The role of glucocorticoid and mineralocorticoid receptor DNA methylation in antenatal depression and infant stress regulation

Psychoneuroendocrinology 115 (2020) 104611

Contents lists available at ScienceDirect

Psychoneuroendocrinology journal homepage: www.elsevier.com/locate/psyneuen

The role of glucocorticoid and mineralocorticoid receptor DNA methylation in antenatal depression and infant stress regulation

T

Megan Galballya,b,c,*, Stuart J. Watsona,b, Marinus van IJzendoorni, Richard Safferyd, Joanne Ryand,e, Edo Ronald de Kloetg, Tim F. Oberlanderh, Martha Lappasf, Andrew J. Lewisa a

School of Psychology and Exercise Science, Murdoch University, Australia School of Medicine, University of Notre Dame, Australia c King Edward Memorial Hospital, Australia d Murdoch Children’s Research Institute & Department of Paediatrics, The University of Melbourne, Australia e Department of Epidemiology & Preventive Medicine, Monash University, Australia f Obstetrics, Nutrition and Endocrinology Group, Department of Obstetrics and Gynaecology, University of Melbourne, Victoria, Australia g Leiden University Medical Center, Leiden, Netherlands h Department of Pediatrics and School of Population and Public Health, Univeristy of British Columbia, Vancouver, BC, Canada i Department of Psychology, Education and Child Studies, Erasmus University Rotterdam, Netherlands b

A R T I C LE I N FO

A B S T R A C T

Keywords: DNA methylation Depression Antidepressants Pregnancy Glucocorticoid receptor Cortisol Mineralocorticoid receptor

Understanding fetal programming pathways that underpin the relationship between maternal and offspring mental health necessitates an exploration of potential role of epigenetic variation in early development. Two genes involved in stress response regulation, the glucocorticoid and mineralocorticoid receptors (NR3C1 and NR3C2) have been a focus in understanding stressful exposures and mental health outcomes. Data were obtained from 236 pregnant women from the Mercy Pregnancy Emotional Wellbeing Study (MPEWS), a selected pregnancy cohort, recruited in early pregnancy. Depression was measured using the Structured Clinical Interview for DSM-IV (SCID-IV) and repeated measures of the Edinburgh Postnatal Depression Scale (EPDS). Antidepressant use, stressful events and anxiety symptoms were measured. NR3C1 and NR3C2 DNA methylation was measured in placental and infant buccal samples. Infant cortisol was measured in repeat saliva samples across a task. This study found maternal early pregnancy depressive disorder and symptoms were associated with lower DNA methylation at NR3C2 CpG_24 in placental tissue. There were no significant differences for depression or antidepressant use for DNA methylation of NR3C1. Antenatal depression was associated with lower infant cortisol reactivity at 12 months. DNA methylation in CpG_24 site in NR3C2 in placental samples suppressed the relationship between early maternal depressive symptoms and infant cortisol reactivity. These findings show a relationship between antenatal depression, NR3C2 DNA methylation and infant cortisol response providing support for a specific fetal programming pathway. Further research is required to examine the stability of this epigenetic mark across childhood and long-term mental health outcomes.

1. Introduction The end product of the hypothalamus-pituitary-adrenal (HPA) axis, cortisol, has a profound feedback action on the brain. This action exerted by cortisol is mediated in complementary manner by mineralocorticoid- (MR) and glucocorticoid receptors (GR) (de Kloet et al., 2005; de Kloet et al., 2016). While cortisol action is genetically programmed, early life experiences and stressors have a substantial influence (de Kloet et al., 1998; Francisco Juruena et al., 2015; Nasca et al., 2015; Ryan et al., 2018). A key fetal and early life programming

⁎

mechanism is the epigenetic regulation of the expression of MR and GR and their responsive genes with the potential to shape the HPA axis during fetal development and therefore the child’s later stress response regulation (Glover et al., 2010; Provencal et al., 2019; Ryan et al., 2017) The development of the HPA axis and consequent capacity for regulation of the stress response undergoes significant change over the first year of life. One mechanism that is relevant in understanding how this might be shaped by environmental influences such as maternal mental health is epigenetics (Ryan et al., 2018). Epigenetics refers to a

Corresponding author at: Murdoch University, 90- South Street, Murdoch, 6150, Australia. E-mail address: [email protected] (M. Galbally).

https://doi.org/10.1016/j.psyneuen.2020.104611 Received 12 May 2019; Received in revised form 2 December 2019; Accepted 3 February 2020 0306-4530/ © 2020 Published by Elsevier Ltd.

Psychoneuroendocrinology 115 (2020) 104611

M. Galbally, et al.

potential epigenetic regulation. These include FKBP5 involved in ultrashort feedback regulation of GR expression, and corticotropin releasing hormone (CRH), vasopressin, ACTH and their receptors as drivers of HPA axis activity (Babenko et al., 2015; Mulder et al., 2017). In this study we firstly examine associations between antenatal maternal depression and both placental and infant buccal NR3C1 and NR3C2 DNA methylation. Secondly, we sought to investigate whether there is any difference in associations in DNA methylation of NR3C1 and NR3C2 in placental or infant buccal samples for those exposed to antidepressant medication in pregnancy compared to maternal depression not using antidepressant medication and also healthy control women. Then, within a mediation model, we tested whether variation in NR3C1 and NR3C2 DNA methylation in either placental or infant buccal cells mediated the relationship between maternal depression in pregnancy and infant cortisol reactivity at 12 months of age in the context of a separation-reunion stressful task with the mother.

range of mechanisms that regulate changes in DNA expression rather than its nucleotide sequence (Kiefer, 2007). While there are many potentially important epigenetic mechanisms, DNA methylation is often an area of focus as it is a key regulating mechanism for stability of transcription (Jin et al., 2011; Kiefer, 2007; Ryan et al., 2018). In understanding DNA methylation as a pathway for fetal programming, both placental and newborn biosamples may be of equal relevance (Nugent and Bale, 2015). While the cross-tissue experiment of human progenitor hippocampus cells and the newborn’s cord blood undertaken by Provençal et al. (2019) has to our knowledge not been extended to placenta, there is support to suggest that DNA methylation within placenta may be relevant to the understanding of priming for later stress regulation. The placenta is an endocrine organ that comprises of both maternal and fetal cells and co-ordinates a range of immune and endocrine maternal-fetal interactions important for early neurodevelopment (Hsiao and Patterson, 2012). Furthermore, the placenta has a key role in the development of the HPA axis and the programming of this by early life stress through regulation of exposure to glucocorticoids by the action of 11β-Hydroxysteroid dehydrogenase type 2 (11β-HSD2) (Chapman et al., 2013; Glover et al., 2010; Nugent and Bale, 2015; O’Donnell et al., 2012; Seth et al., 2015). While regulation and expression of placental enzymes, such as 11β-HSD2, have been explored for a potential programming effect of the fetal HPA axis, there has not been as extensive an exploration of placental DNA methylation of MR and GR (Novakovic and Saffery, 2012). A recent systematic review by Turecki and Meaney examined current research on the effects of social stressors and environmental influences on GR gene methylation in a wide range of subjects from infancy to adulthood and across various tissue samples (Turecki and Meaney, 2016). While there was inconsistency of findings with reports of higher, lower or invariant DNA methylation of GR in association with fetal stress exposure, the majority of studies did show alterations in DNA methylation and histone acetylation of the NR3C1 exon 1F which can modulate differential GR mRNA expression in response to early social environmental stress (Turecki and Meaney, 2016; Weaver et al., 2004). However, the authors noted that few studies directly examined offspring stress regulation or cortisol as outcomes. A meta-analysis conducted in 2015 specifically examining stress in pregnancy and offspring GR methylation in promoter region. Of the five common CpG units across 7 studies, they found only one significant association with a positive correlation with antenatal maternal stress and GR CpG unit 36 (r = .14, 95 % CI .05–.23) (Palma-Gudiel et al., 2015). The neighbouring CpG unit 35 was found to correlate at r = 0.10 with maternal antenatal stress but the confidence interval at 95 % sensitivity was -0.01 to 0.21 in 977 subjects. This review identified inconsistency in definition of maternal stressors and reporting of timing of the stressful experiences or symptoms in pregnancy. A recent review of infant DNA methylation and maternal stress without a focus on a specific gene identified a mix of epigenome wide association studies (EWAS) and candidate gene studies. The authors found 12 of the 23 identified studies examined NR3C1 DNA methylation and while there has been an interest in the relationship between stress and NR3C2 methylation there were no identified studies that had examined maternal stress and infant NR3C2 methylation (Sosnowski et al., 2018). Yet the balance between GR and MR functioning is critical for cortisol feedback control of the HPA axis and postulated to be important for understanding vulnerability to depression (de Kloet et al., 2005a, 2018; de Kloet et al., 1998; Francisco Juruena et al., 2015). Indeed, MR has been shown to strongly influence appraisal processes, memory retrieval and selection of coping style as part of the initial response to stress and as such can be important in understanding the effects of chronic stress exposures such as may be relevant to impacts across pregnancy on the fetal environment (de Kloet et al., 2005; de Kloet et al., 2018; ter Heegde et al., 2015). While GR and MR are important in understanding stress regulation and mental health they are by no means the only important HPA axis gene transcripts subject to

2. Methods 2.1. Participants Mercy Pregnancy Emotional Wellbeing Study (MPEWS) is a prospective cohort study and this current study draws on 236 pregnant women recruited before the 20th week of pregnancy (Wave 1) and followed up during third trimester (Wave 2), at birth (Wave 3), and six months (Wave 4) and 12 months (Wave 5) in Melbourne, Australia. This study utilised data and samples from Waves 1-5. Women were excluded from analysis as missing if they had withdrawn prior to or at Wave 3, if they were missing both postpartum waves, or if they were missing both epigenetics and infant salivary cortisol data at 12 months. Study participants comprised three groups: women taking antidepressant medication in pregnancy (AD exposed; n = 43), nonmedicated women who met diagnostic criteria for depression or dysthymia at recruitment (Depressed; n = 24), and control women (n = 169). Further details of the study and the whole cohort are described in the published study protocol (Galbally et al., 2017a). It is worth noting that the demographic characteristics of the sample analysed here do not differ significantly to the full baseline MPEWS cohort (n = 282) demographic characteristics reported in the published study protocol. The Mercy Health Human Research Ethics Committee approved this study and all participants provided written, informed consent. 2.2. Measures 2.2.1. Mental health Mental health in mothers is measured using both diagnostic as well as symptom based measures. This ensures that clinical depressive disorders can be distinguished from sub-threshold symptoms of distress (Matthey, 2010). In addition, by having repeat symptom measures there is the capacity to see chronicity of symptoms. At recruitment, the Structured Clinical Interview for DSM-IV (SCID-IV) Mood disorders schedule was administered (First et al., 1997). In addition, the Edinburgh Postnatal Depression Scale (EPDS) was administered at Waves 1, 2, 4 and 5 (Cox et al., 1987). The scale has been validated for use with Australian women during the perinatal period (Boyce et al., 1993). The State-Trait Anxiety Inventory (STAI) was also administered at Waves 1, 2, 4 and 5 has been validated for use in Australian women in pregnancy (Grant et al., 2008). 2.2.2. Stressful life events Women completed a 23-item stressful life events scale (Brown et al., 2011) to determine the incidence of both common and pregnancyspecific life stressors at recruitment and in third trimester. This scale has been adapted from Pregnancy Risk Assessment Monitoring System (PRAMS) for the Australian context. We created an index scale by summing all items for each woman to create a variable for the total 2

Psychoneuroendocrinology 115 (2020) 104611

M. Galbally, et al.

2.2.6. Sociodemographic characteristics During the study, a range of sociodemographic data are collected. These data include maternal age, ethnicity, educational attainment (both level of high school completion and tertiary study completion), employment status, relationship status, and smoking and alcohol consumption, and infant gender (0 = female, 1 = male).

number of stressful life events. 2.2.3. Antidepressant use Antidepressant type, usage, dosage and timing during pregnancy was self-reported by women, as well as obtained from hospital records at delivery. As the majority of participants were on sertraline, all doses of antidepressants were converted to a sertraline-equivalent dosage using a conversion chart (Procyshyn et al., 2017). Maternal blood and cord blood was collected and analysed for antidepressant drug levels to confirm usage and exposure (Galbally et al., 2017).

2.3. Data cleaning and analyses Methylation variance for several placental and buccal cell NR3C1 units was limited, such that as little as 80 % and as much as 95 % of cases returned methylation levels below one per cent. These CpG units were excluded from the analyses. These units were placental CpGs 14 & 47, and buccal cell CpGs 14, 36, 38_39, and 47. In addition, limited variance was also observed for several placental and buccal cell NR3C2 CpG units; these units were placental CpGs 1 and 8_9, and buccal cell CpGs 1, 6, 8_9, and 12. Data from the remaining CpG units were used in the analyses. Unless otherwise specified, all analyses were conducted using SPSS version 24. For multiple hypothesis testing and pairwise comparisons of differential CpG methylation within tissue (i.e., placenta, buccal) and within gene (i.e., NR3C1, NR3C2), we control for the False Discovery Rate (FDR) using the Benjamini-Hochberg procedure (Benjamini and Hochberg, 1995). We selected an FDR of 0.25 to determine significance due to the exploratory aims of the study and this has been reported as appropriate for exploratory analyses such as this study (Benjamini and Hochberg, 1995). To explore the differences in NR3C1 and NR3C2 CpG methylation in placental and buccal cell tissue between antidepressant-exposed, nonmedicated depressed and control groups, we conducted a series of univariate ANOVA tests. Where the Levene’s test of homogeneity of variance indicated a violation, we report the results of a Welch’s F test. Tukey’s pairwise comparisons were examined where omnibus F tests remained significant following FDR adjustment; Dunnet’s C pairwise comparisons were examined where Welch’s F tests remained significant following FDR adjustment. We then explored the bivariate associations between NR3C1 and NR3C2 CpG methylation from both placental and buccal cell tissue, with maternal depressive and anxious symptoms and stressful life events at both early pregnancy and third trimester using Pearson’s correlation coefficients. As total SLES variables were skewed to the right, Spearman’s rho correlations were used to assess associations between stressful life events and methylation data. To address our hypotheses regarding infant cortisol reactivity, we conducted a series of ANCOVA tests. In each ANCOVA, baseline cortisol level was included as a covariate. We then assessed partial associations between 12-month infant cortisol AUCI, and both placental and buccal cell NR3C1 and NR3C2 methylation controlling for baseline 12-month salivary cortisol. Finally, where there were bivariate associations between antenatal maternal mental health and NR3C1 and NR3C2 methylation, and between NR3C1 and NR3C2 methylation and infant cortisol AUCI, we tested for a potential indirect effect (Hayes, 2009) from maternal antenatal mental health to infant cortisol AUCI via CpG methylation. We used Mplus version 8 to conduct the models addressing indirect effect hypotheses. Due to multivariate non-normality in the model and the need to test inferentially the indirect effect, we bootstrapped bias-corrected standard errors and 95 % confidence intervals using 1000 bootstrap samples and maximum likelihood estimation.

2.2.4. Genomic DNA isolation and NR3C1 and NR3C2 methylation assays Placenta was collected at delivery and processed within 30 min of delivery. Its weight (in grams) was recorded. Biopsies were taken from each placenta, cleaned, snap frozen in liquid nitrogen and stored at −80 °C. Buccal cells were collected from cheek swabs on the infant within 3 days of delivery and these were also stored at −80 °C. DNA was extracted from placenta biopsies and buccal swabs using the QIAamp DNA Mini Kit for tissue (QIAGEN). Genomic DNA was bisulphite converted using the EZ-96 DNA Methylation-LightningTM MagPrep kit (Irvine, USA). Two amplification assays were designed using EpiDesigner software (www.epidesigner.com). The first targeted a region of CpG island in the NR3C1 promoter that has been frequently identified as differentially methylated in prior studies (Turecki and Meaney, 2016). Primers (F- 5′ TTTAATTTTTTAGGAAAAAGGGTGG 3′ and R- 5′ CCCTAAAACCTCCC CAAAAA AC 3′) amplified a 403bp region of the NR3C1 1F promoter (hg18: chr5:142763696-142764098), which covered 47 CpG units. Using Sequenom Mass Array, methylation data was generated for 16CpG units. The second assay targeted a 385bp region in the CpG island of the promoter region of NR3C2. There has been a dearth of previous studies investigating DNA methylation of this gene. The forward primer 5′- GTTAGTTGGAGGGTTGGTTTTTTTA -3′ and reverse 5′TCACATCTCTCCAAATATCCTAAAATC -3′ amplified a 385bp region (hg 38: chr4:148442497-148442881) covering 25 CpGs sites, providing DNA methylation for 13 CpG units. This is near exon1A. In both cases, the forward primers contained a balance tag (AGGAAGAGAG) and the reverse primers contained a T7 tag. PCR amplification of the regions of interest was performed in technical triplicates for all participant samples. Following in vitro transcription and cleavage, DNA methylation was quantified for each triplicate sample using the SEQUENOM MassARRAY EpiTYPER platform and the mean methylation value was used after discarding any outlying values (deviation of ± 10 % methylation from the median). 2.2.5. Cortisol levels and reactivity Salivary samples in the infant were collected at three times during a maternal-infant separation and reunion task (Strange Situations Procedure, SSP): baseline (prior to mother and infant beginning the task), 10 min after completing the task (+20 min from baseline), and 30 min after completing the task (+40 min from baseline). After completing the SSP, parents were asked to free play with their infant. Salivary samples were collected using a salivette, centrifuged and stored at −80 °C. Salivary cortisol was measured using a commercially available ELISA assay (Salimetrics, USA), in duplicate according to the manufacturer’s instructions. Salivary cortisol correlated well with matched serum cortisol concentrations (r = 0.91). Assay sensitivity was 0.003 μg/dL, and intraassay variability was 4.4 % and inter assay variability was 4.9 %. All cortisol levels are expressed in SI units, nmol/ L. Infant Cortisol reactivity was expressed using cortisol response index, Area Under the Curve relative to increase (AUCI), using the formula in Pruessner et al. (Pruessner et al., 2003). In this study, AUCI measures infants’ change in cortisol during the period between commencing the SSP and 30 min after completing the SSP.

3. Results 3.1. Sample sociodemographic characteristics Women in this sample were, on average, 31.13 years of age (SD = 4.73, ranging 19–48 years of age) and most identified as Oceanic/ European ethnicity (n = 191, 80.6 %), followed by Asian (n = 19, 8.0 %), Middle-Eastern (n = 4, 1.7 %) and First Nation Australians (n = 2, 3

Psychoneuroendocrinology 115 (2020) 104611

M. Galbally, et al.

trimester EPDS scores, STAI-State, SLEs and placental and buccal methylation for each included NR3C1 and NR3C2 CpG unit, demonstrated several significant associations (see Supplementary Tables 5-8 for complete correlations tables showing FDR-adjusted significance, as well Supplementary Table 9 displaying correlations between maternal antenatal mental health measures). Early pregnancy depressive symptoms, but not third trimester depressive symptoms, were positively associated with NR3C1 placental methylation at CpGs 10_11 (r[168] = .16, p = .041) and 20_21 (r[228] = .16, p = .017), and with NR3C2 placental methylation at CpG 24 (r[225] = .15, p = .028). Third trimester depressive symptoms were positively associated with NR3C1 placental methylation at CpG 1_2 (r[228] = .17, p = .009). In addition, third trimester EPDS scores were significantly negatively associated with NR3C2 buccal cell methylation at CpG 10 (r[199] = −0.16, p = .039). Regarding zero-order bivariate correlations for first trimester STAI-S scores, there were significant associations with methylation at two placental NR3C1 CpG units only. Early pregnancy STAI-S scores were positively associated with NR3C1 placental methylation for CpG unit 20_21 (r[223] = .16, p = .018), and significantly negatively associated with CpG unit 35 (r[218] = −0.14, p = .047). Antenatal stressful life events were associated with NR3C1 and NR3C2 methylation in both placental and buccal samples. Early pregnancy SLES was significantly positively associated with NR3C1 placental methylation at CpG units 26 (r[212] = .19, p = .005) and 34 (r [212] = .19, p = .005), and significantly negatively associated with NR3C1 buccal methylation at CpG unit 17_18 (r[78] = −15, p = .049). Third trimester SLES was significantly negatively associated with NR3C1 placental methylation at CpG units 3_4_5 (r[214] = −0.16, p = .021) and 12_13 (r[214] = −0.19, p = .006), and buccal methylation at CpG unit 1_2 (r[182] = −0.15, p = .041). For NR3C2 methylation, early pregnancy SLES was significantly positively associated with placental CpG unit 24 (r[208] = .21, p = .003), and significantly negatively associated with placental CpG unit 20 (r[213] = −0.15, p = .030) and buccal CpG unit 13_14_15 (r[183] = −0.17, p = .025). Third trimester SLES was significantly negatively associated with NR3C2 placental methylation at CpG unit 12 (r[213] = −0.17, p = .014).

0.8 %). Almost 90 % (n = 213) of women reported having completed the final year of high school and almost two-thirds (n = 159) reported having completed a university degree. At the time of recruitment during early pregnancy, the majority of women were in a married, de facto or otherwise stable relationship living in the same house (n = 212, 89.5 %), with 10 women (4.2 %) reporting that they were not currently in a relationship. Almost two-thirds of women were working full-time (n = 156), followed by part-time (n = 35, 14.8 %) and casual employment (n = 20, 8.4 %). Twenty-one women (8.9 %) reported smoking during pregnancy and 87 women (36.7 %) reported consuming alcohol during pregnancy. There were more male (n = 129, 54.4 %) than female infants. 3.2. NR3C1 and NR3C2 methylation by groups Sample descriptive statistics for the raw percentage (i.e., prior to log-transformation) of methylation measured in both placental and buccal tissue and across NR3C1 and NR3C2 CpG units are presented in Supplementary Tables 1 and 2. Placental NR3C1 methylation at CpG unit 35 varied significantly between the antidepressant-exposed group and both the non-medicated depressed and the control groups; however, after applying the Benjamini-Hochberg adjustment to tests relating to NR3C1 placental methylation, the FDR for both pairwise comparisons was exceeded (Fig. 1). After controlling for the FDR on tests relating to NR3C1 methylation in buccal cells (see Fig. 2), the one CpG unit that varied significantly between groups at p < .05 (CpG unit 9), also exceeded the FDR critical value of 0.25. Fig. 3 displays placental NR3C2 methylation percentages for each unit by group. Although there were significant differences between groups in the placental NR3C2 methylation at CpG units 11, 20_22_23 and 24, only levels of methylation at CpG unit 24 remained significantly different between groups after adjusting for the FDR. The non-medicated depressed group had significantly lower placental methylation levels at NR3C2 CpG unit 24, compared to the antidepressant-exposed group only. There were no group differences in the level of NR3C2 buccal methylation at any of the CpG units (Fig. 4). The bivariate associations between CpG units for buccal and placental samples within the same gene are reported in Supplementary Tables 3 and 4.

3.4. Infant cortisol reactivity by antenatal depression and antidepressant exposure

3.3. Maternal antenatal depression, anxiety and stress, and NR3C1 and NR3C2 methylation

Controlling for baseline cortisol levels and using a binary grouping variable (No Depression versus Depression), a major depression

Zero-order bivariate correlations between both first and third

Fig. 1. Placental methylation (%) at CpG units for the NR3C1 gene by group. Error bars are standard error. 4

Psychoneuroendocrinology 115 (2020) 104611

M. Galbally, et al.

Fig. 2. Buccal cell methylation (%) at CpG units for the NR3C1 gene by group. Error bars are standard error.

= −0.20, p = .013). All remaining partial correlations between AUCI with STAI-S (partial r = −0.15, p = .06) and SLES (partial r = −0.09, p = .248), and with third trimester EPDS (partial r = −0.13 p = .110), STAI-S (partial r = −0.09, p = .268) and SLES (partial r = -0.01, p = .196), were not significant.

diagnosis was not associated with AUCI, F(1, 162) = .97, p = .326, ηp2 = .01 (Fig. 5). Also using a binary variable and controlling for baseline cortisol levels, antidepressant exposure was not associated with AUCI, F (1, 162) = .45, p = .505, ηp2 < .01 (Fig. 5). When examining cortisol AUCI between antidepressant-exposed, non-medicated depressed and control groups, there was a non-significant omnibus test, F(1, 161) = 1.93, p = .149, ηp2 = .02 (Fig. 5). We then collapsed the antidepressant-exposed and control groups to create a binary variable comparing infant cortisol reactivity in the non-medicated depressed group (EMM = 4.30, SE = 20.62) with all other women in the sample (EMM = 46.13, SE = 6.76). Controlling for baseline cortisol levels, there was a trend towards a significant, but small effect between the groups, F(1, 162) = 3.72, p = .056, ηp2 = .02. This result suggests that children from mothers with untreated major depression demonstrate, on average, a lower cortisol AUCI compared to both control women and antidepressant-exposed women. Using maternal antenatal depressive and anxious symptoms, and stressful life events, and controlling for baseline cortisol levels, only early pregnancy EPDS was significantly associated with AUCi (partial r

3.5. Infant cortisol reactivity, and NR3C1 and NR3C2 methylation Controlling for baseline cortisol levels, only two placental NR3C2 CpGs demonstrated significant partial correlations with infant cortisol AUCI even after controlling for the FDR. Higher placental NR3C2 methylation at CpGs 4_5 (partial r = .21, p = .006) and 24 (partial r = .15, p = .05) was associated with significantly higher infant cortisol AUCI. None of the CpG units for NR3C1 for both the placental and buccal cells demonstrated any significant partial association with infant cortisol AUCI.

Fig. 3. Placental methylation (%) at CpG units for the NR3C2 gene by group. Error bars are standard error. * denotes significance of pairwise comparison using FDR-adjusted p-value, where FDR = .25. 5

Psychoneuroendocrinology 115 (2020) 104611

M. Galbally, et al.

Fig. 4. Buccal cell methylation (%) at CpG units for the NR3C2 gene by group. Error bars are standard error.

Fig. 5. Area under the curve with respect to cortisol increase (AUCI) adjusted for baseline cortisol levels. Error bars are standard error.

antidepressant use and infant gender in cortisol AUCI. Both infant gender (1 = Male) and infant baseline cortisol were significantly associated with lower infant cortisol AUCI. We also controlled for antidepressant exposure and placental NR3C2 methylation at CpG 24, which was significantly, positively associated. There was a small, significant bootstrapped indirect effect between early pregnancy EPDS and infant cortisol AUCI through placental NR3C2 CpG 24 (β = .03, bootstrapped 95 % CIs: 0.01, .09), which suggests that higher early pregnancy depressive symptoms predict higher levels of DNA methylation of the NR3C2 receptor in placental tissue and, in turn, higher levels of

3.6. Maternal antenatal mental health and stress, NR3C1 and NR3C2 methylation, and infant cortisol reactivity Only NR3C2 CpG_24 had significant partial associations with both maternal mood symptoms and infant cortisol AUCI (see Supplementary Figs. 1–3 for bivariate scatterplots representing the zero-order associations between these variables). Fig. 6 displays the indirect path model from early pregnancy depressive symptoms through placental NR3C2 methylation at CpG 24 to infant cortisol AUCI at 12 months. In the model, we controlled for baseline infant cortisol levels, 6

Psychoneuroendocrinology 115 (2020) 104611

M. Galbally, et al.

Fig. 6. Standardised path coefficients in a model testing the effect of maternal early pregnancy mental health and life stress on 12month infant cortisol reactivity (AUCI), through NR3C2 CpG unit 24. Maximum Likelihood estimates are bootstrapped using 1000 samples. Bootstrapped 95 % bias-corrected confidence intervals for the standardised path estimate are included in brackets. EPDS, Edinburgh Postnatal Depression Scale. Model fit: χ2 (n = 177, d.f. = 3) = 0.94, p = .816, RMSEA = .00, SRMR = .01. * p < .05, ** p < .01, *** p < .001.

maternal depression, antidepressant use, DNA methylation of NR3C1 and infant cortisol response (Oberlander et al., 2008). This study examined 33 antidepressant exposed, 13 depressed untreated and 36 control mothers and infants and found increased third trimester maternal depressed/anxious mood was associated with increased methylation of NR3C1 in cord blood mononuclear cells at a predicted NGFI-A binding site and in turn, increased NR3C1 methylation at this site was also associated with increased salivary cortisol stress responses at 3 months, controlling for prenatal SRI exposure, postnatal age and pre and postnatal maternal mood (Oberlander et al., 2008). We did not replicate these findings. It may be explained by both our standardised calculation of infant cortisol reactivity recommended by Pruessner et al. in contrast with a different approach utilised by Oberlander et al. and the older age of the infant when cortisol was measured within our study (Pruessner et al., 2003). Within our study the infant was 12 months compared to the previous study where they collected cortisol samples at 3 months (Oberlander et al., 2008). There is some evidence that the cortisol stress response and HPA system only becomes stable with less responsiveness to everyday stressors by the end of the first year and hence age at which measurement of the stress response is important (Gunnar and Quevedo, 2007). Peripheral biosamples for DNA methylation are only proxies for any hypothesised impact on central nervous system. Another difference between our study and Oberlander et al. is where Oberlander et al. used cord blood mononuclear cells, while our study examined infant buccal and placental samples. Separately, Oberlander et al. found increased DNA methylation levels at CpG 1, 2 and 3 in infants was associated with antenatal maternal depressive symptoms. Our study did not replicate these findings, with no associations apparent for any CpG units for NR3C1 in infant buccal cells. However, both Oberlander et al. and our study found that the effect of any change from maternal mental health on DNA methylation was relatively small with 1–2 % differences identified even when statistically significant. The functional impacts of 1–2 % difference in DNA methylation as well as the specific CpG units each study identified are both unknown. While our findings suggest that DNA methylation may be an important mediator in understanding the fetal programming pathway from mental health exposures in pregnancy and child outcomes, it was not NR3C1. While there has been concern about antidepressant exposure in pregnancy and the potential to impact DNA methylation to date there have not been clear findings of any impact in human subjects within a genome wide epigenetic study (Non et al., 2014). In a previous study we found the method for measurement of antidepressant exposure was associated with significantly different DNA methylation findings (Galbally et al., 2018). Hence whether antidepressant exposure is measured through self-report, drug assay levels of maternal or cord blood or through other proxy measures of exposure may influence

DNA methylation of the NR3C2 receptor in placental tissue predicts greater infant cortisol reactivity during a stress task at 12 months. After accounting for the positive indirect effect, the negative direct effect between early pregnancy EPDS and infant cortisol AUCI remained such that higher depressive symptoms in early pregnancy was associated with significantly lower cortisol AUCI at 12 months postpartum. The results of the indirect model suggest that placental NR3C2 methylation at CpG 24 is a partial negative confounder (i.e., suppression) between maternal depressive symptoms and infant stress reactivity, such that accounting for the placental methylation at this site reduces the size of the total negative association.

4. Discussion In this study, we found few differences in NR3C1 and NR3C2 DNA methylation in both placental and buccal cells according to maternal mental health status (antidepressant exposure, depression untreated and controls) after we adjusted for multiple comparisons. Examining DNA methylation at candidate sites in both placental as well as newborn infant buccal samples is important if we are to understand influences on fetal programming given the important role the placenta plays in fetal development (Nugent and Bale, 2015). These findings continue to build the data on DNA methylation for NR3C1 and NR3C2, by providing data for both antidepressant-treated or untreated maternal depression using a diagnostic measure as well as self-report measures of mental health. Further, the value of this information is enhanced, by understanding any potential significance for future functional outcomes for the infant through including a measure of infant cortisol reactivity. Our current data showed when accounting for baseline cortisol that having a depressive disorder and early pregnancy depressive symptoms were independently associated with lower infant cortisol reactivity and separately also lower DNA methylation for NR3C2 CpG 24. However, of greatest interest was within a hypothesised mediation model, where placental DNA methylation on CpG unit 24 for NR3C2 acted as a negative confounder (suppressor) and corrected the estimation between depressive symptoms and infant cortisol reactivity (Riancho et al., 2016). It is noteworthy that while the placental DNA methylation was the subject of the model, there was an effect seen at CpG unit 24 between 7 and 13 % methylation in both placental and buccal tissues and there was little variation between the 3 groups for all other CpG units examined. Overall, these findings suggest the importance of including epigenetic data, robust characterisation of mental health exposures and when analysing this data ensuring adjustment for multiple comparison if we are to build an understanding of the complexity of fetal programming pathways in relation to the influence of maternal antenatal mental health on infant and child outcomes. There has only been one similar study that examined antenatal 7

Psychoneuroendocrinology 115 (2020) 104611

M. Galbally, et al.

findings with most studies relying on hospital records or self report. Reassuring is our current study, where we measure through repeat self report, hospital records, maternal and cord blood and on none of these measures we had a significant funding for either NR3C1 or NR3C2 DNA methylation and antidepressant exposure in utero. Furthermore, both Oberlander et al. and our study found no significant changes in infant DNA methylation of NR3C1 and antidepressant exposure taken together with Non et al. this suggests antidepressants exposure in pregnancy is unlikely to impact DNA methylation on NR3C1 (Non et al., 2014; Oberlander et al., 2008). While there has been much interest in the importance of the role of MR as well as GR in stress response regulation and vulnerability to depression and anxiety disorders there are more limited studies that have included DNA methylation of NR3C2 as well as NR3C1 in studies of maternal mental health and infant stress regulation outcomes. Understanding the potential role for DNA methylation of NR3C2 is supported by animal models that suggest that MR epigenetic mechanisms are implicated in both individual differences and long term stress responsivity (Nasca et al., 2015). Within human research, a recent study published in 2018 has examined late pregnancy depressive symptoms, measured using the screening measure Edinburgh Postnatal Depression Scale, and then subsequent 6-year-old children’s buccal cell DNA methylation and salivary cortisol levels did include both NR3C1 and NR3C2. Of note, they found a stronger relationship with NR3C2, whereby maternal depressive symptoms in pregnancy predicted boys bedtime cortisol levels and this was mediated by methylation of a single CpG unit for NR3C2 located in the promoter region (Stonawski et al., 2019). They also found lower cortisol response in these boys exposed to higher levels of depressive symptoms in pregnancy. This study found no relationship between maternal antenatal depressive symptoms, child cortisol and methylation of NR3C1. This study was limited by the reliance on only a single screening measure for depressive symptoms, the Edinburgh Postnatal Depression Scale and the ‘exposed to depressive symptoms’ group within the study had a mean EPDS of 13.16 (total sample mean was 6.69) in late pregnancy and at 2 days postpartum a mean EPDS 6.52, making this a low risk sample for perinatal depressive disorders. Furthermore, the positive predictive value for EPDS even when the cut off is above 13 is on average 50 (Matthey, 2010). Therefore, by including a diagnostic measure and a group of women who met criteria for depressive disorder our sample has built considerably on these findings for DNA methylation of NR3C2 in the context of maternal depression and child cortisol by ensuring our findings have meaning within clinical disorders. However, taken together our study and Stonawski et al. suggest the importance of examining NR3C2 as well as NR3C1 when considering the impact of fetal exposure to maternal depression and child HPA axis function. Indeed, research examining the relationship between early life stress and later depression has identified the importance of MR function, furthermore suggesting decreased DNA methylation of NR3C2 -if translated to increased limbic MR expression – would enhance feedback inhibition and result in decreased cortisol secretion (Francisco Juruena et al., 2015; Heuser et al., 2000; Ratka et al., 1989). While transient stress is typically associated with increased cortisol, chronic stress exposure has been associated with reduced cortisol and our findings for infants of lower cortisol reactivity is consistent with the context of exposure to significant maternal depressive disorders during fetal life. Previously we have found that a reduced infant stress reactivity was associated with lower maternal hair cortisol concentration in early pregnancy and independently with increased infant externalizing symptoms (Galbally et al., 2019). Our current findings suggest a reduction of the association between infant cortisol reactivity and maternal depression through an indirect effect of placental DNA methylation of NR3C2 CpG unit 24. This is consistent with both the importance of NR3C2 for HPA axis function and builds a further understanding of the interplay between maternal depressive disorders,

fetal environment, including placental function, and the developing infant HPA axis. Limitations of our study include a lack of data on genotype for this sample. This is a significant limitation given the importance of genotype in understanding and accounting for epigenetic variation in individuals (Teh et al., 2014). The functional significance of the CpG unit 24 methylation site is unknown, although its location in the promoter region suggests a role in transcriptional regulation. Furthermore, DNA methylation has been undertaken in peripheral tissue samples and also did not include infant blood. While the buccal samples were not macroscopically contaminated with blood, a cell count to identify leucocytes and other cells was not undertaken and included in the analysis as a covariate and differences in cell counts could potentially account for some of the differences observed (Theda et al., 2018). In addition, infant data is limited to infant cortisol reactivity without observational behavioural measures or measures of later socio-emotional development including mental health in offspring. A role of MR and GR in placenta growth has been reported, but how this relates to mental health of the mother or later stress responsivity of the infant is not known (Gennari-Moser et al., 2011; Raikkonen et al., 2015; Reynolds et al., 2015). This study has also been limited to the examination of NR3C1/2 and there is a range of other genes important to stress regulation such as those encoding for e.g. FKBP5, CRH, vasopressin, oxytocin, ACTH and their receptors (Bhave and Uht, 2017; Galbally et al., 2018; King et al., 2017; Murgatroyd et al., 2010; Normann and Buttenschon, 2019; Wiechmann et al., 2019). While a direct effect is not necessary to undertake mediation analysis, for reasons of power we limited our mediation analyses to where we found a direct effect between both maternal mental health and also infant cortisol reactivity and DNA methylation at a specific CpG unit. However, a recent study showed that chronic exposure of a hippocampal progenitor cell line to the synthetic glucocorticoid dexamethasone produced profound changes in DNA methylation pattern. Interestingly, a subset of these DNA methylations corresponded to changes in gene transcription revealed after an acute dexamethasone challenge (Provencal et al., 2019). The differential DNA methylation in this chronic dexamethasone model may be translated to the changes in setpoint at the genomic, cellular and neuroendocrine level, previously revealed after a glucocorticoid challenge of chronically stressed rodents (Karst and Joëls, 2003; Datson et al., 2013; de Kloet et al., 2014; Gray et al., 2014; Figueiredo et al., 2003). In the studies of Provençal et al. cross-tissue applicability of a subset of DNA methylated loci was designed to compute a poly-epigenetic risk score for stress- or glucocorticoid-related mental disorder. It was found that this score, if applied in cord blood, could predict maternal depression and anxiety symptoms, beit with a small effect size (Provencal et al., 2019). Thus, recent evidence suggests the use of peripheral samples as a potentially valid method for understanding a fetal programming mechanism underlying neuronal development and later psychiatric vulnerability (Provencal et al., 2019). 5. Conclusions Fetal programming, through influences of maternal mental health on the development of fetal/infant stress regulation, is important in understanding the pathways of an infant developing a heightened vulnerability to mental disorders. While there has been much interest in the potential for maternal antenatal mental health through the HPA axis to influence offspring outcomes the research to date has been conflicting. This study suggests a specific pathway through placenta DNA methylation of NR3C2 to infant cortisol reactivity at 12 months of age where inclusion of methylation at CpG_24 allowed a more accurate estimation of the relationship between depressive symptoms and infant cortisol reactivity. While the mechanism by which placental NR3C2 DNA methylation and infant stress reactivity may be related is unclear, this finding suggests an additional avenue for exploration in the quest 8

Psychoneuroendocrinology 115 (2020) 104611

M. Galbally, et al.

to understand early life influences on the developing stress regulation system as previously has been proposed for the GR (Provencal et al., 2019; Turecki and Meaney, 2016). For both researchers and clinicians having clear direction and evidence on potential fetal programming pathways is an important step towards the eventual translation into improved clinical outcomes for mother and child.

Development of the 10-item edinburgh postnatal depression scale. Br. J. Psychiatry 150, 782–786. Datson, N.A., van den Oever, J.M., Korobko, O.B., Magarinos, A.M., de Kloet, E.R., McEwen, B.S., 2013. Previous history of chronic stress changes the transcriptional response to glucocorticoid challenge in the dentate gyrus region of the male rat hippocampus. Endocrinology 154, 3261–3272. de Kloet, E.R., Joels, M., Holsboer, F., 2005a. Stress and the brain: from adaptation to disease. Nat. Rev. Neurosci. 6, 463–475. de Kloet, E.R., Claessens, S.E., Kentrop, J., 2014. Context modulates outcome of perinatal glucocorticoid action in the brain. Front. Endocrinol. (Lausanne) 5, 100. de Kloet, E.R., Otte, C., Kumsta, R., Kok, L., Hillegers, M.H., Hasselmann, H., Kliegel, D., Joels, M., 2016. Stress and depression: a crucial role of the mineralocorticoid receptor. J. Neuroendocrinol. 28. de Kloet, E.R., Joëls, M., Holsboer, F., 2005. Stress and the brain: from adaptation to disease. Nat. Rev. Neurosci. 6, 463. de Kloet, E.R., Meijer, O.C., de Nicola, A.F., de Rijk, R.H., Joels, M., 2018. Importance of the brain corticosteroid receptor balance in metaplasticity, cognitive performance and neuro-inflammation. Front. Neuroendocrinol. 49, 124–145. de Kloet, E.R., Vreugdenhil, E., Oitzl, M.S., Joels, M., 1998. Brain corticosteroid receptor balance in health and disease. Endocr. Rev. 19, 269–301. First, M., Spitzer, R., Gibbon, M., Williams, J., 1997. Stuructured Clinical Interview for DSM-IV Axis I Disorders (SCID-I), Clinical Version. American Psychiatric Press, Inc., Washington DC and London. Francisco Juruena, M., Von Werne, B., Castro Menezes, I., Guilherme Graeff, F., 2015. Early life stress in depressive patients: role of glucocorticoid and mineralocorticoid receptors and of hypothalamic-pituitary-adrenal axis activity. Curr. Pharm. Des. 21, 1369–1378. Galbally, M., Spigset, O., Johnson, A.R., Kohan, R., Lappas, M., Lewis, A.J., 2017. Neonatal adaptation following intrauterine antidepressant exposure: assessment, drug assay levels and infant development outcomes. Pediatr. Res. Galbally, M., Ryan, J., van IJzendoorn, M., Watson, S.J., Spigset, O., Lappas, M., Saffery, R., de Kloet, R., Lewis, A.J., 2018. Maternal depression, antidepressant use and placental oxytocin receptor DNA methylation: findings from the MPEWS study. Psychoneuroendocrinology 90, 1–8. Galbally, M., van Rossum, E.F.C., Watson, S.J., de Kloet, E.R., Lewis, A.J., 2019. Transgenerational stress regulation: mother-infant cortisol and maternal mental health across the perinatal period. Psychoneuroendocrinology 109, 104374. Gennari-Moser, C., Khankin, E.V., Schuller, S., Escher, G., Frey, B.M., Portmann, C.B., Baumann, M.U., Lehmann, A.D., Surbek, D., Karumanchi, S.A., Frey, F.J., Mohaupt, M.G., 2011. Regulation of placental growth by aldosterone and cortisol. Endocrinology 152, 263–271. Glover, V., O’Connor, T., O’Donnell, K., 2010. Prenatal stress and the programming of the HPA axis. Neurosci. Biobehav. Rev. 35, 17–22. Grant, K.-A., McMahon, C., Austin, M.-P., 2008. Maternal anxiety during the transition to parenthood: a prospective study. J. Affect. Disord. 108, 101–111. Gray, J.D., Rubin, T.G., Hunter, R.G., McEwen, B.S., 2014. Hippocampal gene expression changes underlying stress sensitization and recovery. Mol. Psychiatry 19, 1171–1178. Gunnar, M., Quevedo, K., 2007. The neurobiology of stress and development. Annu. Rev. Psychol. 58, 145–173. Hayes, A.F., 2009. Beyond Baron and Kenny: statistical mediation analysis in the new millennium. Commun. Monogr. 76, 408–420. Heuser, I., Deuschle, M., Weber, A., Kniest, A., Ziegler, C., Weber, B., Colla, M., 2000. The role of mineralocorticoid receptors in the circadian activity of the human hypothalamus-pituitary-adrenal system: effect of age. Neurobiol. Aging 21, 585–589. Hsiao, E.Y., Patterson, P.H., 2012. Placental regulation of maternal-fetal interactions and brain development. Dev. Neurobiol. 72, 1317–1326. Jin, B., Li, Y., Robertson, K.D., 2011. DNA methylation: superior or subordinate in the epigenetic hierarchy? Genes Cancer 2, 607–617. Kiefer, J.C., 2007. Epigenetics in development. Dev. Dyn. 236, 1144–1156. King, L., Robins, S., Chen, G., Yerko, V., Zhou, Y., Nagy, C., Feeley, N., Gold, I., Hayton, B., Turecki, G., Zelkowitz, P., 2017. Perinatal depression and DNA methylation of oxytocin-related genes: a study of mothers and their children. Horm. Behav. 96, 84–94. Matthey, S., 2010. Are we overpathologising motherhood? J. Affect. Disord. 120, 263–266. Mulder, R.H., Rijlaarsdam, J., Luijk, M.P., Verhulst, F.C., Felix, J.F., Tiemeier, H., Bakermans-Kranenburg, M.J., Van IJzendoorn, M.H., 2017. Methylation matters: FK506 binding protein 51 (FKBP5) methylation moderates the associations of FKBP5 genotype and resistant attachment with stress regulation. Dev. Psychopathol. 29, 491–503. Murgatroyd, C., Wu, Y., Bockmuhl, Y., Spengler, D., 2010. Genes learn from stress: how infantile trauma programs us for depression. Epigenetics 5, 194–199. Nasca, C., Bigio, B., Zelli, D., Nicoletti, F., McEwen, B.S., 2015. Mind the gap: glucocorticoids modulate hippocampal glutamate tone underlying individual differences in stress susceptibility. Mol. Psychiatry 20, 755–763. Non, A.L., Binder, A.M., Kubzansky, L.D., Michels, K.B., 2014. Genome-wide DNA methylation in neonates exposed to maternal depression, anxiety, or SSRI medication during pregnancy. Epigenetics 9, 964–972. Normann, C., Buttenschon, H.N., 2019. Gene-environment interactions between HPA-axis genes and stressful life events in depression: a systematic review. Acta Neuropsychiatr. 31, 186–192. Novakovic, B., Saffery, R., 2012. The ever growing complexity of placental epigenetics role in adverse pregnancy outcomes and fetal programming. Placenta 33, 959–970. Nugent, B.M., Bale, T.L., 2015. The omniscient placenta: metabolic and epigenetic regulation of fetal programming. Front. Neuroendocrinol. 39, 28–37. O’Donnell, K., Bugge, J.A., Freeman, L., Khalife, N., O’Connor, T., Glover, V., 2012.

Funding This study is supported through the 2012 National Priority Funding Round of Beyond blue in a three-year research grant (ID 519240) and a 2015 National Health and Medical Research Council (NHMRC) project grant for 5 years (APP1106823). Financial support has also been obtained from the Academic Research Development Grants from Mercy Health and from the Centre for Mental Health and Well-Being, Deakin University. Contributors MG, AJL, MvIJ designed the original and overall study protocol and ethics application. RS and ML contributed to the design of biosample collection protocol. RS and JR undertook the epigenetic analysis. RdK and TO contributed to the interpretation of the data. SW undertook the statistical analysis. MG and SW drafted this manuscript and all authors critically reviewed and revised for content and gave approval to the final to be published version of the manuscript. Declaration of Competing Interest The authors declare that they have no competing interests. Acknowledgements The authors would like to thank those who have both supported and given advice in the development of MPEWS including: Michael Permezel, Anne Buist, Philip Boyce and Marian Bakermans-Kranenburg. In addition, acknowledge the assistance of Dilys Lam and Toby Mansell in undertaking and describing the epigenetic analyses for this study. The authors also thank the staff and students on the study and research co-ordinators: Tina Vaiano and Nicole Brooks for their contribution to MPEWS. We are also sincerely grateful to the study participants who have contributed a substantial amount of time to participating in this study Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.psyneuen.2020. 104611. References Babenko, O., Kovalchuk, I., Metz, G.A., 2015. Stress-induced perinatal and transgenerational epigenetic programming of brain development and mental health. Neurosci. Biobehav. Rev. 48, 70–91. Benjamini, Y., Hochberg, Y., 1995. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B (Methodological) 57, 289–300. Bhave, S.A., Uht, R.M., 2017. CpG methylation and the methyl CpG binding protein 2 (MeCP2) are required for restraining corticotropin releasing hormone (CRH) gene expression. Mol. Cell. Endocrinol. 454, 158–164. Boyce, P., Stubbs, J., Todd, A., 1993. The Edinburgh postnatal depression scale: validation for an Australian sample. Aust. N. Z. J. Psychiatry 27, 472–476. Brown, S.J., Yelland, J.S., Sutherland, G.A., Baghurst, P.A., Robinson, J.S., 2011. Stressful life events, social health issues and low birthweight in an Australian populationbased birth cohort: challenges and opportunities in antenatal care. BMC Public Health 11, 196. Chapman, K., Holmes, M., Seckl, J., 2013. 11beta-hydroxysteroid dehydrogenases: intracellular gate-keepers of tissue glucocorticoid action. Physiol. Rev. 93, 1139–1206. Cox, J.L., Holden, J.M., Sagovsky, R., 1987. Detection of postnatal depression.

9

Psychoneuroendocrinology 115 (2020) 104611

M. Galbally, et al.

Studies: a Guide for Clinicians. BoneKEy Reports. pp. 5. Ryan, J., Mansell, T., Fransquet, P., Saffery, R., 2017. Does maternal mental well-being in pregnancy impact the early human epigenome? Epigenomics 9, 313–332. Ryan, J., Saffery, R., Patton, G., 2018. Epigenetics: a missing link in understanding psychiatric disorders? Lancet Psychiatry 5, 8–9. Seth, S., Lewis, A.J., Saffery, R., Lappas, M., Galbally, M., 2015. Maternal prenatal mental health and placental 11beta-HSD2 gene expression: initial findings from the mercy pregnancy and emotional wellbeing study. Int. J. Mol. Sci. 16, 27482–27496. Sosnowski, D.W., Booth, C., York, T.P., Amstadter, A.B., Kliewer, W., 2018. Maternal prenatal stress and infant DNA methylation: a systematic review. Dev. Psychobiol. 60, 127–139. Stonawski, V., Frey, S., Golub, Y., Rohleder, N., Kriebel, J., Goecke, T.W., Fasching, P.A., Beckmann, M.W., Kornhuber, J., Kratz, O., Moll, G.H., Heinrich, H., Eichler, A., 2019. Associations of prenatal depressive symptoms with DNA methylation of HPA axisrelated genes and diurnal cortisol profiles in primary school-aged children. Dev. Psychopathol. 31, 419–431. Teh, A.L., Pan, H., Chen, L., Ong, M.L., Dogra, S., Wong, J., MacIsaac, J.L., Mah, S.M., McEwen, L.M., Saw, S.M., Godfrey, K.M., Chong, Y.S., Kwek, K., Kwoh, C.K., Soh, S.E., Chong, M.F., Barton, S., Karnani, N., Cheong, C.Y., Buschdorf, J.P., Stunkel, W., Kobor, M.S., Meaney, M.J., Gluckman, P.D., Holbrook, J.D., 2014. The effect of genotype and in utero environment on interindividual variation in neonate DNA methylomes. Genome Res. 24, 1064–1074. ter Heegde, F., De Rijk, R.H., Vinkers, C.H., 2015. The brain mineralocorticoid receptor and stress resilience. Psychoneuroendocrinology 52, 92–110. Theda, C., Hwang, S.H., Czajko, A., Loke, Y.J., Leong, P., Craig, J.M., 2018. Quantitation of the cellular content of saliva and buccal swab samples. Sci. Rep. 8, 6944. Turecki, G., Meaney, M.J., 2016. Effects of the social environment and stress on glucocorticoid receptor gene methylation: a systematic review. Biol. Psychiatry 79, 87–96. Weaver, I.C., Cervoni, N., Champagne, F.A., D’Alessio, A.C., Sharma, S., Seckl, J.R., Dymov, S., Szyf, M., Meaney, M.J., 2004. Epigenetic programming by maternal behavior. Nat. Neurosci. 7, 847–854. Wiechmann, T., Roh, S., Sauer, S., Czamara, D., Arloth, J., Kodel, M., Beintner, M., Knop, L., Menke, A., Binder, E.B., Provencal, N., 2019. Identification of dynamic glucocorticoid-induced methylation changes at the FKBP5 locus. Clin. Epigenetics 11, 83.

Maternal prenatal anxiety and downregulation of placental 11B-HSD2. Psychoneuroendocrinology 37, 818–826. Oberlander, T.F., Weinberg, J., Papsdorf, M., Grunau, R., Misri, S., Devlin, A.M., 2008. Prenatal exposure to maternal depression, neonatal methylation of human glucocorticoid receptor gene (NR3C1) and infant cortisol stress responses. Epigenetics 3, 97–106. Palma-Gudiel, H., Cordova-Palomera, A., Eixarch, E., Deuschle, M., Fananas, L., 2015. Maternal psychosocial stress during pregnancy alters the epigenetic signature of the glucocorticoid receptor gene promoter in their offspring: a meta-analysis. Epigenetics 10, 893–902. Procyshyn, R.M., Bezchlibnyk-Butler, K.Z., Jeffries, J.J., 2017. Clinical Handbook of Psychotropic Drugs. Hogrefe Publishing. Provencal, N., Arloth, J., Cattaneo, A., Anacker, C., Cattane, N., Wiechmann, T., Roh, S., Kodel, M., Klengel, T., Czamara, D., Muller, N.S., Lahti, J., team, P, Raikkonen, K., Pariante, C.M., Binder, E.B., 2019. Glucocorticoid exposure during hippocampal neurogenesis primes future stress response by inducing changes in DNA methylation. Proc. Natl. Acad. Sci. U. S. A. https://doi.org/10.1073/pnas.1820842116. Pruessner, J.C., Kirschbaum, C., Meinlschmid, G., Hellhammer, D.H., 2003. Two formulas for computation of the area under the curve represent measures of total hormone concentration versus time-dependent change. Psychoneuroendocrinology 28, 916–931. Raikkonen, K., Pesonen, A.K., O’Reilly, J.R., Tuovinen, S., Lahti, M., Kajantie, E., Villa, P., Laivuori, H., Hamalainen, E., Seckl, J.R., Reynolds, R.M., 2015. Maternal depressive symptoms during pregnancy, placental expression of genes regulating glucocorticoid and serotonin function and infant regulatory behaviors. Psychol. Med. 45, 3217–3226. Ratka, A., Sutanto, W., Bloemers, M., de Kloet, E.R., 1989. On the role of brain mineralocorticoid (type I) and glucocorticoid (type II) receptors in neuroendocrine regulation. Neuroendocrinology 50, 117–123. Reynolds, R.M., Pesonen, A.K., O’Reilly, J.R., Tuovinen, S., Lahti, M., Kajantie, E., Villa, P.M., Laivuori, H., Hamalainen, E., Seckl, J.R., Raikkonen, K., 2015. Maternal depressive symptoms throughout pregnancy are associated with increased placental glucocorticoid sensitivity. Psychol. Med. 45, 2023–2030. Riancho, J., Del Real, A., Riancho, J.A., 2016. How to Interpret Epigenetic Association

10