The role of microRNA-196a and microRNA-196b as ERG regulators in acute myeloid leukemia and acute T-lymphoblastic leukemia

Leukemia Research 35 (2011) 208–213

Contents lists available at ScienceDirect

Leukemia Research journal homepage: www.elsevier.com/locate/leukres

The role of microRNA-196a and microRNA-196b as ERG regulators in acute myeloid leukemia and acute T-lymphoblastic leukemia Ebru Coskun a , Eva Kristin von der Heide a , Cornelia Schlee a , Andrea Kühnl a , Nicola Gökbuget b , Dieter Hoelzer b , Wolf-Karsten Hofmann c , Eckhard Thiel a , Claudia D. Baldus a,∗ a b c

Department of Hematology and Oncology, Charité University Hospital Berlin, Campus Benjamin Franklin, Hindenburgdamm 30, Berlin, Germany Department of Hematology and Oncology, University of Frankfurt am Main, Frankfurt/Main, Germany Department of Hematology and Oncology, University Hospital Mannheim, Mannheim, Germany

a r t i c l e

i n f o

Article history: Received 9 March 2010 Received in revised form 7 May 2010 Accepted 8 May 2010 Available online 8 June 2010 Keywords: ERG miR-196a miR-196b Hematopoietic differentiation Acute myeloid leukemia Acute T-lymphoblastic leukemia

a b s t r a c t Overexpression of the ETS transcription factor ERG is an adverse prognostic factor in adult patients with acute myeloid leukemia (AML) and T-cell acute lymphoblastic leukemia (T-ALL). We investigated the regulation of ERG by microRNAs and explored their role in hematopoiesis and leukemia. Transfection of precursor molecules of miR-196a and miR-196b induced ERG downregulation and luciferase assays confirmed binding of miR-196a and miR-196b to the ERG 3 UTR. During in vitro differentiation of CD34+ cells, miR-196b expression decreased with time, indicating a role for miR-196b in early hematopoiesis. In AML, patients with NPM1-mutations had higher levels of miR-196a and miR-196b compared to NPM1-wildtype. In T-ALL patients, miR-196a and miR-196b expression was associated with an immature immunophenotype, and expression of CD34 and CD33. In conclusion, our results identify miR-196a and miR-196b as ERG regulators and implicate a potential role for these miRNAs in acute leukemia. © 2010 Elsevier Ltd. All rights reserved.

1. Introduction Acute myeloid leukemia (AML) and T-cell acute lymphoblastic leukemia (T-ALL) are heterogeneous groups of leukemias, reflecting various underlying genetic abnormalities [1,2]. Specific chromosomal aberrations, such as numerical aberrations, translocations, and gene mutations have shown to be important prognostic factors in AML [3–6] and in acute lymphoblastic leukemia (ALL) [7–9]. Moreover, aberrant expression of single genes, for example, BAALC, MN1, and CXCR4, were also found to be of prognostic relevance [10–12]. In particular, deregulation of transcription factors, which promote normal differentiation of hematopoiesis, is critical for the development of leukemias. For instance, the oncogenic ETS transcription factor ERG (v-ets erythroblastosis virus E26 oncogene homolog) that plays an important physiological role in hematopoiesis [13] was of independent adverse prognostic significance, as high expression of ERG identified adult patients with T-ALL and cytogenetically normal AML (CN-AML) with a high risk of relapse and inferior survival [14,15]. The underlying biology of the oncogenic properties of ERG and its expression regulation remain unknown. To date, few stud-

∗ Corresponding author. Tel.: +49 30 8445 2337; fax: +49 30 8445 4468. E-mail address: [email protected] (C.D. Baldus). 0145-2126/$ – see front matter © 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.leukres.2010.05.007

ies have been performed unraveling the regulation of ERG in hematopoiesis [13,16]. Characterization of the expression pattern of ERG isoforms in leukemia revealed marked differences in the expression of the two main isoforms ERG2 and ERG3 in T-ALL and AML. The ERG2 promoter was found to be regulated by methylation, whereas no CpG islands were detected in the promoter region of ERG3 [17]. Thus, in addition to the epigenetic regulation, the regulation of ERG may also be directed by other mechanisms. microRNAs (miRNAs) are endogenous ∼22 nt non-coding molecules that play an important regulatory role in critical cellular processes such as cell cycle, apoptosis, and differentiation [18,19]. Recent discoveries implicate miRNAs in normal hematopoiesis and in the pathogenesis of leukemia. miR-221 and miR-222 were found to have a role in erythropoiesis, whereas miR-223 was involved in granulopoietic regulation and miR-150 in megakaryocytic differentiation [20–22]. Moreover, deregulation of miRNA expression was shown to be involved in the initiation and progression of leukemia, as they can act as oncogenes and tumor suppressors [23]. In CNAML, miR-181a and miR-181b were part of a miRNA expression signature associated with outcome and their expression levels were inversely associated with the risk of an event [24,25]. Additionally, in ALL of various subtypes, miRNA expression profiles revealed high expression of miR-128b, miR-204, miR-218, miR-331, and miR181b-1 compared to healthy controls, indicating a potential role for these miRNAs in leukemogenesis [26].

E. Coskun et al. / Leukemia Research 35 (2011) 208–213

Since miRNAs have emerged as major regulators in hematopoiesis by fine-tuning transcription factors [27], we examined the regulation of ERG by miRNAs. Among the miRNAs predicted to regulate ERG, we identified miR-196a and miR-196b as regulators of ERG. In order to explore the potential role of miR196a and miR-196b in normal hematopoiesis and acute leukemia, we further examined the expression of miR-196a and miR-196b during hematopoietic differentiation, as well as in AML and T-ALL patient samples. 2. Materials and methods 2.1. Computational analysis Four different databases (Targetscan http://www.targetscan.org, PicTar http://pictar.bio.nyu.edu, mirBase http://microrna.sanger.ac.uk, Human microRNA targets http://www.microrna.org) were used to predict potential miRNAs that regulate ERG. The databases predicted miRNAs that target ERG by comparing the complementarity between the seed region at 5 end of miRNA and the 3 UTR of the ERG mRNA sequences. The following conserved miRNAs, common in at least two of the four databases, were chosen for further analyses: miR-9, miR-27a, miR-30b, miR-137, miR-142-3p, miR-145, miR-196a, miR-196b, miR-219, miR-361, and miR-544. 2.2. Cells and patient samples KG1a and MOLT-4 cell lines, obtained from DSMZ (Braunschweig, Germany), were cultured in RPMI 1640 with 10% fetal calf serum (FCS) and 1% antibiotics and antimycotics. The 293T cell line was maintained in DMEM supplemented with 10% FCS and 1% antibiotics and antimycotics. Human bone marrow (BM) samples used for hematopoietic differentiation experiments were obtained from healthy donors after informed consent. Density gradient centrifugation (Ficoll-Hypaque; Amersham Pharmacia Biotech, Uppsala, Sweden) was performed to isolate mononuclear cells from BM samples. CD34+ cells were immunomagnetically enriched from BM using MACS CD34 isolation kit (MACS, Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) following the manufacturer’s recommendations. Pretreatment BM samples of adult patients with newly diagnosed AML (admitted to our institution between the years 2006–2009, n = 46) and T-ALL (enrolled on the German Acute Lymphoblastic Leukemia Multicenter Study Group 07/03 protocol, n = 104) were analyzed. As control unselected total BM (n = 4) specimens were obtained from healthy donors after informed consent. 2.3. Transfection KG1a and MOLT-4 cells were transfected with Pre-miRTM miRNA precursor molecules (Applied Biosystems/Ambion, Darmstadt, Germany) and scrambled RNA oligomer controls (Pre-miR negative control), using the Nucleofector systems (Lonza Cologne AG, Cologne, Germany) according to the manufacturer’s recommendations. The final concentration of Pre-miR molecules and the corresponding Pre-miR negative control was 100 nM each. Cells were harvested 24 h (hrs) and 48 h after transfection. 2.4. Real time RT-PCR for ERG mRNA and miRNA expression analyses Total RNA was extracted using Trizol® Reagent (Invitrogen GmbH, Karlsruhe, Germany). For cDNA synthesis, 500 ng of total RNA was reverse transcribed in a final volume of 20 ␮l using oligo-dT primers and AMV reverse transcriptase (Roche Diagnostics GmbH, Mannheim, Germany). Comparative RT-PCR assays of a region common to all ERG isoforms (pan-ERG), ERG2 and ERG3 isoforms were performed using Glucose Phosphate Isomerase (GPI) as housekeeping gene as previously reported [17]. The relative levels of miRNAs were determined by stem-loop real time RTPCR using gene-specific primers according to the TaqMan MicroRNA Assay protocol (Applied Biosystems/Ambion, Darmstadt, Germany). Briefly, for reverse transcription, 10 ng of total RNA was used in each reaction and mixed with the specific stem-loop primers. All PCRs were run in duplicates and RNU6B small nuclear RNA endogenous control was used for normalization. 2.5. Reporter vector and DNA constructs The miR-196a and miR-196b binding sites of ERG 3 UTR were designed as oligonucleotides, either as wildtype (wt) or as mutant by inserting random nucleotides into the miR-196 “seed sequences”, and were subsequently cloned into the psiCHECKTM 2 Vector (Promega GmbH, Mannheim, Germany). The oligonucleotide sequences were designed to carry the XhoI and NotI sites facilitating ligation into the vector. The sense oligonucleotide sequences were as follows:

209

psicheck-ERG-wt, 5 tttaaggaaaactacctgtataaaa 3 ; psicheck-ERG-mut, 5 tttaaggaaaactggtaacctgtataaaa 3 . 2.6. Luciferase reporter gene assay 293T cells were seeded at 2.5 × 105 cells per well of a 12-well plate and were grown for 48 h. After 48 h the cells were washed with PBS and replaced with new medium. A total of 400 ng of the plasmids psicheck-ERG-wt and psickeck-ERG-mut, respectively, were cotransfected with 50 pmol final concentrations of either PremiR-196a or Pre-miR-196b molecules and their corresponding Pre-miR negative controls, using Lipofectamin 2000 (Invitrogen GmbH, Karlsruhe, Germany). After 24 h, the cell extract was obtained and firefly and Renilla luciferase activities were measured with the Dual-Luciferase reporter system (Promega GmbH, Mannheim, Germany) according to manufacturer’s instructions. Renilla luciferase activity was normalized to firefly luciferase activity. 2.7. CD34+ cell differentiation Immunomagnetically purified CD34+ BM cells from healthy donors were cultured in Iscove’s modified Dulbecco’s culture medium supplemented with 20% FCS, 1% antibiotic and antimycotic. The cytokines SCF (50 ng/ml) and IL-3 (20 ng/ml) (MACS, Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) were added to keep the cells in the maintenance culture. To induce lineage-specific differentiation, EPO (3 U/ml) (R&D Systems GmbH, Wiesbaden-Nordenstadt, Germany) was added for erythropoietic differentiation and G-CSF (50 ng/ml) and GM-CSF (20 ng/ml) (MACS, Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) for granulopoietic differentiation. The cells were semi-depleted at predefined time points (days 3, 6, 9, 13, 16, and 20). At these time points medium and cytokines were replaced and harvested cells were processed for RNA isolation. The maturation of CD34+ cells was confirmed with flow cytometry using antibodies against the cell surface markers Glycophorin A (GlyA) (Beckman Coulter GmbH, Krefeld, Germany) for erythroid differentiation and CD15 (BD Biosciences, Heidelberg, Germany) for granulopoietic differentiation.

3. Results 3.1. miR-196a and miR-196b regulate ERG mRNA expression By using the miRNA prediction softwares, 11 potential miRNAs binding to ERG 3 UTR were chosen for further analyses. All miRNAs were tested by transfecting myeloid KG1a cells with miRNA precursor molecules and transfected cells were subsequently studied for ERG mRNA expression levels. Of all 11 miRNAs, only transfection of the miRNA precursor molecules of miR-196a (Pre-miR-196a) and miR-196b (Pre-miR-196b) induced a significant reduction of ERG mRNA expression levels. After 24 h pan-ERG was significantly downregulated by 29% (after Pre-miR-196a transfection) and by 33% (after Pre-miR-196b transfection); after 48 h by 34% (after Pre-miR-196a transfection) and by 36% (after PremiR-196b transfection) compared to Pre-miR negative controls (Fig. 1A). Moreover, analysis of the expression regulation of the specific isoforms revealed a downregulation of ERG3 expression levels by miR-196a and miR-196b in KG1a (Fig. 1B). Due to lack of ERG2 expression in KG1a cells, we further studied the T-lymphoblastic cell line MOLT-4, which showed downregulation of both ERG2 by 38% and 36% (after Pre-miR-196a and Pre-miR-196b transfection), and ERG3 by 43% and 33% (after Pre-miR-196a and Pre-miR-196b) 24 h after transfection (Fig. 1C). Transfection efficiency was confirmed with increased expression levels of the miRNAs after 24 h in KG1a and MOLT-4 (data not shown). 3.2. miR-196a and miR-196b target ERG 3 UTR Validation of ERG as a direct target of miR-196a and miR-196b was performed by a luciferase reporter assay. The predicted miR196 recognition site of the ERG 3 UTR was cloned into a luciferase reporter vector. The vector contained either the wt or a mutated sequence of the ERG 3 UTR. Subsequently, the vectors were cotransfected with Pre-miR-196a or Pre-miR-196b molecules into 293T cells. After 24 h, a 33% and 28% reduction of luciferase activity was observed in cells cotransfected with psicheck-ERG-wt vector and Pre-miR-196a or Pre-miR-196b molecules compared to the

210

E. Coskun et al. / Leukemia Research 35 (2011) 208–213

Fig. 1. Transfections with precursor molecules Pre-miR-196a and Pre-miR-196b downregulate the expression of pan-ERG and ERG3 mRNA in KG1a (A and B), as well as ERG2 and ERG3 mRNA expression in MOLT-4 (C) compared to cells transfected with unspecific Pre-miR negative control. The data depict the mean ± S.D. from three independent experiments.

controls (Fig. 2). In contrast, transfection of the miRNA precursor molecules did not reduce the luciferase activity with the mutated psicheck-ERG-mut vector. The results show that ERG expression is directly regulated by miR-196a and miR-196b.

196b median = 0.02, P < .01) and healthy donors (miR-196a median = 0.05, P = .03 and miR-196b median = 0.18, P = .05) (Fig. 5), whereas no significance was observed in miR-196a and miR-196b expression in T-ALL compared to healthy donors (P = .36 and P = .39).

3.3. miR-196a and miR-196b expression during cell differentiation of normal CD34+ cells

3.5. Association of miR-196a and miR-196b with clinical and molecular characteristics in T-ALL

The expression pattern of miR-196a and miR-196b was examined in CD34+ progenitor cells isolated from human BM of healthy donors. The cells were kept in maintenance culture using the cytokines SCF and IL-3, and lineage-specific differentiation was induced by the addition of EPO or G/GM-CSF. Flow cytometry analysis of the surface markers GlyA and CD15 expression confirmed lineage-specific maturation (Fig. 3A and B). As shown in Fig. 4A, the expression of miR-196a was nearly constant during the differentiation, whereas the expression of miR-196b was high in undifferentiated CD34+ cells and decreased with early onset of differentiation stimulus (maintenance culture: 20-fold reduction; EPO: 20-fold reduction; G/GM-CSF: 14-fold reduction—day 0 vs. day 9, Fig. 4B).

To examine the association of miR-196a and miR-196b expression levels with clinical and molecular features, T-ALL patients

3.4. Expression of miR-196a and miR-196b in T-ALL and AML patients To investigate the role of miR-196a and miR-196b in acute leukemia, we measured the expression of miR-196a and miR196b in pretreatment BM samples from T-ALL and AML patients. miR-196a and miR-196b were significantly higher expressed in AML (miR-196a median = 0.29 and miR-196b median = 1.46) compared to T-ALL (miR-196a median = 0.02, P < .01 and miR-

Fig. 2. Dual-luciferase assay of 293T cells cotransfected with luciferase vector containing the cloned 3 UTR region of ERG and Pre-miR-196a or Pre-miR-196b compared to cells cotransfected with unspecific Pre-miR negative control. The data depict the mean ± S.D. from three independent experiments.

Fig. 3. Expression of the surface markers Glycophorin A for erythropoietic differentiation (A), and CD15 for granulopoietic differentiation (B) confirm lineage-specific differentiation of CD34+ progenitor cells measured with flow cytometry at days 3, 6, and 9.

E. Coskun et al. / Leukemia Research 35 (2011) 208–213

211

Fig. 5. Expression of miR-196a and miR-196b in AML and T-ALL patients. Real time RT-PCR was performed in pretreatment BM samples from AML (n = 46), TALL (n = 105) patients and BM samples from healthy donors (n = 4). The median is shown by a horizontal bar. Significance of Mann–Whitney’s U-test values compared to controls are as follows: *P ≤ .05, and ***P ≤ .001.

Fig. 4. Expression of miR-196a (A) and miR-196b (B) during in vitro differentiation of CD34+ progenitor cells with the addition of following cytokines: SCF and IL-3, plus EPO or plus G-/GM-CSF. Real time RT-PCR was performed on days 0, 3, 6, 9, 13, 16, and 20. The expression of miR-196a was nearly constant, whereas miR-196b expression decreased with time. Data is expressed relative to day 0. A representative result from two independent experiments is shown.

were divided into two miRNA expression groups using the median of the miRNA expression levels as the arbitrary cutoff. Patients were classified as having low miR-196a or low miR-196b if the miRNA expression values were below the median and as high miR196a or high miR-196b if they had miRNA expression values above the median (see Fig. 5). With respect to age, no significant correlation was observed between high miR-196a and low miR-196a groups (Table 1). T-ALL patients with low miR-196a expression had higher white blood count (WBC) (P < .001) at initial diagnosis as compared to patients with high miR-196a expression. Additionally, high miR-196a expression was significantly associated with an early immunophenotype of T-ALL (P = 0.01), CD34 expression (P = .02), and with the aberrant expression of the myeloid marker CD33 (P < .01). Similar trends were seen for miR-196b,

Table 1 Clinical and molecular characteristics of T-ALL patients with respect to miR-196a and miR-196b expression. Characteristic Age, years Median Range WBC (× 109 /L) Median Range Early T-ALL (n = 27) No. (%) Thymic T-ALL (n = 66) No. (%) Mature T-ALL (n = 11) No. (%) CD34 expression, surface, % Mean Range CD33 expression, surface, % Mean Range

miR-196a low (n = 52)

miR-196a high (n = 52)

P

miR-196b low (n = 52)

miR-196b high (n = 52)

37 (18–65)

33 (15–60)

49 (1–429)

24 (2–326)

0.60

P 0.57

36 (18–65)

34 (15–60)

58 (2–429)

23 (1–315)

7 (13)

20 (38)

9 (17)

18 (34)

39 (75)

27 (52)

36 (69)

30 (58)

6 (12)

5 (10)

7 (14)

4 (8)

12 (0–80)

25 (0–97)

14 (0–80)

24 (0–97)

3 (0–26)

19 (0–98)

4 (0–53)

18 (0–98)

<0.001

0.01

0.01*

0.11*

0.02

0.05

<0.01

<0.01

P value of Mann–Whitney’s U-test and 2 -test. WBC indicates white blood counts. * Overall P value for the frequency of the three immunophenotypes across the miRNA low and high groups.

212

E. Coskun et al. / Leukemia Research 35 (2011) 208–213

Table 2 Association of miR-196a and miR-196b expression in AML with NPM1-wt vs. NPM1-mutant subgroups.

miR-196a expression miR-196b expression

Median (CI) Median (CI)

NPM1-wt (n = 32)

NPM1-mutant (n = 14)

P value

0.2 (0.2–0.4) 1.3 (0.9–1.9)

0.7 (0.4–1.3) 3.4 (2.3–8.8)

0.01 0.01

P value of Mann–Whitney’s U-test.

however no significant correlations were observed between miR-196b and immunophenotype with 34% of high miR-196b expressers classified as early T-ALL, 58% as thymic T-ALL and 8% as mature T-ALL compared to 17%, 69% and 14% of low miR-196b expressers (P = .11). Moreover, the expression of miR-196a and miR-196b positively correlated with each other (P < .0001), whereas no correlation was found between the miRNAs and ERG expression. Additionally, no significant differences in clinical outcome between high vs. low miR-196a and high vs. low miR-196b expression levels were observed. 3.6. miR-196a and miR-196b expression in AML We further characterized the association of the expression of miRNAs with clinical and molecular features in AML. When patients were grouped according to the median of the miRNA expression levels, no significant differences were observed between high vs. low miRNA expression groups with respect to age, WBC, FrenchAmerican-British classified subtypes, and FLT3 internal tandem duplication mutations. There was also no difference with respect to outcome (complete remission, relapse-free survival and overall survival). Patients having NPM1-mutations had higher expression levels of miR-196a and miR-196b compared to NPM1 wt patients (P = .01, Table 2). 4. Discussion miRNAs have emerged as important gene expression regulators involved in a variety of biological processes [19]. Analyses of miRNA expression in hematopoiesis implicate miRNAs to be involved in fine-tuning of the hematopoietic differentiation machinery [20–22]. In addition, recent evidence indicates that the deregulation of genes, involved in leukemogenesis, might be partly due to the aberrant expression of regulatory miRNAs, displaying an active role in acute leukemias [28,29]. Importantly, transcription factors, essential for normal hematopoietic maintenance, might be targets of miRNAs. For instance, miR-181a was found to regulate RUNX1, and TEL/AML, and was shown to impair cell proliferation in TEL/AML expressing cells [30]. The oncogenic ETS transcription factor ERG has an important physiological role in hematopoiesis, and was found to be an adverse prognostic factor in a subset of adult patients with CN-AML and T-ALL [14,15]. Here, we explored the regulation of ERG by miRNAs, and demonstrate that among several miRNAs predicted to regulate ERG, only miR-196a and miR-196b specifically modulated ERG expression at a posttranscriptional level. By overexpressing miR-196a and miR-196b in the myeloid cell line KG1a and in the Tlymphoblastic cell line MOLT-4, we observed downregulation of the mRNA levels of pan-ERG, as well as of the two main isoforms ERG2 and ERG3. Moreover, direct binding of miR-196a and miR-196b to the ERG 3 UTR was confirmed with luciferase reporter assay. Recent studies have already implicated both miR-196a and miR-196b in normal cell differentiation, proliferation, and in tumorgenesis of various cancer types [31–34]. miR-196a was found to inhibit proliferation and promote osteogenic differentiation in adipose tissue derived mesenchymal stem cells by targeting HOXC8 [31]. On the other hand, targeting of annexin A1 by miR-196a in esophageal cancer promoted cell proliferation,

anchorage-independent growth and suppressed apoptosis [33], suggesting the oncogenic potential of miR-196a and implying its diverse functions in various cell types. Microarray profiles of miRNA expression patterns have shown that highest expression of miR-196b levels was found in human BM and spleen cells compared to other organs [35]. Moreover, miR196b was found to be most abundant in short-term hematopoietic stem cells in mouse and was downregulated in more differentiated hematopoietic cells [34]. Our analysis of CD34+ progenitor cells demonstrated that miR-196b was highly expressed in undifferentiated CD34+ progenitors and decreased with onset of differentiation, suggesting a role for miR-196b in early hematopoiesis. We further explored the role of miR-196a and miR-196b in acute leukemias. The expression levels of miR-196a and miR-196b in AML and T-ALL patients correlated with specific molecular characteristics. In particular, in T-ALL, high expression of miR-196a and miR-196b was associated with an early immunophenotype of TALL, CD34-positivity and with the aberrant expression of CD33. In AML, the expression of miR-196a and miR-196b was significantly higher in the patient samples compared to healthy donors. Additionally, both of the miRNAs were also higher expressed in the molecular subgroup of AML carrying NPM1-mutations compared to NPM1 wt. This is in line with the study from Jongen-Lavrencic et al., showing up-regulated miR-196a and miR-196b expression levels in AML carrying NPM1-mutations [36]. miR-196a and miR-196b are located within the genomic clusters of HOXB and HOXA families that are overexpressed in AML with NPM1-mutations [37]. Furthermore, miR-196a was found to regulate HOXB8 [38], and the regulation of miR-196b was found to be similar to that of the surrounding HOX genes [34]. Thus, these observations implicate a role for miR-196a, miR-196b, and HOX genes in AML with NPM1-mutations. The expected inverse correlation between the expression of miRNAs and ERG mRNA that was not observed possibly reflects the heterogeneity in AML and T-ALL populations. The involvement of additional regulatory mechanisms of ERG needs to be further explored. In conclusion, this study demonstrates miR-196a and miR-196b as regulators of ERG. Furthermore, the decrease of miR-196b mRNA abundance during hematopoietic maturation indicates a possible role for miR-196b in early hematopoiesis. The aberrant expression of miR-196a and miR-196b in AML, and the association of miR196a and miR-196b with an immature immunophenotype, CD34 expression and with aberrant expression of CD33 in T-ALL implicate a potential role for these miRNAs in acute leukemia. Conflict of interest statement The authors reported no conflicts of interest. Acknowledgements This study was supported by grants from the Deutsche Krebshilfe (Max Eder Nachwuchsförderung). We thank Jutta Ortiz Tanchez for technical support and Liliana Mochmann for her critical reading of the manuscript. Contributions: E.C.: carried out laboratory-based research and wrote the manuscript; E.K.V. and C.S.: carried out laboratory-based research; A.K.: performed statistical analysis; N.G. and D.H.: head of

E. Coskun et al. / Leukemia Research 35 (2011) 208–213

GMALL study center, provided patient samples and clinical data; WK.H. and E.T.: contributed intellectual insights and C.D.B.: designed the research, contributed to the analysis of this study, and to the writing of this manuscript. References [1] Hoelzer D, Gokbuget N, Ottmann O, Pui C, Relling MV, Appelbaum FR, et al. Acute lymphoblastic leukemia. Hematol Am Soc Hematol Educ Program 2002:162–92. [2] Estey E, Döhner H. Acute myeloid leukaemia. The Lancet 2006;368:1894–907. [3] Mrózek K, Heinonen K, Bloomfield CD. Clinical importance of cytogenetics in acute myeloid leukaemia. Best Pract Res Clin Haematol 2001;14:19–47. [4] Grimwade D. The clinical significance of cytogenetic abnormalities in acute myeloid leukaemia. Best Pract Res Clin Haematol 2001;14:497–529. [5] Yanada M, Matsuo K, Suzuki T, Kiyoi H, Naoe T. Prognostic significance of FLT3 internal tandem duplication and tyrosine kinase domain mutations for acute myeloid leukemia: a meta-analysis. Leukemia 2005;19:1345–9. [6] Dohner K, Schlenk RF, Habdank M, Scholl C, Ru FG, Corbacioglu A, et al. Mutant nucleophosmin (NPM1) predicts favorable prognosis in younger adults with acute myeloid leukemia and normal cytogenetics: interaction with other gene mutations. Blood 2005;106:3740–6. [7] Mrózek K. Cytogenetics in acute leukemia. Blood Rev 2004;18:115–36. [8] Pui C, Jeha S. New therapeutic strategies for the treatment of acute lymphoblastic leukaemia. Nat Rev Drug Discov 2007;6:149–65. [9] Armstrong SA, Look AT. Molecular genetics of acute lymphoblastic leukemia. J Clin Oncol 2005;23:6306–15. [10] Baldus CD, Thiede C, Soucek S, Bloomfield CD, Thiel E, Ehninger G. BAALC expression and FLT3 internal tandem duplication mutations in acute myeloid leukemia patients with normal cytogenetics: prognostic implications. J Clin Oncol 2006;24:790–7. [11] Heuser M, Beutel G, Krauter J, Dohner K, von Neuhoff N, Schlegelberger B, et al. High meningioma 1 (MN1) expression as a predictor for poor outcome in acute myeloid leukemia with normal cytogenetics. Blood 2006;108:3898–905. [12] Spoo AC, Lubbert M, Wierda WG, Burger JA. CXCR4 is a prognostic marker in acute myelogenous leukemia. Blood 2007;109:786–91. [13] Loughran SJ, Kruse EA, Hacking DF, de Graaf CA, Hyland CD, Willson TA, et al. The transcription factor Erg is essential for definitive hematopoiesis and the function of adult hematopoietic stem cells. Nat Immunol 2008;9:810–9. [14] Baldus CD, Burmeister T, Martus P, Schwartz S, Gökbuget N, Bloomfield CD, et al. High expression of the ETS transcription factor ERG predicts adverse outcome in acute T-lymphoblastic leukemia in adults. J Clin Oncol 2006;24:4714–20. [15] Marcucci G, Maharry K, Whitman SP, Vukosavljevic T, Paschka P, Langer C, et al. High expression levels of the ETS-related gene, ERG, predict adverse outcome and improve molecular risk-based classification of cytogenetically normal acute myeloid leukemia: a Cancer and Leukemia Group B Study. J Clin Oncol 2007;25:3337–43. [16] Kruse EA, Loughran SJ, Baldwin TM, Josefsson EC, Ellis S, Watson DK, et al. Dual requirement for the ETS transcription factors Fli-1 and Erg in hematopoietic stem cells and the megakaryocyte lineage. PNAS 2009;106:13814–9. [17] Bohne A, Schlee C, Mossner M, Thibaut J, Heesch S, Thiel E, et al. Epigenetic control of differential expression of specific ERG isoforms in acute T-lymphoblastic leukemia. Leukemia Res 2009;33:817–22. [18] Naguibneva I, Ameyar-Zazoua M, Polesskaya A, Ait-Si-Ali S, Groisman R, Souidi M, et al. The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation. Nat Cell Biol 2006;8:278–84. [19] Bartel DP, Lee R, Feinbaum R. MicroRNAs: genomics, biogenesis, mechanism, and function genomics: the miRNA genes. Cell 2004;116:281–97.

213

[20] Felli N, Fontana L, Pelosi E, Botta R, Bonci D, Facchiano F, et al. MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation. PNAS 2005;102:18081–6. [21] Fazi F, Rosa A, Fatica A, Gelmetti V, De Marchis ML, Nervi C, et al. A minicircuitry comprised of microRNA-223 and transcription factors NFI-A and C/EBPalpha regulates human granulopoiesis. Cell 2005;123:819–31. [22] Lu J, Guo S, Ebert BL, Zhang H, Peng X, Bosco J, et al. MicroRNA-mediated control of cell fate in megakaryocyte–erythrocyte progenitors. Dev Cell 2008;14:843–53. [23] Zhao H, Wang D, Du W, Gu D, Yang R. MicroRNA and leukemia: tiny molecule, great function. Crit Rev In Oncol/Hematol 2009, doi:10.1016/j.critrevonc.2009.05.001. [24] Marcucci G, Radmacher MD, Maharry K, Mrózek K, Ruppert AS, Paschka P, et al. MicroRNA expression in cytogenetically normal acute myeloid leukemia. N Engl J Med 2008;358:1919–28. [25] Marcucci G, Maharry K, Radmacher MD, Mrózek K, Vukosavljevic T, Paschka P, et al. Prognostic significance of, and gene and microRNA expression signatures associated with, CEBPA mutations in cytogenetically normal acute myeloid leukemia with high-risk molecular features: a Cancer and Leukemia Group B Study. J Clin Oncol 2008;26:5078–87. [26] Zanette DL, Rivadavia F, Molfetta GA, Barbuzano FG, Proto-Siqueira R, Silva-Jr WA, et al. miRNA expression profiles in chronic lymphocytic and acute lymphocytic leukemia. Braz J Med Biol Res 2007;40:1435–40. [27] Romania P, Lulli V, Pelosi E, Biffoni M, Peschle C, Marziali G. MicroRNA 155 modulates megakaryopoiesis at progenitor and precursor level by targeting Ets-1 and Meis1 transcription factors. Br J Haematol 2008;143:570–80. [28] Garzon R, Garofalo M, Martelli MP, Briesewitz R, Wang L, Fernandez-Cymering C, et al. Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. PNAS 2008;105:3945–50. [29] Mi S, Li Z, Chen P, He C, Cao D, Elkahloun A, et al. Aberrant overexpression and function of the miR-17-92 cluster in MLL-rearranged acute leukemia. PNAS 2010;107:1–6. [30] Hickey C, Schwind S, Becker H, Alachkar H, Garzon R, Wu Y, et al. MicroRNA181a targets TEL/AML1 expression and impairs cell proliferation in t(12;21) acute lymphocytic leukemia (ALL) cells. ASH Annual Meeting Abstracts 2009;114:766. [31] Kim YJ, Bae SW, Yu SS, Bae YC, Jung JS. miR-196a regulates proliferation and osteogenic differentiation in mesenchymal stem cells derived from human adipose tissue. J Bone Miner Res 2009;24:816–25. [32] Schimanski CC. High miR-196a levels promote the oncogenic phenotype of colorectal cancer cells. World J Gastroenterol 2009;15:2089. [33] Luthra R, Singh RR, Luthra MG, Li YX, Hannah C, Romans AM, et al. MicroRNA196a targets annexin A1: a microRNA-mediated mechanism of annexin A1 downregulation in cancers. Oncogene 2008;27:6667–78. [34] Popovic R, Riesbeck LE, Velu CS, Chaubey A, Zhang J, Achille NJ, et al. Regulation of mir-196b by MLL and its overexpression by MLL fusions contributes to immortalization. Blood 2009;113:3314–22. [35] Baskerville S, Bartel DP. Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes. RNA 2005;11: 241–7. [36] Jongen-Lavrencic M, Sun SM, Dijkstra MK, Valk PJ, Lowenberg B. MicroRNA expression profiling in relation to the genetic heterogeneity of acute myeloid leukemia. Blood 2008;111:5078–85. [37] Alcalay M, Tiacci E, Bergomas R, Bigerna B, Venturini E, Minardi SP, et al. Brief report Acute myeloid leukemia bearing cytoplasmic nucleophosmin (NPMc + AML) shows a distinct gene expression profile characterized by upregulation of genes involved in stem-cell maintenance Study design. Blood 2005;106:899–902. [38] Yekta S, Shih I, Bartel DP. MicroRNA-directed cleavage of HOXB8 mRNA. Science 2004;304:594–6.