The role of diclofenac sodium in the dimorphic transition in Candida albicans

Microbial Pathogenesis 48 (2010) 110–115

Contents lists available at ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

The role of diclofenac sodium in the dimorphic transition in Candida albicans Zahra Rashki Ghalehnoo a, Ahmad Rashki a, b, *, Mohsen Najimi b, Angel Dominguez a a b

Departamento de Microbiologı´a y Gene´tica/Instituto de Microbiologı´a Bioquı´mica, Universidad de Salamanca/CSIC, 37007 Salamanca, Spain Faculty of Veterinary Medicine, Department of Physiopathology, University of Zabol, Zabol, Iran

a r t i c l e i n f o

a b s t r a c t

Article history: Received 28 October 2009 Received in revised form 7 December 2009 Accepted 10 December 2009 Available online 22 December 2009

Diclofenac sodium is a non-steroidal anti-inflammatory drug that inhibits filamentation in Candida albicans. Here we examined the effect of diclofenac sodium on hypha formation in C. albicans. The C. albicans cells were treated with various concentrations of diclofenac sodium (50, 100, 200 and 500 mg/ml) and incubated at 37  C for 2 h. The characteristics of hypha formation were then assessed microscopically in both liquid and solid media. The results indicated that the effect of diclofenac sodium was dependent on the concentration of this compound, and preincubation with 500 mg/ml diclofenac sodium completely inhibited hypha formation in both liquid and solid media. RT-qPCR analysis of RNA extracted from C. albicans indicated that the levels of expression of agglutinin-like sequence 3 (ALS3), RAS1, EFG1 mRNA, which are regulated by the cAMP-EFG1 pathway in C. albicans and three hypha-specific genes (ALS1, ECE1 and HWP1), were decreased in diclofenac sodium treated cells compared to the levels in controls. Our results also demonstrated that diclofenac sodium possesses potent anti yeast-hypha transition activity in vitro and it could be useful in combined therapy with conventional antifungal agents in the management of treatment of Candida albicans infections. Ó 2009 Elsevier Ltd. All rights reserved.

Keywords: Non-steroidal anti-inflammatory drug Diclofenac sodium C. albicans Inhibition of hypha formation

1. Introduction Candida albicans, a dimorphic fungus, is an important opportunistic pathogenic species of Candida causes oral thrush, esophageal infection and disseminated candidiasis. It has been realized that the phenotypic divergence of C. albicans, which is controlled by host of factors, is associated with a successful infection and the evasion of anti-Candida drugs. This organism is capable of growing in either of two forms, the budding yeast form or the elongating hyphal form. While both morphological forms bud and hypha are found at the site of infection, the hyphal form is believed to have evolved primarily as the mechanism of tissue penetration [1]. The factors that affect the morphology of fungi are extremely diverse. Environmental signals (pH, temperature, concentrations of oxygen and glucose) are the primary stimuli that switch on genetic programs involving the expression of specific genes [2] and the synthesis of regulatory proteins and enzymes [3,4] which form the biochemical basis of dimorphic growth. They change the enzymatic balance in the cell, cause metabolic rearrangement, and promote adaptation of the corresponding morphological variant to the

* Corresponding author. Faculty of Veterinary Medicine, Department of Physiopathology, University of Zabol, Zabol, Iran. Tel.: þ98 910 5054875; fax: þ98 542 2242509. E-mail address: [email protected] (A. Rashki). 0882-4010/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.micpath.2009.12.003

environmental conditions [5]. Serum is known to be an external factor affecting hypha formation of C. albicans [6,7]. It has been shown that hypha transformation is induced by the activation of the mitogen-activated protein (MAP) kinase cascade and the cAMP pathway, which are controlled by RAS protein [8,9]. Some studies have been demonstrated that EFG1 is present downstream at the RAS1-cAMP pathway [10–13]. EFG1 is a transcription factor and EFG1-deficient mutants are unable to form hypha despite the presence of serum [14,15]. Hypha-specific proteins such as Als1, Als3, Ece1 and Hwp1 are cell wall proteins in C. albicans, and the expressions are regulated by EFG1 [16–18]. Diclofenac sodium is a non-steroidal anti-inflammatory drug and COX inhibitor, which had the greatest inhibitory impact on the growth of Candida biofilms [19]. This drug specifically blocks the biosynthesis of mammalian prostaglandins by the inhibition one or both of the COX isoenzymes [20]. Prostaglandins are small lipid molecules that have diverse biological activities, including the modulation of host immune responses [21]. They are now known to be produced by pathogenic fungi as well as by mammalian cells [22–24]. Both C. albicans and Cryptococcus neoformans secrete prostaglandins de novo or via conversion of exogenous arachidonic acid [23]. However, the effects of diclofenac sodium on the C. albicans hypha formation are unknown. In this study, we investigated the effects of diclofenac sodium on the hypha formation in the liquid and solid media and the cAMP-EFG1 pathway by measuring changes in the hypha formation signals.

Z. Rashki Ghalehnoo et al. / Microbial Pathogenesis 48 (2010) 110–115

2. Materials and methods 2.1. Strains, media, and growth conditions The C. albicans strains SC5314 and CAI4 were used for most experiments in this study. Candida strains were propagated in standard media, including YEPD (1% yeast extract, 2% peptone, 2% dextrose) and YNB (0.17% yeast nitrogen base without amino acids, 0.5% ammonium sulfate, 2% dextrose). Medium for C. albicans CAI4 supplemented with 80 mg/ml uridine as needed, unless otherwise indicated. Batches of medium (50 ml in 250-ml Erlenmeyer flasks) were inoculated from fresh culture slopes and incubated at 28  C in an orbital shaker at 200 rpm. All strains grew exclusively in the budding yeast phase under these conditions. Cells were harvested after 24 h and washed twice in 0.15 M phosphate-buffered saline (PBS; pH 7.2). Stock solution (1 mg/ml) of diclofenac sodium (Sigma) was prepared in dimethyl sulfoxide and used at final concentrations of 50 mg/ml, 100 mg/ml, 200 mg/ml and 500 mg/ml in Lee medium [25]. 2.2. Germ tube formation C. albicans strains SC5314 and CAI4 were grown in minimal medium (MM) or under our condition for the yeast-hypha transition. Cells were pre-grown in Lee medium up to the exponential phase at 28  C, washed, starved in water for 24 h at 4  C, and then resuspended at 107 cells ml_1 in the Lee medium containing either 10 mM proline (Sigma) and 2.5 mM N-acetylglucosamine (Sigma) or 4% fetal bovine serum (Invitrogen). Where indicated, at time zero, diclofenac sodium was added to a final concentration of 500 mg/ml. The cell suspensions were incubated with gentle shaking at 37  C for 2 h and were examined for the percentage of germ tubes present by using a light microscope; 200 cells were counted each time. To induce hyphal development on solid media, C. albicans cells were grown overnight at 28  C in YEPD liquid medium and washed twice with water before being plated. Photomicrographs of colonies and invasive growth were taken with a DMRXA microscope (Leica, Germany). The Lee’s, Spider and SLAHD media were prepared as described previously [25–28]. 2.3. RNA isolation and cDNA preparation C. albicans SC5314 and CAI4 strains were grown in Lee cultures treated with 500 mg/ml diclofenac sodium for 120 min at 37  C during the yeast-hypha transition. Cells were harvested at room temperature, resuspended in a small volume of the supernatant and immediately frozen by releasing small drops of cell samples into liquid nitrogen. Cells were then stored at 80  C till RNA extraction. Total RNA was isolated by breaking cells in a microdismembrator (Braun, Melsungen, Germany), followed by trizol extraction method as described in Galar Fungal standard operating procedures for RNA extraction (http://www.pasteur.fr/recherche/ unites/Galar_Fungail/), keeping the cells frozen in liquid nitrogen at all times. RNA was checked for integrity by electrophoresis and quantified by spectrophotometric analysis at 260 nm. cDNA generated using a Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. 2.4. Real-time quantitative PCR (RT-qPCR) The expression level of selected genes was analyzed by RT-qPCR. Cells were grown in Lee medium as above and treated with 500 mg/ml diclofenac sodium for 120 min at 37  C. An aliquot of the RNA preparations from untreated and treated samples, used for

111

quantitative real-time reverse transcription (RT)-PCR follow-up studies. A portion of each preparation (150 mg) was treated with DNase I, using the DNAFree kit from Ambion. To prepare cDNA, 300 ng DNase-treated RNA was mixed with dNTP mix (Sigma) and oligo dT(18–23) (Sigma) at 70  C for 3 min. Superscript II reverse transcriptase (Invitrogen), 10  RT buffer (Invitrogen), and RNase inhibitor (Promega) were added to this mixture and incubated at 42  C for 1 h. The reaction was terminated by heating at 70  C for 10 min and the resulting mixture was used as cDNA solution. Quantitative real-time PCRs were performed in triplicate using the 7900 Sequence Detection System (Applied Biosystems, Foster City, CA). Primers were designed using Primer Express software (Table 1), and actin was used as an endogenous control. The PCR conditions consisted of Taqman Gold PCR kit activation at 95  C for 15 min, followed by 40 cycles of denaturation at 95  C for 30 s and annealing/extension at 60  C for 1 min. A dissociation curve was generated at the end of each PCR cycle to verify that a single product was amplified using software provided with the 7900 Sequence Detection System. The results are shown as relative expression compared to ACT1.

3. Results 3.1. Diclofenac sodium inhibits formation of germ tubes The effect of diclofenac sodium on filamentous growth was measured with two wild-type strains of C. albicans SC5314 (wildtype clinical isolate) and CAI4 (Dura3 :: imm434/D;ura3 :: imm434) [29]. For the growth of hyphal form, cells were pre-grown in Lee medium up to the exponential phase at 28  C, washed, starved in water for 24 h at 4  C, and then incubated in Lee medium with 4% (v/v) fetal bovine serum at 37  C. C. albicans strains cultured in Lee’s medium containing 4% FBS generally grew in hypha form. When diclofenac sodium was added at 500 mg/ml to the cell suspension, the complete inhibition of germ tube formation of C. albicans strains was observed (Fig. 1). Cultures treated with diclofenac sodium exhibited a dose-dependent inhibition of germ tube formation following 2 h incubation at 37  C (Fig. 2A). Similar

Table 1 DNA primer sequence of C. albicans. Primer

Sequence (50 /30 )

ALS1 (sense) ALS1 (antisense) ALS3 (sense) ALS3 (antisense) EFG1 (sense) EFG1 (antisense) HWP1 (sense) HWP1 (antisense) RAS1 (sense) RAS1 (antisense) CPH1 (sense) CPH1 (antisense) CYR1 (sense) CYR1 (antisense) ECE1 (sense) ECE1 (antisense) NRG1 (sense) NRG1 (antisense) CDC42 (sense) CDC42 (antisense) CST20 (sense) CST20 (antisense) RBT1 (sense) RBT1 (antisense)

CAATGGAGACAACCAAAGTGG TGTGGTGATATCTTCAGTGAT TCAATCCTATACCACTGCTAC ACCTTTATCACCTTCACAGCT ACGTGGTAGAAGAGATGGGA TGCATTAGGAGTTACTCCGG CAGAAGCTTCCATTCCACCT TTTGGAACAGCTGGAGAGGT CAAATCAACAAGGTCAAGACC AGAAGAAACACCTCCATTACC TGCAGTTGCTACTACTGCTG CATGCTTTGATATCCCATGGC GAACCAGATGTTATAACCGG TTCCGGCATTTTCATTGCCC ATGGCGTTCCAGATGTTGG GCAGATTCAGCTGATCTAGT CCAAGAAGAAAACACGTCTG CTGTTGCGTTTGTTTTTCCC TTCCGTCATTTCTCCCGCTT TTCCTGGGTGATTGGGGACA CGGTAACATCAAGATCACTGA GATATAATGCCCTCAATGGAG CAGGTACTGAAACCACTCCA TGTAGTTGGAATAGTACCCTC

Z. Rashki Ghalehnoo et al. / Microbial Pathogenesis 48 (2010) 110–115

A 120 CAI4

100

% cells with germ tubes

results were obtained when cultures were induced by both yeast extract-peptone-dextrose (YEPD) temperature shift and 4% (v/v) fetal bovine serum (data not shown). These findings suggested that diclofenac sodium regulated the hypha transformation of C. albicans cells. One explanation for the lack of germ tubes was diclofenac sodium inhibition of cell proliferation, which would have resulted in a decreased growth rate in treated cultures. The doubling time of cultures of Candida strains in the presence of diclofenac sodium, determined by measuring the increase in optical density at 600 nm (OD600), was slightly affected by concentration sufficient to inhibit morphogenesis (Fig. 2B). For the determination of growth rates, cultures were incubated at 28  C in YEPD medium so that all cells would be yeast form, regardless of the presence of diclofenac sodium. Although it has been reported that lower concentrations (75–100 mg/ml) produced only about 30% inhibition on germ tube formation [19] and inhibits biofilm formation by C. albicans, its dramatic inhibition of hypha formation was unexpected, and it was therefore investigated further on mode of action of diclofenac sodium on hypha development. Diclofenac sodium concentrations of 150 mg can be achieved in humans by the use of therapeutic doses of the drug [30,31], suggesting that the antigerm tube effect observed in vitro might also be relevant in vivo.

SC5314

80 60 40 20 0 0

B

All organisms, from bacteria and yeast to higher eukaryotes, respond to changes that occur in the environment. In C. albicans, the yeast-to-hypha transition is triggered by various environmental cues, such as serum, N-acetylglucosamine (GlcNAc), neutral pH, high temperature, starvation, CO2, and adherence [32]. In recent years, signal transduction pathways and receptors/sensors that may mediate environmental responses have been identified [33] and are key elements in mediating the transduction of many signals generated at the surface to the nucleus. As in Saccharomyces cerevisiae, both MAPK and cAMP-PKA pathways are involved in filamentation in C. albicans [32]. In responses to a wide variety of stresses, including nutritional [34] and environmental stresses [35], C. albicans initiate morphological changes. To clarify the effect of diclofenac sodium on hypha-formation signals, the expression level of some selected genes, CYR1, EFG1 [36], RAS1, CPH1, CST20, CDC42, HWP1, ECE1, and NRG1 belonging to the cAMP-EFG1 pathway, mitogen-activated protein kinase (MAPK) and major morphopathogenic determinants [32] in C. albicans were measured. The ALS family gene is related to the growth and morphological change of C. albicans. ALS family especially, ALS1, ALS3 [37,38] are important in the yeast-to-hypha transformation of C. albicans [37,39]. Thus, we measured the expression of these

100ug/ml

200ug/ ml

500ug/ ml

12 c ont rol (CA I4)

8 SC5314 (t reat ed c ells )

6

CAI4 (t reat ed c ells )

4 2 0 0

3.2. The effect of diclofenac sodium on hypha-formation signals

50ug/ ml

10 OD (600nm)

112

10

20

30

40

Time (h) Fig. 2. Effect of diclofenac sodium on morphogenesis and growth (A) The percentage of cells with germ tubes in each sample was determined by direct microscopic enumeration. A minimum of 200 cells were counted for each sample. Results are means  standard errors of the means of triplicate determinations. (B) Doubling times were determined by measuring the increase in OD 600nm of cultures incubated at 28  C. Microscopic examination of the cultures revealed the absence of germ tubes or hypha and of clumps of cells, all factors that can invalidate the use of optical density to monitor culture growth.

mRNAs to estimate the effect of diclofenac sodium on other morphopathogenic determinants. The mRNA expressions of EFG1, CYR1 and RAS1 were reduced by 500 mg/ml of diclofenac sodium (Fig. 3). Expression of some components of the MAP kinase cascade like CPH1 and CST20 were not affected by 500 mg/ml of diclofenac sodium. In addition, we measured the expression of some of the genes that had been previously recognized as hyphal-specific and major morphopathogenic determinants through independent analyses of differentially induced genes, ALS1, ALS3, ECE1 [40], CDC42, NRG1, RBT1 [41] and HWP1 [42]. The relative mRNA expressions of ALS1, ALS3, CDC42, ECE1, HWP1 and RBT1 were reduced by 500 mg/ml of diclofenac sodium and the relative expression of NRG1 was induced (Fig. 3).

Fig. 1. Growth form of C. albicans cultured with diclofenac sodium in liquid medium. C. albicans was cultured with/without 500 mg/ml diclofenac sodium in Lee’s medium containing 4% FBS at 37  C for 2 h. After incubation, the growth forms of C. albicans were observed microscopically.

Z. Rashki Ghalehnoo et al. / Microbial Pathogenesis 48 (2010) 110–115

4. Discussion

4.5

Relative expression of mRNA

113

4

dic lofenac +

3.5

dic lofenac -

3 2.5 2 1.5 1 0.5

1 PH

ST 20 C

C

C

D

C4 2

G1

E1

R N

EC

BT 1 R

W P1 H

AL S3

1

AL S1

1

YR C

AS R

EF G

1

0

Fig. 3. Relative expressions of mRNAs in C. albicans treated with diclofenac sodium. C. albicans (1  107 cells/ml in Lee’s medium containing 4% FBS) was incubated with/ without 500 mg/ml diclofenac sodium at 37  C for 2 h. After incubation and extraction of RNA, the relative expressions of selected genes were measured as described in Materials and methods. Results are means  standard errors of the means of triplicate determinations.

3.3. Behaviour of the diclofenac sodium treated cells in solid media For the observation of filamentous growth on solid media, cells of the C. albicans strains were plated at 50 ufc on plates. Solid media normally induce filamentous growth after 5 days. The untreated cells displayed normal filamentous growth, with long chains of hypha growing outwards from the colony (Fig. 4). In contrast, the diclofenac sodium treated cells were defective for filamentous growth in all media assayed. The colonies had completely smooth edges and all cells examined were in the budding yeast form (data not shown). Consistent with this hypothesis, diclofenac sodium was found to inhibit completely the formation of germ tubes in solid media in C. albicans. We also observed that, like other solid media, the diclofenac sodium treated cell was unable to form hypha in Embedded medium (Fig. 4).

The morphological switch from yeast-to-hypha is one of the most important biological features that enable C. albicans to colonize, invade, and survive in the host tissues during infection. Environmental conditions determine the growth mode of C. albicans. This organism can undergo a significant change in morphogenesis, due to environmental conditions, which are controlled by a complex network of parallel pathways (e.g. MAPK and cAMP-PKA pathways) [32]. Thus, any interference with the expression of genes involved in the MAPK cascades and cAMP-PKA pathway can block filamentation in C. albicans. To clarify the effect of diclofenac sodium on the indicators of the hyphal formation signal, the expressions of C. albicans CYR1, EFG1, RAS1 in the cAMP-EFG1 pathway and CPH1, CST20 in the MAPK pathway were measured. In addition, the expressions of EFG1 target genes (ALS1, ALS3, ECE1 and HWP1) and some selected genes from morphopathogenic determinants in C. albicans (CDC42, NRG1 and RBT1) also were measured. We showed that the expression of EFG1 target genes is repressed by diclofenac sodium (Fig. 3). Adherence of microorganisms to surfaces and hypha formation involve numerous factors such as cell hydrophobicity, electrostatic forces and specific adhesins. Among the C. albicans adhesion molecules and hypha specefic genes, the ALS (agglutinin-like sequence) gene family, which encodes cell surface glycoproteins, is of major importance. Previously, we described that the expression level of the ALS1 and ALS3 genes are increased in the yeast-hypha transition (unpublished data), suggesting its potential role in the development of C. albicans microbial communities. Another well-characterised C. albicans hypha specefic gene is the glycosylphosphatidylinositol (GPI)-linked cell surface protein Hwp1. Functional analyses showed that this protein is required for the adherence of fungal cells to epithelial cells as well as for normal biofilm and hypha formation [43,44]. Here, we have provided evidence that the inhibitory effect of diclofenac sodium on C. albicans hypha formation in both solid and liquid

Fig. 4. Morphology of colonies on different solid media. SC5314 and CAI4 were grown on solid media with/without diclofenac sodium (500 mg/ml) which induce hyphal development. The plates were incubated for 5 days at 37  C.

114

Z. Rashki Ghalehnoo et al. / Microbial Pathogenesis 48 (2010) 110–115

media (Figs. 1 and 4) may be associated with its action on the expression of some adhesin genes. As expected, C. albicans filamentation induced by fetal bovine serum resulted in upregulation of ALS1, ALS3 and HWP1 adhesin genes as shown by quantitative reverse transcriptase polymerase chain reaction (Fig. 3). However, addition of diclofenac sodium represses the upregulation of these genes, corroborating its inhibitory effect on filamentation of Candida albicans. This result, together with those described by Alems group [19] may explain the effect of diclofenac sodium on C. albicans hypha and biofilm development. ALS1, ALS3 and HWP1 genes are regulated by EFG1, which is an important regulator of C. albicans morphogenetic processes. Of cAMP pathway, C. albicans Ras1 is an important regulator of hyphal development, and is likely to function upstream of the cAMP pathway [45]. The relative expression of RAS1 in response to extracellular diclofenac sodium was repressed suggesting that diclofenac sodium may functioned upstream of the RAS1 signal pathway and blocked the expression of the hyphal formation signal. Efg1, a basic helix-loop-helix (bHLH) protein and similar to the Phd1 and Sok2 of S. cerevisiae, plays a major role in hyphal morphogenesis [18,46] was also repressed by diclofenac sodium. efg1/efg1 null mutant strains do not form hypha under most hyphainducing conditions, including serum and are defective in the induction of hypha-specific genes. Finally, adenylate cyclase is a component of the cAMP-EFG1 pathway, and CYR1 encodes adenylate cyclase of C. albicans [47]. The expression of CYR1 mRNA was reduced by diclofenac sodium (Fig. 3). Thus, these findings suggest that diclofenac sodium disrupts the cAMP-EFG1 pathway. Of MAPK pathway, the expression levels of two selected genes (CST20 and CPH1) were not affected by diclofenac sodium. Null mutations in any of the genes in the MAPK cascade (Cst20) or the transcription factor Cph1 confer a hyphal defect on solid media in response to many inducing conditions; however, all of these mutants filament normally in response to serum. Our results indicate that diclofenac sodium inhibited hypha formation of C. albicans in both soild and liquid media by interrupting the cAMPEFG1 pathway, but did not affect the MAP kinase cascade. As the addition of diclofenac sodium affected the cAMP-EFG1 pathway of C. albicans, it was shown that EFG1 expression could be controlled by extracellular stimulation medicine. Although diclofenac sodium is used as antianalgesic in clinical medicine, the recommended blood level for treatment not greatly differ from the concentration for inhibition of the hypha formation. Thus, diclofenac sodium might be useful as a treatment for C. albicans infection. This study reveals that diclofenac sodium has a potential inhibitory effect on C. albicans hypha formation in vitro. The mode of action of diclofenac sodium on biofilm development [19] is closely related to its effect on C. albicans filamentation. Diclofenac sodium inhibits germ tube formation by repressing the cAMP-EFG1 pathway of C. albicans. Consequently, the expression of EFG1 target genes (e.g. ALS1, ALS3 and HWP1) is also repressed by diclofenac sodium. Thus, inhibition of indicators of the hyphal formation signal in C. albicans results in prevention of the hyphal formation. These results and those decribed by Alems group [19] open a new view regarding the use of this compound in the treatment of implantable medical devices in order to prevent C. albicans biofilm formation. However, it is expected that diclofenac sodium, as a non-steroidal antiinflammatory, would effectively control the expression of EFG1 and some morphopathogenic determinants (RAS1 [48], CDC42 [49,50], NRG1 [51–53], HWP1 [42,54,55], ALS3 [56] and ALS1 [57,58]) of C. albicans. These results altogether suggest that the recently discovered fungal prostaglandin(s) may be involved in yeast-hypha transition in C. albicans. However, more investigations about the effects of diclofenac sodium on hypha formation signal and the

possible interacion between C. albicans and NSAIDs such as diclofenac sodium during infections are going to be done. Acknowledgments Zahra Rashki Ghalehnoo is the recipient of a research studentship from the Ministry of Science of Islamic republic of Iran. References [1] Whiteway M, Bachewich C. Morphogenesis in Candida albicans. Annual Review of Microbiology 2007;61:529–53. [2] Ghormade V, Deshpande MV. Fungal spore germination into yeast or mycelium: possible implications of dimorphism in evolution and human pathogenesis. Die Naturwissenschaften 2000;87:236–40. [3] Amin A, Joshi M, Deshpande MV. Morphology-associated expression of NADPdependent glutamate dehydrogenases during yeast-mycelium transition of a dimorphic fungus Benjaminiella poitrasii. Antonie van Leeuwenhoek 2004;85:327–34. [4] Niimi M, Shepherd MG, Monk BC. Differential profiles of soluble proteins during the initiation of morphogenesis in Candida albicans. Archives of Microbiology 1996;166:260–8. [5] Mysiakina IS, Funtikova NS. The role of sterols in morphogenetic processes and dimorphism in fungi. Mikrobiologiia 2007;76:5–18. [6] Enloe B, Diamond A, Mitchell AP. A single-transformation gene function test in diploid Candida albicans. Journal of Bacteriology 2000;182:5730–6. [7] Chiew YY, Shepherd MG, Sullivan PA. Regulation of chitin synthesis during germ-tube formation in Candida albicans. Archives of Microbiology 1980;125:97–104. [8] Chen J, Zhou S, Wang Q, Chen X, Pan T, Liu H. Crk1, a novel Cdc2-related protein kinase, is required for hyphal development and virulence in Candida albicans. Molecular and Cellular Biology 2000;20:8696–708. [9] Schroppel K, Sprosser K, Whiteway M, Thomas DY, Rollinghoff M, Csank C. Repression of hyphal proteinase expression by the mitogen-activated protein (MAP) kinase phosphatase Cpp1p of Candida albicans is independent of the MAP kinase Cek1p. Infection and Immunity 2000;68:7159–61. [10] Felk A, Kretschmar M, Albrecht A, Schaller M, Beinhauer S, Nichterlein T, et al. Candida albicans hyphal formation and the expression of the Efg1-regulated proteinases Sap4 to Sap6 are required for the invasion of parenchymal organs. Infection and Immunity 2002;70:3689–700. [11] Phan QT, Belanger PH, Filler SG. Role of hyphal formation in interactions of Candida albicans with endothelial cells. Infection and Immunity 2000;68: 3485–90. [12] Jung WH, Stateva LI. The cAMP phosphodiesterase encoded by CaPDE2 is required for hyphal development in Candida albicans. Microbiology (Reading, England) 2003;149:2961–76. [13] Wilson D, Tutulan-Cunita A, Jung W, Hauser NC, Hernandez R, Williamson T, et al. Deletion of the high-affinity cAMP phosphodiesterase encoded by PDE2 affects stress responses and virulence in Candida albicans. Molecular Microbiology 2007;65:841–56. [14] Bachewich C, Thomas DY, Whiteway M. Depletion of a polo-like kinase in Candida albicans activates cyclase-dependent hyphal-like growth. Molecular Biology of the Cell 2003;14:2163–80. [15] Rademacher F, Kehren V, Stoldt VR, Ernst JF. A Candida albicans chaperonin subunit (CaCct8p) as a suppressor of morphogenesis and Ras phenotypes in C. albicans and Saccharomyces cerevisiae. Microbiology (Reading, England) 1998;144(Pt 11):2951–60. [16] Zhao X, Oh SH, Cheng G, Green CB, Nuessen JA, Yeater K, et al. ALS3 and ALS8 represent a single locus that encodes a Candida albicans adhesin; functional comparisons between Als3p and Als1p. Microbiology (Reading, England) 2004;150:2415–28. [17] Zhao X, Daniels KJ, Oh SH, Green CB, Yeater KM, Soll DR, et al. Candida albicans Als3p is required for wild-type biofilm formation on silicone elastomer surfaces. Microbiology (Reading, England) 2006;152:2287–99. [18] Stoldt VR, Sonneborn A, Leuker CE, Ernst JF. Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. Embo Journal 1997;16:1982–91. [19] Alem MA, Douglas LJ. Effects of aspirin and other nonsteroidal anti-inflammatory drugs on biofilms and planktonic cells of Candida albicans. Antimicrobial Agents and Chemotherapy 2004;48:41–7. [20] Dannhardt G, Kiefer W. Cyclooxygenase inhibitors – current status and future prospects. European Journal of Medicinal Chemistry 2001;36:109–26. [21] Harris SG, Padilla J, Koumas L, Ray D, Phipps RP. Prostaglandins as modulators of immunity. Trends in Immunology 2002;23:144–50. [22] Noverr MC, Erb-Downward JR, Huffnagle GB. Production of eicosanoids and other oxylipins by pathogenic eukaryotic microbes. Clinical Microbiology Reviews 2003;16:517–33. [23] Noverr MC, Phare SM, Toews GB, Coffey MJ, Huffnagle GB. Pathogenic yeasts Cryptococcus neoformans and Candida albicans produce immunomodulatory prostaglandins. Infection and Immunity 2001;69:2957–63.

Z. Rashki Ghalehnoo et al. / Microbial Pathogenesis 48 (2010) 110–115 [24] Noverr MC, Toews GB, Huffnagle GB. Production of prostaglandins and leukotrienes by pathogenic fungi. Infection and Immunity 2002;70:400–2. [25] Lee KL, Buckley HR, Campbell CC. An amino acid liquid synthetic medium for the development of mycelial and yeast forms of Candida albicans. Sabouraudia 1975;13:148–53. [26] Liu H, Kohler J, Fink GR. Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science (New York, NY) 1994;266: 1723–6. [27] Castilla R, Passeron S, Cantore ML. N-acetyl-D-glucosamine induces germination in Candida albicans through a mechanism sensitive to inhibitors of cAMPdependent protein kinase. Cellular Signalling 1998;10:713–9. [28] Buffo J, Herman MA, Soll DR. A characterization of pH-regulated dimorphism in Candida albicans. Mycopathologia 1984;85:21–30. [29] Fonzi WA, Irwin MY. Isogenic strain construction and gene mapping in Candida albicans. Genetics 1993;134:717–28. [30] Brogden RN, Heel RC, Pakes GE, Speight TM, Avery GS. Diclofenac sodium: a review of its pharmacological properties and therapeutic use in rheumatic diseases and pain of varying origin. Drugs 1980;20:24–48. [31] Brooks PM, Day RO. Nonsteroidal antiinflammatory drugs–differences and similarities. The New England Journal of Medicine 1991;324:1716–25. [32] Biswas S, Van Dijck P, Datta A. Environmental sensing and signal transduction pathways regulating morphopathogenic determinants of Candida albicans. Microbiology and Molecular Biology Reviews 2007;71:348–76. [33] Brega E, Zufferey R, Mamoun CB. Candida albicans Csy1p is a nutrient sensor important for activation of amino acid uptake and hyphal morphogenesis. Eukaryotic Cell 2004;3:135–43. [34] Vilella F, Herrero E, Torres J, de la Torre-Ruiz MA. Pkc1 and the upstream elements of the cell integrity pathway in Saccharomyces cerevisiae, Rom2 and Mtl1, are required for cellular responses to oxidative stress. Journal of Biological Chemistry 2005;280:9149–59. [35] Garcia-Rodriguez LJ, Valle R, Duran A, Roncero C. Cell integrity signaling activation in response to hyperosmotic shock in yeast. FEBS Letters 2005;579:6186–90. [36] Doedt T, Krishnamurthy S, Bockmuhl DP, Tebarth B, Stempel C, Russell CL, et al. APSES proteins regulate morphogenesis and metabolism in Candida albicans. Molecular Biology of the Cell 2004;15:3167–80. [37] Hoyer LL, Payne TL, Bell M, Myers AM, Scherer S. Candida albicans ALS3 and insights into the nature of the ALS gene family. Current Genetics 1998;33: 451–9. [38] Green CB, Zhao X, Hoyer LL. Use of green fluorescent protein and reverse transcription-PCR to monitor Candida albicans agglutinin-like sequence gene expression in a murine model of disseminated candidiasis. Infection and Immunity 2005;73:1852–5. [39] Hoyer LL. The ALS gene family of Candida albicans. Trends in Microbiology 2001;9:176–80. [40] Birse CE, Irwin MY, Fonzi WA, Sypherd PS. Cloning and characterization of ECE1, a gene expressed in association with cell elongation of the dimorphic pathogen Candida albicans. Infection and Immunity 1993;61:3648–55. [41] Braun BR, Head WS, Wang MX, Johnson AD. Identification and characterization of TUP1-regulated genes in Candida albicans. Genetics 2000;156:31–44.

115

[42] Sharkey LL, McNemar MD, Saporito-Irwin SM, Sypherd PS, Fonzi WA. HWP1 functions in the morphological development of Candida albicans downstream of EFG1, TUP1, and RBF1. Journal of Bacteriology 1999;181:5273–9. [43] Nobile CJ, Schneider HA, Nett JE, Sheppard DC, Filler SG, Andes DR, et al. Complementary adhesin function in C. albicans biofilm formation. Current Biology 2008;18:1017–24. [44] Padovan AC, Chaves GM, Colombo AL, Briones MR. A novel allele of HWP1, isolated from a clinical strain of Candida albicans with defective hyphal growth and biofilm formation, has deletions of Gln/Pro and Ser/Thr repeats involved in cellular adhesion. Medical Mycology 2009:1–13. [45] Liu H. Transcriptional control of dimorphism in Candida albicans. Current Opinion in Microbiology 2001;4:728–35. [46] Lo HJ, Kohler JR, DiDomenico B, Loebenberg D, Cacciapuoti A, Fink GR. Nonfilamentous C. albicans mutants are avirulent. Cell 1997;90:939–49. [47] Jain P, Akula I, Edlind T. Cyclic AMP signaling pathway modulates susceptibility of candida species and Saccharomyces cerevisiae to antifungal azoles and other sterol biosynthesis inhibitors. Antimicrobial Agents and Chemotherapy 2003;47: 3195–201. [48] Feng Q, Summers E, Guo B, Fink G. Ras signaling is required for serum-induced hyphal differentiation in Candida albicans. Journal of Bacteriology 1999;181: 6339–46. [49] Hazan I, Liu H. Hyphal tip-associated localization of Cdc42 is F-actin dependent in Candida albicans. Eukaryotic Cell 2002;1:856–64. [50] Ushinsky SC, Harcus D, Ash J, Dignard D, Marcil A, Morchhauser J, et al. CDC42 is required for polarized growth in human pathogen Candida albicans. Eukaryotic Cell 2002;1:95–104. [51] Braun BR, Kadosh D, Johnson AD. NRG1, a repressor of filamentous growth in C. albicans, is down-regulated during filament induction. Embo Journal 2001;20: 4753–61. [52] Murad AM, d’Enfert C, Gaillardin C, Tournu H, Tekaia F, Talibi D, et al. Transcript profiling in Candida albicans reveals new cellular functions for the transcriptional repressors CaTup1, CaMig1 and CaNrg1. Molecular Microbiology 2001;42:981–93. [53] Murad AM, Leng P, Straffon M, Wishart J, Macaskill S, MacCallum D, et al. NRG1 represses yeast–hypha morphogenesis and hypha-specific gene expression in Candida albicans. Embo Journal 2001;20:4742–52. [54] Staab JF, Bradway SD, Fidel PL, Sundstrom P. Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1. Science 1999;283:1535–8. [55] Tsuchimori N, Sharkey LL, Fonzi WA, French SW, Edwards JE, Filler SG. Reduced virulence of HWP1-deficient mutants of Candida albicans and their interactions with host cells. Infection and Immunity 2000;68:1997–2002. [56] Spellberg BJ, Ibrahim AS, Avanesian V, Fu Y, Myers C, Phan QT, et al. Efficacy of the anti-Candida rAls3p-N or rAls1p-N vaccines against disseminated and mucosal candidiasis. The Journal of Infectious Diseases 2006;194:256–60. [57] Fu Y, Ibrahim AS, Sheppard DC, Chen YC, French SW, Cutler JE, et al. Candida albicans Als1p: an adhesin that is a downstream effector of the EFG1 filamentation pathway. Molecular Microbiology 2002;44:61–72. [58] Loza L, Fu Y, Ibrahim AS, Sheppard DC, Filler SG, Edwards JE. Functional analysis of the Candida albicans ALS1 gene product. Yeast 2004;21:473–82.