 1.98 [0.74e5.30] 1 0.34 [0.12e0.95] 1

0.05 0.18

0.03

0.04

H, high; L, low; N, negative; P, positive; OR, odds ratio; CI, confidence interval; TBP, pulmonary tuberculosis; TBE, extra-pulmonary tuberculosis; TBD, disseminated tuberculosis. * Significance < 0.05 at multivariate analysis.

3.4. CYP2E1 genetic polymorphism By analyzing CYP2E1 genetic polymorphism, this enzyme showed to be quite conserved in the studied population. Among 129 patients genotyped, 122 presented homozygous wild type genotype, *1A/*1A (c1/c1), corresponding to 94.57% of the population, 1.55% (2/129) were homozygous mutants *5B/*5B (c2/c2) and 3.88% (5/129) were heterozygous. Concerning the anti-TB DIH, 48/122

Table 4 Frequency of anti-TB DIH in smokers and non-smokers.

Tobacco Pack-years smoked

Yes No >20 <20

n (frequency %)

Logistic regression model

Cases

Controls

OR [CI 95%]; p-value

8 44 7 9

31 47 21 22

0.28 [0.11e0.64]; <0.01 Baseline 0.81 [0.25e2.58]; 0.72 Baseline

(20.51%) (48.35%) (25%) (29.03%)

OR, odds ratio; CI, confidence interval.

*1A/*1A genotype carriers, 1/2 *5B/*5B carriers and 2/5 *1A/*5B carriers presented this adverse event.

(79.49%) (51.65%) (75%) (70.97%)

According to genetic polymorphisms observed in NAT2 coding region, patients were classified as slow, intermediate or rapid acetylators. Our analysis demonstrated that 55.7% of the patients were slow acetylators, 35.1% of the patients were intermediate acetylators and 9.2% of the patients were rapid acetylators. As the percentage of rapid acetylators was very small, intermediate and rapid acetylators were grouped for statistical analysis. Between intermediate and rapid acetylators, 25.86% (15/58) patients developed anti-TB DIH, while 50.68% (37/73) of slow acetylators had the same outcome. Analyses using the logistic regression model demonstrated that rapid/intermediate acetylators presented a decreased risk for anti-TB DIH when compared to slow acetylators (OR: 0.34, CI 95: 0.16e0.71; p < 0.01) (Table 6). 3.6. Logistic regression model with all variables The logistic regression model was performed by making the interaction among smoking status and all the other variables. The patients with the lower risk of developing anti-TB DIH were active smokers, with rapid/intermediate acetylator profile and NAT2 polymorphisms in heterozygosis. In Table 7 we can see the comparison between this group and all the analyzed groups. Compared to this group, active smokers that were homozygous for NAT2 polymorphisms (haplotype group NAT2*5) with a slow acetylator profile had an increased risk for anti-TB DIH (OR: 8.67, CI 95: 1.55e48.49; p ¼ 0.02). Likewise, non-smokers with slow acetylator profiles and NAT2 polymorphisms (haplotype group NAT2*5) in either homozygosis or heterozygosis had an even

C. Zaverucha-do-Valle et al. / Tuberculosis 94 (2014) 299e305 Table 5 CYP3A4 genotypes among cases and controls and their association with risk of antiTB DIH. Gene

CYP3A4

Genotype

*1B/*1B *1A/*1B *1A/*1A

n (frequency %)

Logistic regression model

Cases

Controls

OR [CI 95%]; p-value

7 (41.18%) 18 (34.62%) 27 (43.55%)

10 (58.82%) 34 (62.38%) 35 (56.45%)

0.91 [0.29e2.68]; 0.86 0.69 [0.32e1.46]; 0.33 Baseline

OR, odds ratio; CI, confidence interval.

increased risk for anti-TB DIH (OR: 15.8, CI 95: 4.16e59.96; p < 0.01).

303

Table 7 Multivariate logistic regression model comparing the odds ratios of hepatotoxicity for all combination of smoker habit and NAT2 genotype and acetylator status using as reference a patient with the lower risk of developing anti-TB DIH. All combinations of patients characteristics

OR [95%CI]

p-value

Smoker, Heterozygous, RA or IA Smoker, Homozygous, SA Smoker, Heterozygous, SA Smoker, Homozygous, RA or IA Non-smoker, Homozygous, SA Non-smoker, Heterozygous, SA Non-smoker, Heterozygous, RA or IA

Baseline 8.67 [1.55e48.49] Baseline 3.76 [0.96e14.64] 15.8 [4.16e59.96] 15.8 [4.16e59.96] 3.76 [0.96e14.64]

e 0.02 e 0.06 <0.01 <0.01 0.06

OR, odds ratio; CI, confidence interval; RA, rapid acetylator; IA, intermediate acetylator; SA, slow acetylator, Heterozygous and Homozygous (Haplotype group NAT2*5), SA.

4. Discussion The understanding of mechanism of anti-TB DIH becomes important to increase TB treatment success rate. In the present study, we analyzed a cohort of Brazilian TB patients from 2001 to 2008. The 39.7% frequency of DIH found here is above the incidence range of variation that has been reported in several studies (2e28%) [12], although the frequency rate of DIH depends on the investigators’ definition of hepatotoxicity as well as the population studied, the high rate of DIH, is probably due the variations on drug regimens in different Countries. In 2010, the Brazilian National Tuberculosis Control Program (NTCP) recommended the implementation of the four-fixed dose combination (4 FDC-RHZE), regimen to treat new tuberculosis cases, expecting to increase adherence and avoid resistance. The new regimen contain ethambutol (E), reduced doses of H (from 400 to 300 mg) and of Z (from 2000 to 1600 mg). Possibly, this new regimen would decrease the risk of anti-TB DIH. However, information regarding the hepatotoxicity of this combination remains unavailable in studies conducted in Brazil. Concerning NAT2 acetylation status, we demonstrated that slow acetylators have an increased risk of developing anti-TB DIH. Different groups have shown similar results [16e18,26,27]. In NAT2 slow acetylator phenotype carriers, there is higher accumulation not only of isoniazid but also of acetylhidrazine, which is the precursor of the hepatotoxins generated by CYP2E1. Additionally, NAT2 slow acetylators have as a common pathway, the direct conversion of isoniazid to hydrazine, possibly through the accumulation of isoniazid [8,28,29]. As hydrazine is also associated to liver injury, NAT2 slow acetylators would have a higher risk of developing hepatotoxicity both through the accumulation of hydrazine and acetylhidrazine. Concerning CYP3A4 enzyme, it is induced by rifampicin through the pregnane X receptor and its activation leads to increased metabolism of isoniazid and, consequently, the production of toxic metabolites [8], suggesting that CYP3A4 could be associated to antiTB DIH. Nevertheless, no significant association was found between CYP3A4 genotypes and the anti-TB DIH, probably because the majority of analyzed patients were homozygous wild type genotype

Table 6 NAT2 acetylation profile among cases and controls and their association with risk of anti-TB DIH. Gene Enzyme acetylation n (frequency %) profile Cases Controls NAT2 RA or IA SA

Logistic regression model OR [CI 95%]; p-value

15 (25.86%) 43 (74.14%) 0.34 [0.16e0.71]; <0.01 37 (50.68%) 36 (49.32%) 1

OR, odds ratio; CI, confidence interval; RA, rapid acetylator; IA, intermediate acetylator; SA, slow acetylator.

carriers. To our knowledge, this is the first report analyzing a possible association between CYP3A4 polymorphisms and DIH. In respect to CYP2E1 genetic polymorphisms, different groups have found an association of homozygous wild type genotype (1*A/ 1*A) with an increase in DIH [20,30,31] or the severity of the condition [32]. Corroborating with the findings in Brazil [16], patients with DIH were more prevalent in wild type homozygous than the others genotypes, however, the statistical analysis was not significant. The differences in CYP2E1 genetic polymorphism distribution between our population and previous studies are probably related to ethnicity, especially because most of these studies were performed in Asian populations [20,30e32] that are very distinct from the Brazilian population. Unexpectedly, when analyzing the nongenetic characteristics of the population in cases (anti-TB DIH) and control patients (without anti-TB DIH), cigarette smoking demonstrated to be negatively associated to anti-TB DIH. It is well known that constituents of cigarette smoke induce drugmetabolizing enzymes. The polycyclic aromatic hydrocarbons found in cigarette smoke induce CYP1A1, CYP1A2 and CYP2E1 and nicotine also induces several enzymes [11]. Using an animal model, Howard et al. have shown that nicotine administration increases CYP2E1 expression in rat’s liver and chlorzoxazone metabolism, which is a marker of CYP2E1 activity [33]. In humans, Benowitz et al. have demonstrated an increase in chlorzoxazone and caffeine metabolism after cigarette smoking, suggesting an induction of CYP2E1 and CYP1A2 respectively [34]. The induction of CYP2E1 in smokers would increase the oxidation of acetylhidrazine and, in theory, would increase the generation of toxic metabolites. Differently, our results showed that risk of DIH was decreased in active smokers. These results may be associated to nicotine or other compounds of tobacco smoke in Glutathione Stransferase (GST) activity, since this enzyme plays a role in nicotine detoxification pathway. In an animal study, Pachauri and Flora [35] showed prophylactic efficiency of nicotine against arsenic toxicity, since pretreatment with nicotine attenuated the GST inhibition induced by arsenic. It has been demonstrated that isoniazid also inhibits GST activity in animal models [36]. Therefore, pretreatment with nicotine could also prevent the isoniazid GST inhibition and consequently decrease DIH. Nicotine is detoxified by CYP in the liver. Concerning hepatic ischemia/reperfusion (I/R), a condition that elicits an excessive inflammatory response posing a lethal threat to the host, Park et al., suggest that activation of a7-nicotinic acetylcholine receptor by nicotine ameliorates I/R-induced liver injury. This protection is likely due to inhibition of the inflammatory response through heme oxygenase-1 induction [37]. a7-Nicotinic acetylcholine receptors have also emerged as potential target for the treatment of neurocognitive dysfunctions in schizophrenia. Molecular evidences for the involvement of this

304

C. Zaverucha-do-Valle et al. / Tuberculosis 94 (2014) 299e305

receptor gene in the neurobiology of the disease suggest the use of a7-nicotinic receptor agonists in clinical studies to improve neurocognition [38]. Another hypothesis to explain the association found between cigarette non-consumption and anti-TB DIH would be a possible correlation between cigarette consumption and NAT2 acetylator status. Since heterocyclic amines that are present in tobacco smoke require activation by CYP1A2 and NAT2 [39] and despite the slow acetylator status is related to reduced ability to detoxify these xenobiotics, the active smokers could have an increase of NAT2 activity and accelerate metabolism of isoniazid. This hypothesis could be supported by several studies that have indentified many interactions between tobacco smoke and medications in induction of hepatics enzymes. These interactions could affect the pharmacokinetic or pharmacodynamic mechanisms [11]. In fact, our results showed a risk decreased for anti-TB DIH among active smokers (p < 0.01). However, the tobacco smoke has different compounds that act on many liver enzymes, thus, further studies are necessary to understand the lower risk of DIH in smoking patients. These results would be useful to evaluate anti-TB drugs interactions with smoking on DIH and may require adjust of the therapeutic regimen dosages or alarm in case of adverse event developments. Acknowledgments The authors thank the medical, technical and nursing staff of the Evandro Chagas Clinical Research Institute (IPEC) for their support. Funding: This study was supported by grants (403630/20088) from the Programa Estratégico de Apoio à Pesquisa em Saúde, Fundação Oswaldo Cruz and from the Foundation for Research Support of Rio de Janeiro State (FAPERJ). Competing interests:

None declared.

Ethical approval: IPEC-FIOCRUZ Ethics Committee approved this research under the SISNEP register: 0013.0.009.000-03/2003. References [1] Yee D, Valiquette C, Pelletier M, Parisien I, Rocher I, Menzies D. Incidence of serious side effects from first-line antituberculosis drugs among patients treated for active tuberculosis. Am J Respir Crit Care Med 2003;167: 1472e7. [2] Lee AM, Mennone JZ, Jones RC, Paul WS. Risk factors for hepatotoxicity associated with rifampin and pyrazinamide for the treatment of latent tuberculosis infection: experience from three public health tuberculosis clinics. Int J Tuberc Lung Dis 2002;6:995e1000. [3] Chamorro JG, Castagnino JP, Musella RM, Nogueras M, Aranda FM, Frias A, Visca M, Aidar O, Perés S, Gabriela F de Larrañaga GF. Sex, ethnicity, and slow acetylator profile are the major causes of hepatotoxicity induced by antituberculosis drugs. J Gastroenterol Hepatol 2013;28:323e8. [4] Singla R, Sharma SK, Mohan A, Makharia G, Sreenivas V, Jha B, Kumar S, Sarda P, Singh S. Evaluation of risk factors for antituberculosis treatment induced hepatotoxicity. Indian J Med Res 2010;132:81e6. [5] Sharma SK, Balamurugan A, Saha PK, Pandey RM, Mehra NK. Evaluation of clinical and immunogenetic risk factors for the development of hepatotoxicity during antituberculosis treatment. Am J Respir Crit Care Med 2002;166:916e9. [6] Fernandez-Villar A, Sopena B, Fernandez-Villar J, Vazquez-Gallardo R, Ulloa F, Leiro V, Mosteiro M, Piñeiro L. The influence of risk factors on the severity of anti-tuberculosis drug-induced hepatotoxicity. Int J Tuberc Lung Dis 2004;8: 1499e505. [7] Tost JR, Vidal R, Cayla J, Diaz-Cabanela D, Jimenez A, Broquetas JM. Severe hepatotoxicity due to anti-tuberculosis drugs in Spain. Int J Tuberc Lung Dis 2005;9:534e40. [8] Ramappa V, Aithal GP. Hepatotoxicity related to anti-tuberculosis drugs: mechanisms and management. J Clin Exp Hepatol 2013;3:37e49. [9] Chiang CY, Slama K, Enarson DA. Associations between tobacco and tuberculosis. Int J Tuberc Lung Dis 2007;11:258e62.

[10] Keshavjee S, Gelmanova IY, Shin SS, Mishustin SP, Andreev YG, Atwood S, Furin JJ, Miller A. Hepatotoxicity during treatment for multidrug-resistant tuberculosis: occurrence, management and outcome. Int J Tuberc Lung Dis 2012;16:596e603. [11] Kroon LA. Drug interactions with smoking. Am J Syst Pharm 2007;64: 1917e21. [12] Tostmann A, Boeree MJ, Aarnoutse RE, de Lange WC, van der Ven AJ, Dekhuijzen R. Antituberculosis drug-induced hepatotoxicity: concise up-todate review. J Gastroenterol Hepatol 2008;23:192e202. [13] Mitchell JR, Thorgeirsson UP, Black M, Timbrell JA, Snodgrass WR, Potter WZ, Jollow HR, Keiser HR. Increased incidence of isoniazid hepatitis in rapid acetylators: possible relation to hydranize metabolites. Clin Pharmacol Ther 1975;18:70e9. [14] Yamamoto T, Suou T, Hirayama C. Elevated serum aminotransferase induced by isoniazid in relation to isoniazid acetylator phenotype. Hepatology 1986;6: 295e8. [15] Leiro-Fernandez V, Valverde D, Vazquez-Gallardo R, Botana-Rial M, Constenla L, Agundez JA, Fernández-Villar A. N-acetyltransferase 2 polymorphisms and risk of anti-tuberculosis drug-induced hepatotoxicity in Caucasians. Int J Tuberc Lung Dis 2011;15:1403e8. [16] Santos NP, Callegari-Jacques SM, Ribeiro Dos Santos AK, Silva CA, Vallinoto AC, Fernandes DC, de Carvalho DC, Santos SE, Hutz MH. N-acetyl transferase 2 and cytochrome P450 2E1 genes and isoniazid-induced hepatotoxicity in Brazilian patients. Int J Tuberc Lung Dis 2013;17:499e504. [17] Gupta VH, Amarapurkar DN, Singh M, Sasi P, Joshi JM, Baijal R, Ramegowda PH, Amarapurkar AD, Joshi K, Wangikar PP. Association of Nacetyltransferase 2 and cytochrome P450 2E1 gene polymorphisms with antituberculosis drug-induced hepatotoxicity in Western India. J Gastroenterol Hepatol 2013;28:1368e74. [18] Wang PY, Xie SY, Hao Q, Zhang C, Jiang BF. NAT2 polymorphisms and susceptibility to anti-tuberculosis drug-induced liver injury: a meta-analysis. Int J Tuberc Lung Dis 2012;16:589e95. [19] An HR, Wu XQ, Wang ZY, Zhang JX, Liang Y. NAT2 and CYP2E1 polymorphisms associated with antituberculosis drug-induced hepatotoxicity in Chinese patients. Clin Exp Pharmacol Physiol 2012;39:535e43. [20] Huang YS, Chern HD, Su WJ, Wu JC, Chang SC, Chiang CH, Chang FY, Lee SD. Cytochrome P450 2E1 genotype and the susceptibility to antituberculosis drug-induced hepatitis. Hepatology 2003;37:924e30. [21] Jeovanio-Silva AL, Monteiro TP, El-Jaick KB, do Brasil PE, Rolla VC, de Castro L. Unique CYP3A4 genetic variant in Brazilian tuberculosis patients with/ without HIV. Mol Med Rep 2012;5:153e61. [22] Otto TD, Vasconcellos EA, Gomes LH, Moreira AS, Degrave WM, Mendonca-Lima L, Alves-Ferreira M. ChromaPipe: a pipeline for analysis, quality control and management for a DNA sequencing facility. Genet Mol Res 2008;7:861e71. [23] Rothman KJ, Greenland S. Modern epidemiology. 2nd ed. Philadelphia, PA: Lippincott Williams & Wilkins; 1998. [24] McCullagh P, Nelder JA. Generalized linear models. 2nd ed. London: Chapman & Hall/CRC; 1989. [25] Team RDC. R: a language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2012. [26] Huang YS, Chern HD, Su WJ, Wu JC, Lai SL, Yang SY, Chang FY, Lee SD. Polymorphism of the N-acetyltransferase 2 gene as a susceptibility risk factor for antituberculosis drug-induced hepatitis. Hepatology 2002;35: 883e9. [27] Ohno M, Yamaguchi I, Yamamoto I, Fukuda T, Yokota S, Maekura R, Ito M, Yamamoto Y, Ogura T, Maeda K, Komuta K, Igarashi T, Azuma J. Slow Nacetyltransferase 2 genotype affects the incidence of isoniazid and rifampicin-induced hepatotoxicity. Int J Tuberc Lung Dis 2000;4:256e61. [28] Timbrell JA, Mitchell JR, Snodgrass WR, Nelson SD. Isoniazid hepatoxicity: the relationship between covalent binding and metabolism in vivo. J Pharmacol Exp Ther 1980;213:364e9. [29] Scales MD, Timbrell JA. Studies on hydrazine hepatotoxicity. 1. Pathological findings. J Toxicol Environ Health 1982;10:941e53. [30] Wang T, Yu HT, Wang W, Pan YY, He LX, Wang ZY. Genetic polymorphisms of cytochrome P450 and glutathione S-transferase associated with antituberculosis drug-induced hepatotoxicity in Chinese tuberculosis patients. J Int Med Res 2010;38:977e86. [31] Sun F, Chen Y, Xiang Y, Zhan S. Drug-metabolising enzyme polymorphisms and predisposition to anti-tuberculosis drug-induced liver injury: a metaanalysis. Int J Tuberc Lung Dis 2008;12:994e1002. [32] Lee SW, Chung LS, Huang HH, Chuang TY, Liou YH, Wu LS. NAT2 and CYP2E1 polymorphisms and susceptibility to first-line anti-tuberculosis drug-induced hepatitis. Int J Tuberc Lung Dis 2010;14:622e6. [33] Howard LA, Micu AL, Sellers EM, Tyndale RF. Low doses of nicotine and ethanol induce CYP2E1 and chlorzoxazone metabolism in rat liver. J Pharmacol Exp Ther 2001;299:542e50. [34] Benowitz NL, Peng M, Jacob 3rd P. Effects of cigarette smoking and carbon monoxide on chlorzoxazone and caffeine metabolism. Clin Pharmacol Ther 2003;74:468e74. [35] Pachauri V, Flora SJ. Effect of nicotine pretreatment on arsenic-induced oxidative stress in male Wistar rats. Hum Exp Toxicol 2013;32:972e 82. [36] Yue J, Peng R, Chen J, Liu Y, Dong G. Effects of rifampin on CYP2E1-dependent hepatotoxicity of isoniazid in rats. Pharmacol Res 2009;59:112e9.

C. Zaverucha-do-Valle et al. / Tuberculosis 94 (2014) 299e305 [37] Park J, Kang JW, Lee SM. Activation of the cholinergic anti-inflammatory pathway by nicotine attenuates hepatic ischemia/reperfusion injury via heme oxygenase-1 induction. Eur J Pharmacol 2013;707:61e70. [38] Freedman R. Alpha7-nicotinic acetylcholine receptor agonists for cognitive enhancement in Schizophrenia. Annu Rev Med 2014;65:245e61.

305

[39] Voutsinas J, Wilkens LR, Franke A, Vogt TM, Yokochi LA, Decker R, Le Marchand L. Heterocyclic amine intake, smoking, cytochrome P450 1A2 and N-acetylation phenotypes, and risk of colorectal adenoma in a multiethnic population. Gut 2013;62:416e22.