The role of invariant natural killer T cells in experimental xenobiotic-induced cholestatic hepatotoxicity

Biomedicine & Pharmacotherapy 122 (2020) 109579

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

The role of invariant natural killer T cells in experimental xenobioticinduced cholestatic hepatotoxicity

T

Cheng Nonga, Mengzhi Zoua, Rufeng Xueb, Li Baic, Li Liua, Zhenzhou Jianga, Lixin Suna, Xin Huanga, Luyong Zhanga,d,*, Xinzhi Wanga,* a

Jiangsu Key Laboratory of Drug Screening, Jiangsu Center for Pharmacodynamics Research and Evaluation, China Pharmaceutical University, Nanjing 210009, China Reproductive Medicine Center, Department of Obstetrics and Gynecology, The First Affiliated Hospital of Anhui Medical University, Hefei 230022, China c Division of Molecular Medicine, Hefei National Laboratory for Physical Sciences at Microscale, CAS Key Laboratory of Innate Immunity and Chronic Disease, School of Life Sciences, University of Science and Technology of China, Hefei 230022, China d Center for Drug Research and Development, Guangdong Pharmaceutical University, Guangzhou 510006, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: ANIT Cholestasis Bile acid homeostasis iNKT cell Th1/Th2 cytokines

Inflammation, especially the release of pro-inflammatory mediators, contributes to hepatocyte injury during cholestasis. Alpha-naphthylisothiocyanate (ANIT) is widely used in rodents to mimic clinical cholestasis. Lymphocytes have been reported to exacerbate ANIT - induced hepatotoxicity. However, which cell and mechanism mediate hepatic inflammatory response and hepatocyte injury in cholestasis is still not clear. Invariant natural killer T (iNKT) cells are a unique subset of T lymphocytes which are supposed to exert immune-regulatory effect on cholestatic liver damage. In the present study, we hypothesized that iNKT cells played a role in the pathogenesis of ANIT-induced cholestatic hepatotoxicity. ANIT (50 mg/kg, intragastric gavage) was administered to male mice for 16, 48, or 72 h. We found that ANIT administration activated iNKT cells, releasing Th1 cytokine IFN-γ and Th2 cytokine IL-4. Administration of ANIT induced cholestatic liver injury, evidenced by the elevated serum ALT, AST, ALP, TBA, TG and TC levels, and significant hepatic histopathological changes. However, knockout of iNKT cell were resistant to the late development of ANIT - induced liver injury due to the reduced release of inflammatory cytokines CXCL10 and ICAM-1, as well as the down-regulation of nuclear receptor Egr1. We further revealed that the improvement of ALP in iNKT cell - deficient mice was partly associated with the up-regulation of transporter MRP2 and NTCP and bile acid metabolism enzyme CYP2B10. Collectively, these results suggested that iNKT cells aggravated ANIT-induced cholestatic liver injury by inducing inflammatory response which contributed to the understanding of the mechanisms of ANIT-induced cholestasis. More importantly, the iNKT cell regulation may promote effective measures that control cholestasis.

1. Introduction

ANIT has clinical significance for understanding the pathogenesis of cholestasis and discovering potential therapeutic targets. Although several published reports have demonstrated that the causes of ANIT induced cholestasis are related to disruption of bile acid homeostasis through changes in energy metabolism [1], hepatocyte polarity and barrier function [2], yet the mechanisms of ANIT-induced cholestatic hepatotoxicity have not been fully elucidated. Interestingly,

Cholestasis is a common occurrence during the process of liver diseases and increases the risk of liver fibrosis, cirrhosis or other hepatic and gall-bladder diseases. Alpha-naphthylisothiocyanate (ANIT) is known as a hepatotoxic agent to cause hepatocyte and biliary cell damage in rodents, which can mimic human intrahepatic cholestasis.

Abbreviations: αGalCer, α-galactosylceramide; ALT, alanine aminotransferase; ANIT, alpha-naphthylisothiocyanate; AST, aspartate aminotransferase; ALP, alkaline phosphatase; BDL, bile duct ligation; BSEP, bile salt export pump; CXCL10, C-X-C motif chemokine 10; CYP, cytochrome P450 family; Egr-1, early growth response 1; FXR, farnesoid X receptor; H&E, hematoxylin and eosin; ICAM-1, intercellular adhesion molecule 1; IFN-γ, interferon gamma; IL-4, interleukin 4; LFA-1, lymphocyte function-associated antigen 1; MRP2, multidrug resistance-associated protein 2; MRP3, multidrug resistance-associated protein 3; iNKT cell, invariant natural killer T cell; NTCP, Na+-dependent taurocholate cotransporter; OATP1B2, organic anion transporters 1B2; PBC, primary biliary cirrhosis; PPARα, peroxisome proliferatoractivated receptor alpha; TBA, total bile acids; TC, total cholesterol; TG, triglyceride; TJs, tight junctions; Ugt2a3, UDP glucuronosyltransferase family 2 member a3; VDR, vitamin D receptor; WT, wild type; ZO-1, zonula occludens 1 ⁎ Corresponding authors at: China Pharmaceutical University, No.24 Tongjiaxiang, Nanjing 210009, China. E-mail addresses: [email protected] (L. Zhang), [email protected] (X. Wang). https://doi.org/10.1016/j.biopha.2019.109579 Received 4 August 2019; Received in revised form 10 October 2019; Accepted 23 October 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

2.2. Animals and treatment

hepatocytes, not hepatic non-parenchymal cells or cholangiocytes, respond to stimulation of pathophysiological concentrations of bile acids followed with increased cytokine and chemokine expression, leading to the recruitment of lymphocytes and neutrophils into the liver [3]. The inflammatory response in hepatocyte induced by elevated concentrations of toxic bile acids may result in hepatocellular apoptosis/necrosis and liver injury [4]. Innate immunity has been reported to play a fast and crucial role in the exacerbation of liver injury [5]. To unravel the mechanism, we investigated the role of invariant natural killer T (iNKT) cells in ANIT-induced cholestasis. NKT cells compose nearly 30 % of the lymphoid cells in mouse liver (approximately 50 % in human liver) [6]. In the liver, NKT cells are mostly found in the sinusoids adherent to the endothelial cells and crawl rapidly along the vessel walls [7]. There are two distinct NKT cell populations: variant (non-classical) and invariant (classical). INKT cells express a unique CD1d-restricted T cell receptor, Va14Ja18 in mice and Va24Ja18 in humans. INKT cells recognize antigenic glycolipids, e.g., α-galactosylceramide (αGalCer) presented in CD1d [8]. NKT cells are capable of responding very rapidly to TCR and/or cytokine signals with an immediate and copious production of various cytokines (both proinflammatory and anti-inflammatory), subsequently activating other innate and adaptive immune cells, such as NK cell, dendritic cell [9]. Thus, NKT cells bridge and regulate innate and adaptive immune responses [10]. NKT cells, which are abundant in the liver than in other tissues, exert crucial immunomodulatory effects in the liver. NKT cells have been shown to play a key role in the development of autoimmune hepatitis. The activation of NKT cells, the following production of IL-4, IFN-γ and TNF-α, and the up-regulated expression of Fas ligand contribute to aggravate liver damage in several animal models [11,12]. Strong evidence also supports NKT cells are involved in cholestatic liver injury. NKT cells suppress neutrophil accumulation through NO and iNOS, thereby alleviate cholestatic hepatotoxicity in mouse model of bile duct ligation (BDL) [13]. However, in some instances, NKT cells are not protective, but detrimental. Due to reduced serum IFN‐γ and hepatic lymphoid cell infiltration, hepatotoxicity of primary biliary cirrhosis (PBC) is extenuated in NKT cell -deficient mouse [14]. Consequently, there is no common agreement regarding the pathophysiologic role of NKT cells in cholestasis. Bile duct injury is reduced in RAG1−/− mice which lack T- and Blymphocytes after ANIT administration [15]. Therefore, in the present study, we hypothesized that iNKT cells participate in ANIT - induced cholestasis. First, we confirmed whether ANIT can induce iNKT cell activation. Then, cholestatic liver injury was compared between wild type (WT) mice and iNKT cell knockout (Jα18−/−) mice after ANIT treatment. We further explored possible immune regulators associated with involvement of iNKT cell in ANIT - induced hepatotoxicity. Finally, transporters and enzyme related to bile acid homeostasis were compared between WT mice and Jα18−/− mice after ANIT treatment. Because the specificity of NKT cell is highly conserved among different mammalian species [16]. Study of the role of iNKT cell in ANIT-induced cholestasis will aid a better understanding of cholestasic hepatotoxicity, which will promote the discovery of effective therapeutic measures that control and predict cholestasis.

WT mice (male, age of 6–8 weeks and weighing 18–20 g) were purchased from Vital River Experimental Animal Technology, Co., Ltd. (Beijing, China). Jα18−/− mice (iNKT cells deficient) were kindly provided by Dr. Li Bai (University of Science and Technology of China). All male mice used were in C57BL/6 background and between 6–10 weeks of age. All the mice were housed under pathogen-free conditions and given free access to mouse chow and water ad libitum. The animals were maintained at a controlled temperature (22 ± 2 °C) and photoperiod (12 h of light and 12 h of dark). The animals were acclimated to the laboratory for 1 week before the experiments. This study was approved by the Ethical Committee of China Pharmaceutical University and the Laboratory Animal Management Committee of Jiangsu Province (Approval No.: 2110748). Male C57BL/6 mice were administered by intragastric gavage with ANIT at a dose of 50 mg/kg per mouse for 16, 48 or 72 h. Every group contained 6 mice. 2.3. Non-parenchymal cell (NPC) isolation and labeling Single cell suspensions were prepared from livers from which blood was eliminated by perfusion of the heart with saline solution. Mouse liver was passed through a 200-gage nylon mesh, and washed with cold PBS. The cell mixture was centrifuged at 50 × g for 2 min. The supernatant was then centrifuged at 800 × g for 10 min. For hepatic NPC isolation, the cell pellets were resuspended in 40 % Percoll and centrifuged at 1250 × g for 15 min. Then, the cell pellets were treated with red blood cell lysis solution (0.15 M NH4Cl and 0.1 mM Na2EDTA) to eliminate erythrocytes and obtain hepatic NPCs. NPCs were blocked with anti-CD16/32 and stained with fluorescence-conjugated anti-mouse CD3e, CD49b and CD69 antibodies for surface labeling. NPCs were permeabilized with Cytoperm/Cytofix (Becton Dickinson) according to the manufacturer’s instructions, and then incubated with antibodies specific for IFN-γ or IL-4 for intracellular labeling. The cells were then centrifuged, and the pellets were washed to remove unbound antibodies. After surface and/or intracellular labeling, the cells were analyzed using Calibur flow cytometer (Becton Dickinson, Palo Alto, CA, USA), and the data were analyzed using FlowJo version 10 software (FlowJo, Ashland, OR, USA). We used the gating strategy as follows: first, monocytes and lymphocytes were gated by FSC and SSC. Then, CD3e+ cells were gated. CD1d-αGalCer tetramer+CD69+, CD1d-αGalCer tetramer +IFNγ+ or CD1d-αGalCer tetramer +IL-4+ were gated and analyzed. 50,000 event were read per animal. 2.4. Blood chemistry analysis The blood was collected in tubes without anticoagulant to obtain serum which was analyzed for the levels of alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), total bile acid (TBA), total cholesterol (TC) and triglyceride (TG) using the ALT, AST and ALP quantification kit (Whitman Biotech, Nanjing, China) and TC, TG and TBA quantification kit (Jiancheng Bioengineering Institute, Nanjing, China).

2. Material and methods

2.5. Histopathological evaluations

2.1. Chemicals

Sections from the livers were removed and fixed in 10 % neutralbuffered formalin. For histopathological examination, all the fixed organs were processed for embedding in paraffin, sectioned, and stained with hematoxylin and eosin (H&E). The features of damages we evaluated included inflammatory cell infiltration, bile duct hyperplasia, severe hepatocellular necrosis and infarction. One field/mouse (every group contains 6 mice) at 4 × magnification were scored and analyzed. The severity of histology was semi-quantitatively scored into the following categories: 1 (minimal), 2 (mild), 3 (moderate), 4 (marked), or 5

ANIT was purchased from Sigma-Aldrich Co. (St Louis, MO, USA). Anti-CD3e-FITC antibody, anti-CD69-PE antibody, anti-IFN-γ-PE antibody, anti-IL-4-PE antibody were obtained from Becton Dickinson (San Diego, CA, USA). CD1d-αGalCer tetramer-APC was kindly provided by the NIH Tetramer Core Facility.

2

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

(severe) as compared with the control group. Additional sections were washed three times for 15 min each with 0.1 % Triton X-100 in PBS (PBST; Sigma-Aldrich) and blocked with 5 % goat serum in PBST for 1 h at room temperature. After blocking, the samples were incubated with primary antibodies including Egr-1 (Cell Signaling Technology, Danvers, MA, USA), CYP2B10 (Abcam, Cambridge, UK) and CYP27A1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA). On the next day, the samples were incubated with secondary antibodies for 2 h at room temperature.

antibodies, and then the protein was detected using the enhanced chemiluminescence kit for horseradish peroxidase.

2.6. RNA extraction and real-time PCR

3. Results

RNA was isolated from liver sections with TRIzol reagent (Vazyme Biotech, Nanjing, China). CDNA synthesis was performed following the manufacturer’s instructions by using the HiScript™ Q RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme Biotech). Real-time PCR was performed in a 20 - μL system containing 10 μL of 1 × SYBR Green Master Mix (Vazyme Biotech), 5 μL of cDNA, 3.5 μL of RNase/DNase-free water, 0.5 μL of ROX Reference Dye1 and 0.5 μL of each primer. The thermal cycler conditions included a hold for 5 min at 95 °C, followed by 40 cycles of 10 s at 95 °C and 30 s at 60 °C, and then 15 s at 95 °C, 1 min at 60 °C and 15 s at 95 °C. A melting curve analysis was performed for each reaction with a 65–95 °C ramp. The threshold cycle at which the fluorescent signal reached an arbitrarily set threshold near the middle of the log-linear phase of the amplification for each reaction was calculated, and the relative quantity of mRNA were determined. The mRNA levels were normalized against the mRNA levels of the housekeeping gene GAPDH. The primer sequences used are shown in Table 1.

3.1. ANIT activated iNKT cell and induced Th1/Th2 cytokine production

2.8. Statistical analysis The data are expressed as the mean ± SEM. The groups were evaluated using Student’s t-test between two groups, a one-way analysis of variance (ANOVA) and Dunnet’s t-test among groups. P-values < 0.05 were considered statistically significant.

CD69 is an early activation marker. Up-regulation of CD69 positive iNKT cells was observed 16 h and 48 h after ANIT administration (Fig. 1A & D), which indicated that iNKT cells were activated at an early stage. Another intriguing activation sign of iNKT cell is the production of Th1 (IFN-γ) /Th2 (IL-4) cytokine, which can make them both harmful and protective [17]. IFN-γ produced by iNKT cells was elevated at 72 h (Fig. 1B & E) IFN-γ has been reported to induce reactive oxygen species generation and hepatocyte death. NKT cell-initiated injury can be dependent on the production of IFN- γ [18]. IL-4 was increased at 48 and 72 h (Fig. 1C & F). Unlike the traditional theory that IL-4 is an antiinflammatory and protective cytokine, IL-4 secreted by iNKT cells is essential for augmentation of iNKT cell-mediated cytotoxicity [19]. The ratio of Th1/Th2 was up-regulated at 16 h and down-regulated at 48 and 72 h (Fig. 1G), which indicated that activation of NKT cell may induce pro-inflammatory environment and further injury. These results demonstrated that ANIT induced iNKT cell activation and Th1/Th2 cytokine production.

2.7. Protein extraction and western blot analyses The protein was extracted using RIPA lysis (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s protocol. The protein concentration was determined using a commercial BCA kit (Beyotime Biotechnology). Protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis on 8 % separation gels for ICAM-1 (58 kDa, 1:1000; Abcam) and GAPDH (36 kDa, 1:10000, Proteintech Group, Rosemont, IL, USA), transferred to polyvinylidene difluoride membranes, and then blocked for 1 h at room temperature with 5 % bovine serum albumin in Tris-buffered saline and 0.1 % Tween-20. Western blot analyses were performed with primary antibodies. Blots were incubated with the appropriate secondary

3.2. INKT cell deficiency alleviated ANIT - induced liver injury To further explore the role of iNKT cell in ANIT - induced liver injury, iNKT cell deficient mice (Jα18−/− mice) were used to compare hepatotoxicity after ANIT treatment. Compared with control mice, WT mice manifested significant increases of ALT, AST, ALP, TBA, TG and TC levels 48 h and 72 h after ANIT administration. Notably, the changes of blood biochemistry were later than the activation of hepatic iNKT cells. Compared with Jα18−/− mice, WT mice had higher levels of ALT, AST and ALP at 72 h and higher levels of TG and TC at 48 and 72 h.

Table 1 The primer sequence used for real-time PCR in mice. Name

Forward (5’ to 3’)

Reserve (5’ to 3’)

GAPDH ICAM-1 CXCL10 Egr-1 FXR PPARα VDR NTCP OATP1B2 BSEP MRP2 MRP3 CYP7A1 CYP7B1 CYP27A1 CYP8B1 CYP3A11 CYP2B10 Ugt2a3 ZO-1 Occludin

CATCACTGCCACCCAGAAGACTG CGACGCCGCTCAGAAGAA GCCGTCATTTTCTGCCTCA GGCAGAGGAAGACGATGAAG GGGATGAGTGTGAAGCCAGCTA ACCACTACGGAGTTCACGCATG GCTCAAACGCTGCGTGGACATT CCTGATGCCTTTCACTGGCTTC GCAATGATCGGACCAATCCTTGG CCTTGGTAGAGAAGAGGCGACA TACCAGCGAGTTATCGAAGCGTG ACTTCCTCCGAAACTACGCACC CACCATTCCTGCAACCTTCTGG CGGAAATCTTCGATGCTCCAAAG TCAGGAGACCATCGGCACCTTT CATGAAGGCTGTGCGTGAGGAA ACAGCACTGGTCAGAGCCTGAA TGCTGTCGTTGAGCCAACC GCAAACCTGCCAAGCCTTTACC GTTGGTACGGTGCCCTGAAAGA TGGCAAGCGATCATACCCAGAG

ATGCCAGTGAGCTTCCCGTTCAG GTCTCGGAAGGGAGCCAAGTA CGTCCTTGCGAGAGGGATC GACGAGTTATCCCAGCCAAA GTGGCTGAACTTGAGGAAACGG GAATCTTGCAGCTCCGATCACAC GGATGGCGATAATGTGCTGTTGC GGATGGTAGAACAGAGTTGGACG CCAACGAGCATCCTGAGGAGTT ATGGCTACCCTTTGCTTCTGCC TGCTTCTGACCGCCACTGAGAT GCTGGCTCATTGTCTGTCAGGT ATGGCATTCCCTCCAGAGCTGA GCTTGTTCCGAGTCCAAAAGGC CCAGTCACTTCCTTGTGCAAGG CATCACGCTGTCCAACACTGGA GAGAGCAAACCTCATGCCAAGG CCACTAAACATTGGGCTTCCT GACAGAGGCAATGAGGTTGGCT GCTGACAGGTAGGACAGACGAT CTGCCTGAAGTCATCCACACTC

3

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

Fig. 1. ANIT activates iNKT cell and induces Th1/Th2 cytokine production. The mice were killed at 16, 48 and 72 h after the administration of ANIT (50 mg/kg; intragastric gavage.). The hepatic CD3e+CD1d-αGalCer tetramer+CD69+, or CD3e+CD1d-αGalCer tetramer +IFNγ+ or CD3+CD1d-αGalCer tetramer+IL-4+ cells were detected and compared. (A) CD69 expression on liver iNKT cells. (B) IFN-γ produced by iNKT cells. (C) IL-4 produced by iNKT cells.(D) Analysis of CD69 expression. (E) Analysis of hepatic IFN-γ produced by iNKT cells. (F) Analysis of hepatic IL-4 produced by iNKT cells. (G) Th1/Th2 cytokine ratio. All values are the mean ± SEM (n = 6). *P < 0.05, ***P < 0.001 vs. control.

These results revealed that Jα18−/− mice were resistant to the late development of ANIT - induced liver injury.

Interestingly, iNKT cell deficient mice showed greater ALP and TBA levels at 16 h than WT mice, which meant they may develop cholestasis earlier than WT mice (Fig. 2). Histology in livers of WT mice exhibited inflammation (red arrows), bile duct hyperplasia (green arrows) and obvious feathery necrosis and infarction (blue arrows) 48 h and 72 h after ANIT administration, whereas NKT cell deficient mice presented alleviation of necrosis (Fig. 3A), which was confirmed by the toxicity score analysis (Fig. 3B).

3.3. Possible immune regulators associated with involvement of iNKT cell in ANIT - induced hepatotoxicity To figure out the mechanism of involvement of iNKT cell in ANIT induced hepatotoxicity, we detected the expressions of possible 4

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

Fig. 2. INKT cell deficiency protects against ANIT - induced liver injury. ANIT (50 mg/kg; intragastric gavage) was administered to mice, and serum were collected at 16, 48 and 72 h after administration for the assessment of ALT (A), AST (B), ALP(C), TBA(D), TG(E) and TC(F). All values are the mean ± SEM (n = 6). *P < 0.05, **P < 0.01, ***P < 0.001 vs. control. ###P < 0.001 vs. WT group.

iNKT cell-mediated hepatic inflammation. FXR is an important nuclear factor for regulation of bile acid metabolism. ANIT significantly suppressed the mRNA level of FXR in WT mice after 48 h and in Jα18−/− mice after 16 h, which may cause Jα18-/- mice develope cholestasis earlier than WT mice. Moreover, Jα18-/- mice showed higher gene expression of FXR at 72 h than WT mice (Fig. 4D). PPARα functions within NKT cells to regulate IFN-γ responses [23]. The expression of PPARα was up-regulated at 16 h in WT mice, which may exert effect on iNKT cell and IFN-γ in their involvement in cholestatic liver damage (Fig. 4E). The role of VDR in the development of NKT cells and regulation of cholestasis has been examined [24]. VDR expression significantly increased at 16 h in WT mice, which may exhibit an early role in the participation of iNKT cell in ANIT model. (Fig. 4F). These results indicated that CXCL10, ICAM-1, Egr-1, FXR, PPARα and VDR were possibly related to ANIT - induced liver injury during cholestasis, and CXCL10, ICAM-1 and Egr-1 may contribute to iNKT cell – mediated inflammation.

immune modulators. ICAM-1 is a pro-inflammatory mediator which can be induced by bile acid. Cholestatic liver injury is substantially reduced in BDL mice that are deficient in ICAM-1 [20].The mRNA and protein level of ICAM-1 was obviously elevated at 16 h while significantly lower ICAM-1 expression was shown in Jα18−/− mice (Fig. 4A & G), which indicated that ICAM-1 may initiate inflammation and cholestatic liver injury after ANIT administration. CXCL10, also called IFN-γ-inducible protein 10, is up-regulated in inflamed liver and recruits pro-inflammatory T lymphocytes into the liver [21]. CXCL10 expression was profoundly enhanced 16 h and 48 h after ANIT treatment, whereas iNKT cell depletion efficiently suppressed the up-regulation of CXCL10 (Fig. 4B). These results suggested that CXCL10 contributed to lymphocyte recruitment, including iNKT cells, which may in turn produce IFN- γ to induce CXCL10. Egr-1 is essential for the regulation of hepatic inflammation during cholestasis, linking the elevation of bile acid concentration and the production of pro-inflammatory mediators [22]. The hepatic mRNA level of Egr-1 was rapidly upregulated from 16 h and lasting for 72 h, whereas iNKT cell depletion effectively inhibited the increased expression of Egr-1 at 72 h (Fig. 4C). The trend of immunohistochemistry results in the liver showed as similar as mRNA (Fig. 4G). Our results demonstrated that up-regulation of Egr-1 played a role in ANIT - induced cholestatic hepatotoxicity and it may regulate

3.4. iNKT cell depletion partly restored expression of hepatic bile acid transporters and enzymes To elucidate the improvement of ALP in Jα18−/− mice after ANIT 5

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

Fig. 3. Liver histopathological analysis shows that iNKT cell deficient mice alleviates ANIT – induced hepatotoxicity. Liver specimens were excised and fixed in 10 % neutral-buffered formalin to generate tissue sections stained with hematoxylin and eosin (H&E, 4 ×). Inflammatory cell infiltration (red arrows), bile duct hyperplasia (green arrows), severe hepatocellular necrosis and infarction (blue arrows). Hepatotoxicity scores were compared between WT and Jα18−/− mice. All values are the mean ± SEM (n = 6). ***P < 0.001 vs. control. ###P < 0.001 vs. WT group (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

secretion. Occludin expression was increased after ANIT treatment while its expression was suppressed in Jα18-/- mice (Fig. 6I). These finding suggested that knockout of NKT cell increased bile acid synthesis especially by up-regulation of CYP27A1, which may account for the high level of serum TBA. The enhanced expression of detoxification enzyme CYP2B10 by NKT cell depletion contributed to the improvement of ALP.

administration, genes involved in bile acid homeostasis were compared between WT mice and Jα18−/− mice. The expressions of bile acid transporters NTCP and MRP2 were severely inhibited in WT mice, whereas these gene expressions were restored to control levels in Jα18−/− mice (Fig. 5A & D). Compared with control mice, ANIT enhanced OATP1B2 and BSEP expressions at 48 h in WT mice and Jα18−/ − mice while their expressions were higher at 72 h in Jα18-/- mice than WT mice (Fig. 5B & C). The basolateral uptake transporters NTCP and OATP1B2 are responsible for bile acid uptake into hepatocytes [25]. The canalicular efflux transporters BSEP and MRP2 are involved in transporting hepatic bile acid into bile [26]. Furthermore, MRP3 expression was up-regulated at 48 h in WT mice yet its mRNA level was lower at 16 h and 48 h in Jα18−/− mice than WT mice (Fig. 5E). The basolateral anion transporter MRP3 may play a hepatoprotective role under cholestasis. The enhanced expressions of transporters NTCP and MRP2 in Jα18−/− mice contributed to the bile acid excretion and the improvement of ALP. Bile acid metabolic disorder can be caused by abnormal P450 enzyme and/or hepatobiliary barrier function. Therefore, we investigated the effect of iNKT cell on bile acid synthetic/detoxification enzymes and tight junctions (TJs). Bile acid synthetic enzymes CYP7A1, CYP7B1, CYP27A1 and CYP8B1 were dramatically suppressed by ANIT, whereas knockout of iNKT cell enhanced gene expressions of CYP7A1, CYP27A1 and CYP8B1 compared with WT mice (Fig. 6A–D). The results of immunohistochemistry also showed that CYP27A1 expression was inhibited after ANIT administration to decrease bile acid synthesis, while it was restored in Jα18−/− mice (Fig. 7A). Bile acid is detoxified by phase I enzyme, such as CYP3A11 and CYP2B10, and phase II enzyme, such as Ugt2a3. ANIT promoted the mRNA expressions of CYP3A11, CYP2B10 and inhibited the expression of Ugt2a3 while NKT cell knockout improved the expressions of CYP2B10 and Ugt2a3 (Fig. 6EG). The immunohistochemistry of CYP2B10 also exhibited similar trends as mRNA level (Fig. 7B). TJs play an important role in bile

4. Discussion The causes of cholestasis have been widely studied. However, the molecular mechanisms as to how bile acids initiate liver injury are not well understood. It has recently been proposed that the retention of bile acids in hepatocytes initiates liver injury by inducing an inflammatory response [4]. Cholestasis, the hepatic accumulation of toxic hydrophobic bile acids, is a highly immunogenic process involving both resident and immigrating immune cells. NKT cells are one of the earliest responders to inflammatory stimulation. Activation of NKT cell involving rapid and robust cytokine production within hours after stimulation influences type and intensity of overall immune response [27] The biliary epithelium can present antigens to activate NKT cells [28]. Besides, NKT cells are abundant in both mouse and human livers (compose 30 % of the lymphocytes in mouse liver and 50 % in human), and can exert beneficial or detrimental effects on different murine models of PBC and cholestasis [13,14,29,30]. In the livers of PBC patients, NKT cells are increased in number and recruited more efficiently, leading to exacerbation of hepatic damage which is supposed to because of their higher cytotoxicity [31]. Mice which lack NKT cells exhibit significantly reduced hepatic leukocytes infiltration and milder cholangitis compared with mice that developed PBC. NKT cells in PBC express higher levels of activation markers and secrete higher levels of IFN‐γ when activated [14]. Above results suggest that the onset of PBC is correlated with the abnormal NKT cells in patients and diseased animals. 6

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

Fig. 4. Possible immune regulators associated with involvement of iNKT cell in ANIT - induced hepatotoxicity. The mice were killed at 16, 48 and 72 h after the administration of ANIT (50 mg/kg; intragastric gavage.). Hepatic mRNA expression of immune regulators ICAM-1 (A), CXCL10 (B), Egr-1 (C), FXR (D), PPARα (E) and VDR (F) were determined and compared. Changes in the protein level of ICAM-1 (G) and Egr-1 (H) were determined by Western blot and immunohistochemistry, respectively. All values are the mean ± SEM (n = 6), except greyscale of Western blot were triplicates. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control. ###P < 0.001 vs. WT group.

iNKT cells and triggers for the damage and hepatitis [19,36]. Injection of αGalcer activates iNKT cells, inducing a rapid elevation of IL-4 and a delayed elevation of IFN-γ. The rapid production of IL-4 by iNKT cells promotes liver neutrophil survival and infiltration, which exacerbates liver injury, and the delayed production of IFN-γ attenuates hepatic neutrophil accumulation by inducing neutrophil apoptosis, thereby preventing iNKT-mediated liver injury [37]. In the present study, we observed remarkably activated iNKT cells from 16 h by detecting their surface phenotype CD69. It was important to note that the activation of iNKT cells occurred earlier than the increase of blood biochemistry. Activation of iNKT cells was also revealed by overproduction of IFN-γ at 72 h, and IL-4 at 48 and 72 h. IFN-γ/IL-4 was increased at 16 h and profoundly decreased at 48 and 72 h which indicated that the activation of iNKT cell may induced pro-inflammatory environment and further injury. Both of NKT cell activation and IFN-γ/IL-4 elevation may account for the ANIT - induced liver damage (Fig. 1). Furthermore, NKT cell depletion protected mice from ANIT - induced liver injury, which indicated iNKT cells aggravated liver damage induced by ANIT. Deficiency of NKT cell decreased the ANIT-induced elevation in the serum ALT, AST, ALP levels at 72 h, and TG and TC levels at 48 h and 72 h (Fig. 2). Histological injuries were remarkably relieved in Jα18−/− mice (Fig. 3). These results indicated that Jα18−/− mice effectively mitigated ANIT-induced hepatocyte injury. Therefore, we further figured out the mechanisms of iNKT cell in ANIT - induced hepatotoxicity. ICAM-1 facilitates the interaction of NKT cells with LFA-1 and contributes to the activation and homing of NKT cells following BDL

Previously, we demonstrated that depletion of NKT cells ameliorates triptolide - induced liver damage. After NKT cell depletion, mice exhibited fewer neutrophils and macrophages and lower production of IFN-γ by NKT cells after triptolide administration [32]. However, compared to WT mice, hepatotoxicity is exacerbated in NKT cell - deficient mice following BDL due to the inhibition of neutrophil pro-inflammatory response and neutrophil-dependent cholestatic liver damage by NKT cells [30]. Therefore, the role of NKT cells in the pathogenesis of cholestasis remains unclear. ANIT is used in rodents to induce cholestasis for understanding the pathogenesis of drug-induced cholestatic hepatotoxicity. In the present study, we explored the mechanism of involvement of iNKT cells in ANIT-induced cholestatic hepatotoxicity. Upon activation, iNKT cells produce both Th1 and Th2 cytokines within 1–2 h of surface T cell receptor ligation, whose dysfunction or imbalance may affect immune responses and lead to disease development. However, whether Vα14 NKT cells behave like either Th1 or Th2 cells depends on different diseases and models. IFN - γ, rapidly secreted by activated iNKT cells, leads to activation of NK cells followed by chemoattractant to other cells, such as macrophage and neutrophil [33]. Due to cytotoxicity, activated iNKT cells and NK cells kill themselves and hepatocytes, resulting in organ damage. Overproduction of IFN-γ also causes a greater susceptibility to liver injury and is critical to the development of PBC [34,35]. IL-4 has been considered as anti-inflammatory and protective, yet IL-4 produced by Con A-activated iNKT cells appears to upregulate TNF-α, FasL and granzyme B expression in 7

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

Fig. 5. iNKT cell depletion alters the expression of hepatic bile acid transporters in ANIT - induced cholestatic liver injury. The mice were killed at 16, 48 and 72 h after the administration of ANIT (50 mg/kg; intragastric gavage.). A quantitative real-time PCR analysis was performed to measure the gene expression levels of bile acid transporters in the liver (A) NTCP, (B) OATP1B2, (C) BSEP, (D) MRP2 and (E) MRP3. All values are the mean ± SEM (n = 6). *P < 0.05, **P < 0.01, ***P < 0.001 vs. control. #P < 0.05, ##P < 0.01, ###P < 0.001 vs. WT group.

and reduces liver injury. In the ICAM-1 promoter, an Egr-1 response element has been identified, and Egr-1 directly regulates expression of ICAM-1 [41]. In our study, Egr1 expression was rapidly elevated at 16 h and lasting for 72 h, whereas iNKT cell depletion effectively inhibited the increase at 72 h, which may exert a late protection on ANIT- induced hepatocyte damage. Various transporters and enzymes are crucial in hepatic bile acid homeostasis which is regulated by nuclear receptors, such as FXR [42]. FXR is highly expressed in liver. It functions as metabolic sensors for bile acids, xenobiotics, and cholesterol, and regulates their metabolism and liver immune responses [43].ANIT suppressed the mRNA expression of FXR at 48 h and 72 h. Although higher FXR expression was observed in Jα18−/− mice at 72 h compared with WT mice, iNKT cell deficiency suppressed FXR expression from 16 h which may be the reason that Jα18−/− mice developed cholestasis earlier than WT mice. Moreover, compared to WT mice, FXR knockout mice do not show reduced liver injury or increased survival after BDL [44], which suggests that FXR is mostly related to bile acid homeostasis and has little effect on hepatocyte damage. PPARα is

[38]. The expression level of ICAM-1 as well as the hepatic accumulation of neutrophils directly correlate with the degree of cholestatic injury in both humans and in animal models. In mice deficient of ICAM-1, liver necrosis is dramatically reduced after BDL compared with the WT control [20]. IFN-γ has been reported to promote the production of chemokines. Chemokines and their receptors regulate hepatic infiltration of circulating inflammatory cells in liver inflammation, resulting in either enhanced or resolved inflammation [39]. CXCL10 induced by IFN-γ recruits autoreactive CD4+ T cells expressing CXCR3 and leads to biliary tract destruction [40]. In our study, iNKT cell deficiency efficiently suppressed the up-regulation of ICAM-1 and CXCL10 to inhibit inflammation and liver damage (Fig. 4). Bile acids have been reported to directly induce and enhance inflammation in murine hepatocytes in an Egr-1 dependent manner [22]. The mRNA expression of transcription factor Egr1 is increased in bile acid treated cells, which correlates with regulating the expression of inflammatory cytokines. Egr1-deficiency reduces inflammatory cytokines and adhesion molecules induced by bile acids in vitro and in vivo, 8

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

Fig. 6. iNKT cell knockout changes the mRNA levels of P450 enzymes and tight junctions in ANIT - induced cholestatic hepatotoxicity. The mice were killed at 16, 48 and 72 h after the administration of ANIT (50 mg/kg; intragastric gavage.). The relative mRNA levels of bile acid synthetic enzyme (A) - (D), bile acid metabolism enzyme (E) – (G) and tight junction (H) - (I) were measured and compared. All values are the mean ± SEM (n = 6). *P < 0.05, **P < 0.01, ***P < 0.001 vs. control. #P < 0.05, ##P < 0.01, ###P < 0.001 vs. WT group.

restrain the cellular damage of cholestasis. In response to ANIT - induced cholestasis, hepatocytes minimized hepatic bile acid retention by reducing NTCP and MRP2, as well as increasing the export transporters MRP3. INKT cell depletion increased transporters NTCP and MRP2 expressions, which partly explained that iNKT cell deficiency inhibited the up-regulation of ALP by clearance of bile acids from hepatocytes (Fig. 5). In addition, regulation of bile acid synthesis and metabolism exerts important effect on maintenance of bile acid homeostasis. Reduced expressions of bile acid synthetic enzymes, such as CYP7A1, CYP7B1, CYP27A1 and CYP8B1, reflected a rapid protection under stress to decelerate bile acid synthesis. NKT cell deficiency partly restored the expressions of ANIT-suppressed bile acid synthetic enzymes, especially CYP27A1, which may account for the high level of serum TBA. The expressions of bile acid metabolism enzymes CYP3A11 and CYP2B10 elevated for detoxification, while the expression of CYP2B10 was enhanced in Jα18−/− mice to promote more bile acid metabolism (Figs. 6 & 7). Alter the metabolism of bile acids increases hydroxylation sites of bile acids which decreases their hydrophobicity and toxicity. These results suggested that NKT cell probably contributed to ANIT - induced cholestasis by regulating NTCP, MRP2, CYP27A1 and CYP2B10 expression.

critically involved in maintaining cholesterol, lipid, and bile acid homeostasis by regulating genes responsible for bile acid synthesis and transport. IFN-γ is identified as the gene target of PPARα. Hepatic PPARα plays an important role in NKT cell-mediated liver injury through regulation of NKT cell recruitment and survival [45]. PPARα agonist fenofibrate improves liver function in PBC and PSC by inhibiting bile acid synthesis and stimulating phospholipid excretion [46]. VDR is expressed at high levels in drug-induced cholestasis [47]. Furthermore, VDR is required for NKT cell development and is necessary for efficient cytokine production [48]. Expression of PPARα and VDR significantly increased at 16 h which may play an early role in ANIT-induce cholestatic injury (Fig. 4). Cholestasis can be defined as intrahepatic impairment of bile acid synthesis and excretion, or extrahepatic blockage of the biliary ducts, resulting in accumulation of bile acids or bile salts. ANIT-induced cholestasis is related to decrease in the bile acid efflux in hepatocytes which leads to decreases in the bile flow and bile acid output. From the results of serum ALP and TBA, it was clear that reduced cholestatic liver injury by iNKT cell deficiency was only partly due to changes in bile acid synthesis or transport. Therefore, we compared the expressions of transporters and enzymes related to bile acid synthesis and metabolism. The basolateral uptake transporters NTCP and OATP1B2 are involved in the hepatic uptake of bile acids [25]. NTCP is crucial for conjugated bile acids to be taken up into hepatocytes and it is also required for bile acid - stimulated hepatic chemokine expressions [49]. The bile acid efflux transporters BSEP and MRP2, which are directly regulated by FXR, transport hepatic bile acid across the canalicular membrane into the bile ductules [26]. Up-regulation of basolateral export pumps MRP3 presumably functions as an adaptive compensatory mechanism to

5. Conclusion In summary, ANIT rapidly induced NKT cell activation after 16 h, releasing IFNγ and IL-4. INKT cell knockout mice alleviated ANIT-induced liver injury, yet TBA level was not affected. The mitigation of hepatotoxicity mediated by NKT cell deficiency was associated with 9

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

Fig. 7. iNKT cell knockout changes the protein levels of P450 enzymes in ANIT - induced cholestatic hepatotoxicity. The mice were killed at 16, 48 and 72 h after the administration of ANIT (50 mg/kg; intragastric gavage.). Changes in the protein level of CYP27A1 (A) and CYP2B10 (B) were determined by immunohistochemistry.

Declaration of Competing Interest

reducing the expressions of inflammatory regulator ICAM-1, CXCL10 and Egr-1, leading to a resolution of the inflammatory response and liver injury. The improvement of ALP in knockout mice was to enhance the hepatic uptake/efflux and detoxification of bile acids through the up-regulation of transporter NTCP, MRP2 and metabolism enzyme CYP2B10 expression. The elevation of the bile acid synthesis enzyme CYP27A1 may explain the high level of TBA in Jα18−/− mice. Our study suggests that iNKT cell may be an effective therapeutic target for cholestatic liver injury, which provides new insights for understanding the toxic mechanism of ANIT-induced cholestasis.

The authors declare that there are no conflicts of interest. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2019.109579. References [1] X. Li, R. Liu, L. Yu, Z. Yuan, R. Sun, H. Yang, L. Zhang, Z. Jiang, Alpha-naphthylisothiocyanate impairs bile acid homeostasis through AMPK-FXR pathways in rat primary hepatocytes, Toxicology 370 (2016) 106–115. [2] T. Yang, H. Mei, D. Xu, W. Zhou, X. Zhu, L. Sun, X. Huang, X. Wang, T. Shu, J. Liu, J. Ding, H.M. Hassan, L. Zhang, Z. Jiang, Early indications of ANIT-induced cholestatic liver injury: alteration of hepatocyte polarization and bile acid homeostasis, Food Chem. Toxicol. 110 (2017) 1–12. [3] M. Li, S.Y. Cai, J.L. Boyer, Mechanisms of bile acid mediated inflammation in the liver, Mol. Aspects Med. 56 (2017) 45–53. [4] K. Allen, H. Jaeschke, B.L. Copple, Bile acids induce inflammatory genes in hepatocytes: a novel mechanism of inflammation during obstructive cholestasis, Am. J. Pathol. 178 (1) (2011) 175–186. [5] C.G. Antoniades, P.A. Berry, J.A. Wendon, D. Vergani, The importance of immune dysfunction in determining outcome in acute liver failure, J. Hepatol. 49 (5) (2008) 845–861. [6] S. Norris, D.G. Doherty, C. Collins, G. McEntee, O. Traynor, J.E. Hegarty, C. O’Farrelly, Natural T cells in the human liver: cytotoxic lymphocytes with dual T cell and natural killer cell phenotype and function are phenotypically heterogenous and include Valpha24-JalphaQ and gammadelta T cell receptor bearing cells, Hum. Immunol. 60 (1) (1999) 20–31. [7] A. Bendelac, P.B. Savage, L. Teyton, The biology of NKT cells, Annu. Rev. Immunol. 25 (2007) 297–336. [8] J.L. Matsuda, O.V. Naidenko, L. Gapin, T. Nakayama, M. Taniguchi, C.R. Wang,

Author contributions C.N. and X.W. performed the experiments, collected data, analyzed the data and wrote the manuscript. M.Z., R.X. and L.B. performed parts of the experiments and collected and analyzed the data. Z.J., L.S., X.H. and L.Z. contributed to the guidance of experiments and contributed to the final manuscript. L.Z. and X.W. designed the study and contributed to the final manuscript. All of the authors reviewed the manuscript.

Funding The present study was supported by the National Natural Science Foundation of China (No. 81703626, No. 81773995, No. 81773827, No. 81573514, No. 81873084, No. 81573690, No. 81673684, No. 81673443 and No. 81320108029) and “Double First - Class” University project (CPU2018GY33). 10

Biomedicine & Pharmacotherapy 122 (2020) 109579

C. Nong, et al.

[9] [10] [11]

[12]

[13]

[14]

[15]

[16]

[17] [18]

[19]

[20]

[21]

[22] [23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

Y. Koezuka, M. Kronenberg, Tracking the response of natural killer T cells to a glycolipid antigen using CD1d tetramers, J. Exp. Med. 192 (5) (2000) 741–754. T. Santodomingo-Garzon, M.G. Swain, Role of NKT cells in autoimmune liver disease, Autoimmun. Rev. 10 (12) (2011) 793–800. L. Van Kaer, V.V. Parekh, L. Wu, Invariant natural killer T cells: bridging innate and adaptive immunity, Cell Tissue Res. 343 (1) (2011) 43–55. M. Biburger, G. Tiegs, Alpha-galactosylceramide-induced liver injury in mice is mediated by TNF-alpha but independent of Kupffer cells, J. Immunol. 175 (3) (2005) 1540–1550. R. Xue, H. Zhang, J. Pan, Z. Du, W. Zhou, Z. Zhang, Z. Tian, R. Zhou, L. Bai, Peripheral dopamine controlled by gut microbes inhibits invariant natural killer T cell-mediated hepatitis, Front. Immunol. 9 (2018) 2398. C.C. Duwaerts, E.P. Sun, C.W. Cheng, N. van Rooijen, S.H. Gregory, Cross-activating invariant NKT cells and kupffer cells suppress cholestatic liver injury in a mouse model of biliary obstruction, PLoS One 8 (11) (2013) e79702. Y.H. Chuang, Z.X. Lian, G.X. Yang, S.A. Shu, Y. Moritoki, W.M. Ridgway, A.A. Ansari, M. Kronenberg, R.A. Flavell, B. Gao, M.E. Gershwin, Natural killer T cells exacerbate liver injury in a transforming growth factor beta receptor II dominant-negative mouse model of primary biliary cirrhosis, Hepatology 47 (2) (2008) 571–580. N. Joshi, A.K. Kopec, H. Cline-Fedewa, J.P. Luyendyk, Lymphocytes contribute to biliary injury and fibrosis in experimental xenobiotic-induced cholestasis, Toxicology 377 (2017) 73–80. L. Brossay, M. Chioda, N. Burdin, Y. Koezuka, G. Casorati, P. Dellabona, M. Kronenberg, CD1d-mediated recognition of an alpha-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution, J. Exp. Med. 188 (8) (1998) 1521–1528. N. Li, J. Hua, Immune cells in liver regeneration, Oncotarget 8 (2) (2017) 3628–3639. C.M. Lappas, Y.J. Day, M.A. Marshall, V.H. Engelhard, J. Linden, Adenosine A2A receptor activation reduces hepatic ischemia reperfusion injury by inhibiting CD1ddependent NKT cell activation, J. Exp. Med. 203 (12) (2006) 2639–2648. Y. Kaneko, M. Harada, T. Kawano, M. Yamashita, Y. Shibata, F. Gejyo, T. Nakayama, M. Taniguchi, Augmentation of Valpha14 NKT cell-mediated cytotoxicity by interleukin 4 in an autocrine mechanism resulting in the development of concanavalin a-induced hepatitis, J. Exp. Med. 191 (1) (2000) 105–114. J.S. Gujral, J. Liu, A. Farhood, J.A. Hinson, H. Jaeschke, Functional importance of ICAM-1 in the mechanism of neutrophil-induced liver injury in bile duct-ligated mice, Am. J. Physiol. Gastrointest. Liver Physiol. 286 (3) (2004) G499–507. T. Santodomingo-Garzon, J. Han, T. Le, Y. Yang, M.G. Swain, Natural killer T cells regulate the homing of chemokine CXC receptor 3-positive regulatory T cells to the liver in mice, Hepatology 49 (4) (2009) 1267–1276. N.D. Kim, J.O. Moon, A.L. Slitt, B.L. Copple, Early growth response factor-1 is critical for cholestatic liver injury, Toxicol. Sci. 90 (2) (2006) 586–595. M.A. Zhang, J.J. Ahn, F.L. Zhao, T. Selvanantham, T. Mallevaey, N. Stock, L. Correa, R. Clark, D. Spaner, S.E. Dunn, Antagonizing peroxisome proliferator-activated receptor alpha activity selectively enhances Th1 immunity in male mice, J. Immunol. 195 (11) (2015) 5189–5202. D.S. Smyk, A. Mavropoulos, G. Mieli-Vergani, D. Vergani, M. Lenzi, D.P. Bogdanos, The role of invariant NKT in autoimmune liver disease: can vitamin D act as an immunomodulator? Can. J. Gastroenterol. Hepatol. 2018 (2018) 8197937. I.L. Csanaky, H. Lu, Y. Zhang, K. Ogura, S. Choudhuri, C.D. Klaassen, Organic aniontransporting polypeptide 1b2 (Oatp1b2) is important for the hepatic uptake of unconjugated bile acids: studies in Oatp1b2-null mice, Hepatology 53 (1) (2011) 272–281. B. Liu, Y. Li, H. Ji, H. Lu, H. Li, Y. Shi, Glutamine attenuates obstructive cholestasis in rats via farnesoid X receptor-mediated regulation of Bsep and Mrp2, Can. J. Physiol. Pharmacol. 95 (2) (2017) 215–223. M. Subramanian, R. Kini, M. Madasu, A. Ohta, M. Nowak, M. Exley, M. Sitkovsky, A. Ohta, Extracellular adenosine controls NKT-cell-dependent hepatitis induction, Eur. J. Immunol. 44 (4) (2014) 1119–1129. E. Schrumpf, C. Tan, T.H. Karlsen, J. Sponheim, N.K. Bjorkstrom, O. Sundnes, K. Alfsnes, A. Kaser, D.M. Jefferson, Y. Ueno, T.J. Eide, G. Haraldsen, S. Zeissig, M.A. Exley, R.S. Blumberg, E. Melum, The biliary epithelium presents antigens to and activates natural killer T cells, Hepatology 62 (4) (2015) 1249–1259. E. Schrumpf, X. Jiang, S. Zeissig, M.J. Pollheimer, J.A. Anmarkrud, C. Tan, M.A. Exley, T.H. Karlsen, R.S. Blumberg, E. Melum, The role of natural killer T cells in a mouse model with spontaneous bile duct inflammation, Physiol. Rep. 5 (4) (2017). P. Wintermeyer, C.W. Cheng, S. Gehring, B.L. Hoffman, M. Holub, L. Brossay,

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43] [44]

[45]

[46] [47]

[48]

[49]

11

S.H. Gregory, Invariant natural killer T cells suppress the neutrophil inflammatory response in a mouse model of cholestatic liver damage, Gastroenterology 136 (3) (2009) 1048–1059. Y.H. Chuang, Z.X. Lian, K. Tsuneyama, B.L. Chiang, A.A. Ansari, R.L. Coppel, M.E. Gershwin, Increased killing activity and decreased cytokine production in NK cells in patients with primary biliary cirrhosis, J. Autoimmun. 26 (4) (2006) 232–240. X.Z. Wang, R.F. Xue, S.Y. Zhang, Y.T. Zheng, L.Y. Zhang, Z.Z. Jiang, Activation of natural killer T cells contributes to triptolide-induced liver injury in mice, Acta Pharmacol. Sin. 39 (12) (2018) 1847–1854. M.J. Smyth, N.Y. Crowe, D.G. Pellicci, K. Kyparissoudis, J.M. Kelly, K. Takeda, H. Yagita, D.I. Godfrey, Sequential production of interferon-gamma by NK1.1(+) T cells and natural killer cells is essential for the antimetastatic effect of alpha-galactosylceramide, Blood 99 (4) (2002) 1259–1266. Y. Shimizu, J.A. Margenthaler, K. Landeros, N. Otomo, G. Doherty, M.W. Flye, The resistance of P. acnes–primed interferon gamma-deficient mice to low-dose lipopolysaccharide-induced acute liver injury, Hepatology 35 (4) (2002) 805–814. Y. Ando, G.X. Yang, T.P. Kenny, K. Kawata, W. Zhang, W. Huang, P.S. Leung, Z.X. Lian, K. Okazaki, A.A. Ansari, X.S. He, P. Invernizzi, W.M. Ridgway, Q. Lu, M.E. Gershwin, Overexpression of microRNA-21 is associated with elevated proinflammatory cytokines in dominant-negative TGF-beta receptor type II mouse, J. Autoimmun. 41 (2013) 111–119. S. Toyabe, S. Seki, T. Iiai, K. Takeda, K. Shirai, H. Watanabe, H. Hiraide, M. Uchiyama, T. Abo, Requirement of IL-4 and liver NK1+ T cells for concanavalin a-induced hepatic injury in mice, J. Immunol. 159 (3) (1997) 1537–1542. H. Wang, D. Feng, O. Park, S. Yin, B. Gao, Invariant NKT cell activation induces neutrophil accumulation and hepatitis: opposite regulation by IL-4 and IFN-gamma, Hepatology 58 (4) (2013) 1474–1485. T. Ohteki, C. Maki, S. Koyasu, T.W. Mak, P.S. Ohashi, Cutting edge: LFA-1 is required for liver NK1.1+TCR alpha beta+ cell development: evidence that liver NK1.1+TCR alpha beta+ cells originate from multiple pathways, J. Immunol. 162 (7) (1999) 3753–3756. J. Choi, C. Selmi, P.S. Leung, T.P. Kenny, T. Roskams, M.E. Gershwin, Chemokine and chemokine receptors in autoimmunity: the case of primary biliary cholangitis, Expert Rev. Clin. Immunol. 12 (6) (2016) 661–672. Y.H. Chuang, Z.X. Lian, C.M. Cheng, R.Y. Lan, G.X. Yang, Y. Moritoki, B.L. Chiang, A.A. Ansari, K. Tsuneyama, R.L. Coppel, M.E. Gershwin, Increased levels of chemokine receptor CXCR3 and chemokines IP-10 and MIG in patients with primary biliary cirrhosis and their first degree relatives, J. Autoimmun. 25 (2) (2005) 126–132. J.S. Maltzman, J.A. Carmen, J.G. Monroe, Transcriptional regulation of the Icam-1 gene in antigen receptor- and phorbol ester-stimulated B lymphocytes: role for transcription factor EGR1, J. Exp. Med. 183 (4) (1996) 1747–1759. H.L. Guo, H.M. Hassan, Y. Zhang, S.Z. Dong, P.P. Ding, T. Wang, L.X. Sun, L.Y. Zhang, Z.Z. Jiang, Pyrazinamide induced rat cholestatic liver injury through inhibition of FXR regulatory effect on bile acid synthesis and transport, Toxicol. Sci. 152 (2) (2016) 417–428. Q. Yu, Z. Jiang, L. Zhang, Bile acid regulation: a novel therapeutic strategy in nonalcoholic fatty liver disease, Pharmacol. Ther. 190 (2018) 81–90. M. Wagner, P. Fickert, G. Zollner, A. Fuchsbichler, D. Silbert, O. Tsybrovskyy, K. Zatloukal, G.L. Guo, J.D. Schuetz, F.J. Gonzalez, H.U. Marschall, H. Denk, M. Trauner, Role of farnesoid X receptor in determining hepatic ABC transporter expression and liver injury in bile duct-ligated mice, Gastroenterology 125 (3) (2003) 825–838. I.N. Hines, M. Kremer, S.M. Moore, M.D. Wheeler, Impaired T cell-mediated hepatitis in peroxisome proliferator activated receptor alpha (PPARalpha)-deficient mice, Biol. Res. 51 (1) (2018) 5. N.S. Ghonem, D.N. Assis, J.L. Boyer, Fibrates and cholestasis, Hepatology 62 (2) (2015) 635–643. G. Zhao, M. Elhafiz, J. Jiang, D. Das, Z. Li, W. Zhou, S. Fan, C. Wang, Z. Yuan, D. Xu, Z. Jiang, L. Zhang, T. Wang, Adaptive homeostasis of the vitamin D-vitamin D nuclear receptor axis in 8-methoxypsoralen-induced hepatotoxicity, Toxicol. Appl. Pharmacol. 362 (2019) 150–158. N. Umeda, K. Endo-Umeda, H. Nakashima, S. Kato, S. Seki, M. Makishima, Frontline science: concanavalin a-induced acute hepatitis is attenuated in vitamin D receptor knockout mice with decreased immune cell function, J. Leukoc. Biol. (2019). S.Y. Cai, X. Ouyang, Y. Chen, C.J. Soroka, J. Wang, A. Mennone, Y. Wang, W.Z. Mehal, D. Jain, J.L. Boyer, Bile acids initiate cholestatic liver injury by triggering a hepatocyte-specific inflammatory response, JCI Insight 2 (5) (2017) e90780.