The Role of Neurokinin 1 Receptors in the Maintenance of Visceral Hyperalgesia Induced by Repeated Stress in Rats

GASTROENTEROLOGY 2006;130:1729 –1742

The Role of Neurokinin 1 Receptors in the Maintenance of Visceral Hyperalgesia Induced by Repeated Stress in Rats SYLVIE BRADESI,*,‡,§ EFI KOKKOTOU,¶ SIMOS SIMEONIDIS,¶ SIMONA PATIERNO,*,‡,§ HELENA S. ENNES,*,‡ YASH MITTAL,*,‡ JAMES A. MCROBERTS,*,‡ GORDON OHNING,*,‡,§ PETER MCLEAN,# JUAN CARLOS MARVIZON,*,§ CATIA STERNINI,*,‡,§,储,** CHARALABOS POTHOULAKIS,¶ and EMERAN A. MAYER*,‡,§,**,†† *Center for Neurovisceral Sciences and Women’s Health, Department of Medicine, ‡CURE: Digestive Diseases Research Center, 储 Department of Neurobiology, **Brain Research Institute, and ††Department of Physiology, Psychiatry, and Biobehavioral Sciences, David Geffen School of Medicine, University of California, Los Angeles (UCLA), Los Angeles, California; §VA Greater Los Angeles Healthcare System, Los Angeles, California; ¶Gastrointestinal Neuropeptide Center, Division of Gastroenterology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts; and #GlaxcoSmithKline (Neurology & G1 Centre of Excellence for Drug Discovery), Harlow, UK

Background & Aims: The neurokinin 1 receptors (NK1Rs) and substance P (SP) have been implicated in the stress and/or pain pathways involved in chronic pain conditions. Here we examined the participation of NK1Rs in sustained visceral hyperalgesia observed in rats exposed to chronic psychological stress. Methods: Male Wistar rats were exposed to daily 1-hour water avoidance stress (WA) or sham WA for 10 consecutive days. We tested intraperitoneal or intrathecal injection of the NK1R antagonist SR140333 on the visceromotor reflex to colorectal distention in both groups at day 11. Real-time reverse-transcription polymerase chain reaction, Western blot, and immunohistochemistry were used to assess the expression of NK1Rs and/or SP in samples of colon, spinal cord, and dorsal root ganglia. Results: Both intraperitoneal and intrathecal SR140333 injection diminished the enhanced visceromotor reflex to colorectal distention at day 11 in stressed rats but did not affect the response in control animals. Realtime polymerase chain reaction and Western blotting demonstrated stress-induced up-regulation of spinal NK1Rs. Immunohistochemistry showed an increased number of NK1R-expressing neurons in the laminae I of the dorsal horn in stressed rats. The expression of NK1Rs was decreased in colon from stressed rats compared with control. The expression of SP gene precursor in dorsal root ganglia was unchanged in stressed rats compared with controls. Conclusions: Stress-induced increased NK1R expression on spinal neurons and the inhibitory effect of intrathecal NK1R antagonist on visceral hyperalgesia support the key contribution of spinal NK1Rs in the molecular pathways involved in the maintenance of visceral hyperalgesia observed after chronic WA.

rritable bowel syndrome belongs to a group of stresssensitive chronic disorders that shares visceral hyperalgesia and altered autonomic nervous system responsive-

I

ness and commonly overlaps with anxiety disorders such as posttraumatic stress disorder and panic disorder.1 Based on pathophysiologic models of enhanced responsiveness of brain-gut interactions2 and of central stress circuits,3 several neuropeptide receptors have been implicated as plausible targets for novel therapies for irritable bowel syndrome, including the corticotropin-releasing factor (CRF)/CRF1 receptor system and the substance P (SP)/neurokinin 1 receptor (NK1R) system.4,5 Both preclinical and clinical studies suggest that endogenous release of SP is involved in acute and chronic activation of central stress and/or pain circuits.6 – 8 Recent evidence obtained in patients with posttraumatic stress disorder showed increased cerebrospinal fluid levels of SP-like immunoreactivity, suggesting increased release of SP from sources involved in central stress circuits.9 Increased cerebrospinal fluid levels of SP have also been reported in patients with chronic functional pain syndromes such as fibromyalgia10,11 and in irritable bowel syndrome.12 Even though it is unclear if human SP cerebrospinal fluid levels in these conditions reflect increased release from spinal and/or supraspinal structures, these findings strongly suggest involvement of the SP/NK1R Abbreviations used in this paper: ANOVA, analysis of variance; CRD, colorectal distention; CRF, corticotropin-releasing factor; DRG, dorsal root ganglia; EMG, electromyographic; IR, immunoreactive; NK1R, neurokinin 1 receptor; PPT-A, preprotachykinin A; RT-PCR, reverse-transcription polymerase chain reaction; VMR, visceromotor response; WA, water avoidance. © 2006 by the American Gastroenterological Association Institute 0016-5085/06/$32.00 doi:10.1053/j.gastro.2006.01.037

1730

BRADESI ET AL

signaling system within the central nervous system in stress-related chronic anxiety and pain conditions. In rodents, SP and NK1Rs are widely distributed throughout the central and peripheral nervous system, particularly on spinal neurons in laminae I and X, where visceral primary afferents terminate,13,14 and in brain areas involved in affective and stress responses.15 In the gut, SP and/or NK1Rs are present on enteric neurons,16 peripheral terminals of spinal afferents, capsaicin-sensitive sensory neurons,17,18 and immune cells.17,19,20 At the spinal cord level, SP is released from small-diameter sensory C fibers into the dorsal horn in response to intense peripheral stimulation, including inflammation, tissue irritation, or sustained noxious stimuli.21,22 It is now well established that activation of NK1R neurons on laminae I of the dorsal horn contributes to the development of somatic hyperalgesia. For example, selective ablation of these neurons using an SP/toxin conjugate produces a dramatic decrease in hyperalgesia induced by capsaicin, inflammation, and nerve injury,23,24 without compromising the response to acute noxious stimulation. Similarly, spinal injections of SP antibodies or NK1R antagonist block the somatic hyperalgesia induced by repeated cold stress in rats.25,26 Because the great majority of lamina I neurons project to central structures involved in descending modulation of nociception, it has been suggested that they are part of a spinal-bulbo-spinal circuitry that modulates pain signaling in sensitized conditions.27,28 In terms of visceral nociception, accumulating evidence indicates the contribution of the NK1R/SP system in stress- or colonic irritation–induced visceral hyperalgesia. Both peripheral and spinal sites of action have been proposed.29 –31 The observation that mice with a selective deletion of the NK1R gene show a normal visceral nociceptive response under acute stimulation, but fail to develop hyperalgesia following colonic inflammation, confirms a specific role of the SP/NK1R signaling system in the regulation of visceral nociception in sensitized states.32 Taken together, the available data support the involvement of the SP/NK1R system in the transmission and processing of enhanced nociception from both the somatic and visceral fields. An up-regulation of this signaling system is seen in human and animal models of stress sensitization6 – 8 and of inflammation-induced hyperalgesia.33,34 Yet, the site and mechanism underlying the plasticity of this signaling system in the condition of persistent visceral pain are poorly understood. In the present study, we tested the general hypothesis that the maintenance of sustained visceral hyperalgesia following repeated psychological stress observed in a

GASTROENTEROLOGY Vol. 130, No. 6

recently reported rodent model35 involves the up-regulation of the SP/NK1R system. Specifically, we tested whether chronic stress-induced visceral hyperalgesia is abolished by an NK1R antagonist and whether this hyperalgesia is associated with up-regulation of the SP/ NK1R signaling system on visceral afferent pathways, either at the periphery and/or in the spinal cord. We report that visceral hyperalgesia in this model is abolished by spinal application of an NK1R antagonist and that this response is associated with a selective upregulation of the NK1R on superficial dorsal horn neurons.

Materials and Methods Animals Adult male Wistar rats (250 –275 g) were purchased from Harlan (Indianapolis, IN). Animals were maintained on a normal light-dark cycle, housed in pairs or singly when equipped with a chronic intrathecal catheter. They were provided with food and water ad libitum. All protocols were approved by the Institutional Animal Care and Use Committee at the VA Greater Los Angeles Healthcare System (Los Angeles, CA).

Surgery Implantation of electromyographic electrodes. Adult male rats were deeply anesthetized with pentobarbital sodium (45 mg/kg, Nembutal; Abbott Laboratories, North Chicago, IL) administered intraperitoneally (IP). Electrodes (Teflon-coated stainless steel wire; AstraZeneca, Mölndal, Sweden) were stitched into the external oblique musculature, just superior to the inguinal ligament, for electromyographic (EMG) recordings as previously described.36 Electrode leads were then tunneled subcutaneously and externalized laterally for future access. Wounds were closed in layers with 4-0 silk. Following surgery, rats were allowed to recover for 5–7 days. Wounds were tested for tenderness to ensure complete recovery from surgery before testing. Implantation of chronic intrathecal catheter. Rats were deeply anesthetized with pentobarbital sodium (45 mg/kg, Nembutal; Abbott Laboratories) administered IP. Animals were placed in a stereotaxic frame, and a small incision was made at the back prone of the neck. A small puncture was made in the atlanto-occipital membrane of the cisterna magna, and a 32-gauge polyurethane catheter of 8.5 cm (ReCathCo, LLC, Allison Park, PA) was inserted such that the caudal tip reached the lumbar enlargement of the spinal cord. The dead volume of the catheter was 10 ␮L. The rostral end of the catheter was exteriorized at the top of the head, and sutures were used to secure the placement of the catheter and close the wound. The rats were allowed to recover from the surgery for 5–7 days. Rats exhibiting any sign of neurologic or motor impairment, as evidenced by

May 2006

paralysis, abnormal gait, weight loss, or negligent grooming, were excluded from the study. Rats were housed separately to ensure catheter patency. After completion of drug testing, the catheter position was verified in each animal by postmortem examination of the spinal cord.

Assessment of Visceromotor Response to Colorectal Distention The visceral stimulus used was distention of the descending colon and rectum using a well-established and validated method for the evaluation and quantification of visceral nociceptive responses.36 Briefly, under light halothane anesthesia, a flexible latex balloon (6 cm) was inserted intra-anally (after the distal part of the rectum was gently cleared by massage) such that its end was 1 cm proximal to the anus. Once recovered from anesthesia, animals equipped with the balloon were placed in a Plexiglas cylinder for 30 minutes before the colorectal distention (CRD) procedure was initiated. The CRD procedure consisted of 2 series of phasic CRDs to constant pressures of 10, 20, 40, and 60 mm Hg (20-second duration; 4-minute interstimulus interval). The visceromotor response (VMR) to CRD was quantified by measuring EMG activity in the external oblique musculature. EMG activity was recorded 20 seconds before (baseline), 20 seconds during, and 20 seconds after termination of CRD. The EMG activity was rectified, and the increase in the area under the curve of EMG amplitude during CRD over the baseline period before CRD was recorded as the response. In the following text, we use the term EMG referring to the VMR to CRD. Animals showing an EMG signal/noise ratio ⬍0.05 were excluded from the study.

Water Avoidance Stress Protocol The test apparatus consisted of a Plexiglas tank (25 ⫻ 25 ⫻ 45 cm) with a block (8 ⫻ 8 ⫻ 10 cm) affixed to the center of the floor. The tank was filled with fresh water at room temperature (25°C) to within 1 cm of the top of the block. The animals were placed on the block for 1 hour daily for 10 consecutive days corresponding to the chronic stress protocol (water avoidance [WA]). The sham WA stress consisted of placing the rats similarly for 1 hour daily for 10 days on the same platform in a waterless container. This well-characterized test represents a potent psychological stressor with large elevations of adrenocorticotropic hormone and corticosterone levels within 30 minutes.37

Detection of NK1R and SP Messenger RNA Expression Semiquantitative polymerase chain reaction for detection of NK1R messenger RNA in the colon. Total RNA was isolated by the TRIzol extraction method (Invitrogen Inc, Carlsbad, CA). RNA integrity was confirmed by electrophoresis through a 1% agarose gel containing formaldehyde. Complementary DNA was prepared from 1 ␮g of total RNA as previously described. Added in a ribonuclease-free

CHRONIC STRESS–INDUCED VISCERAL HYPERALGESIA

1731

tube were 2–5 ␮g RNA, 1 ␮L random primer (0.125 ␮g/␮L), and ribonuclease-free water to a final volume of 10 ␮L. Tubes were heated at 70°C for 2 minutes, put on ice, and then 4 ␮L of ribonuclease-free water, 5 ␮L of 5⫻ RT buffer, 2 ␮L of 10 mmol/L deoxynucleoside triphosphates, 2 ␮L of 0.1 mol/L dithiothreitol, 1 ␮L of RNasin (40 U/␮L; Promega, Pittsburgh, PA), and 1 ␮L of Moloney murine leukemia virus reverse transcriptase (200 U/␮L; Invitrogen Inc) were added. The RT reaction was performed at 37°C for 1 hour and 70°C for 15 minutes, and then tubes were left on ice for polymerase chain reaction (PCR). The primers used for the PCR of the NK1R gene were as follows: forward primer 1, 5= GACTCCTCTGACCGCTACCA 3=, reverse primer 2, 5= GGATTTCATTTCCAGCCCCT 3=. The PCR reaction contained 39.75 ␮L of sterile water, 5 ␮L of 10⫻ PCR buffer, 1 ␮L of 10 mmol/L deoxynucleoside triphosphates, 1 ␮L of each forward and reverse primer, 1 ␮L of primer 2, 4 ␮L of 18S primers/18S competitor (1:9 ratio; Ambion, Austin, TX), 0.25 ␮L of Taq DNA polymerase (50 ␮g/␮L; Qiagen, Valencia, CA), and 2 ␮L of the RT reaction mixture. The PCR condition for coamplification of NK1R and 18S messenger RNA (mRNA) was initial denaturation for 5 minutes at 94°C, followed by 3-step cycling: denaturation for 0.5 minutes at 94°C, annealing for 0.5 minutes at 58°C, and extension for 0.5 minutes at 72°C (45 cycles), followed by final extension for 7 minutes at 72°C. Products were resolved by 1.2% agarose. Quantification of the reverse-transcription (RT)-PCR bands was performed using a phosphorimager (Quantity one Gel doc program; Bio-Rad, Hercules, CA) and expressed the amount of NK1R PCR product relative to that of the 18S PCR product. Real-time RT-PCR for detection of SP mRNA (preprotachykinin A) and NK1R mRNA in spinal cord and dorsal root ganglia. Immediately after collection, samples of dorsal root ganglia (DRG) (corresponding to the spinal level L1–L2) and spinal cord (L1–L2) were stored in RNAlater (Qiagen) at ⫺80°C until RNA extraction. Total RNA was isolated using the RNeasy Mini Kit along with deoxyribonuclease treatment (Qiagen). Using the Taq-Man One Step RTPCR reagents (Applied Biosystems, Foster City, CA), genespecific primers, and FAM-labeled probe (TaqMan Assay by Demand; Applied Biosystems), 50 ng of RNA was subjected to RT-PCR. The samples were run in duplicate in an ABI 5700 Sequence Detection System (Applied Biosystems), and the values obtained (arbitrary mRNA units) were normalized by TBP expression and compared between the WA group and sham WA control. Detection of SP mRNA expression was performed by measuring the mRNA for the gene PPT-A, primary transcript for the synthesis of SP.

Detection of NK1R Protein Expression Western blotting for NK1R in samples of distal colon and spinal cord. Immediately after collection, samples were frozen on dry ice and stored at ⫺80°C until they were processed. Proteins extracted from colonic or spinal cord samples of similar weight (200 mg) for each experimental group were subjected to sodium dodecyl sulfate/polyacrylamide gel

1732

BRADESI ET AL

electrophoresis on 3%– 8% gels and electrophoretically transferred to nitrocellulose membranes (Invitrogen, Inc). A positive control (50-␮g load) (catalog SC-2239; Santa Cruz Biotechnology, Santa Cruz, CA) was processed simultaneously. The membranes were blocked for 1 hour in 5% nonfat dry milk in phosphate-buffered saline (PBS) and were incubated with NK1R rabbit antiserum (catalog AB5060; Chemicon, Temecula, CA) at a final dilution of 1:1000 overnight at 4°C. The membranes were then washed and incubated with horseradish peroxidase– conjugated anti-rabbit immunoglobulin G at 1:10,000 dilution for 1 hour at room temperature. Control included preabsorption of the diluted primary antisera with receptor fragments (393KTMTESSSFYSNMLA407, 1 mg/mL) overnight at 4°C before incubation with the membrane. Immunoreactive (IR) bands were detected using enhanced chemiluminescence reagents (Amersham Pharmacia, Piscataway, NJ). Autoradiograms were scanned using the GS-710 Calibrated Imaging Densitometer (Bio-Rad), and the labeled bands were quantified using the Quantity software program (Bio-Rad). Immunohistochemical characterization of NK1R in samples of distal colon and spinal cord. On the day of tissue collection, rats were anesthetized with halothane and perfused intracardially with cold PBS and subsequently with 4% paraformaldehyde in 0.1 mol/L phosphate buffer, pH 7.4. The distal part of the colon and the L1–L2 segments of spinal cord were removed and postfixed in the same fixative overnight and were then transferred to 30% sucrose in 0.1 mol/L phosphate buffer, pH 7.4, for cryoprotection. Cryostat sections on the coronal plan (5 ␮m for the colon and 25 ␮m for the spinal cord) were performed and processed for immunohistochemistry for NK1R. Sections were washed twice with PBS, followed twice with a solution of PBS, 0.3% Triton X-100, and 0.001% thimerosal (PBS/Triton) containing 5% normal goat serum and then incubated at room temperature overnight with the NK1R primary antibodies. We used an NK1R rabbit antiserum (1:1000 dilution for the colon, 1:3000 dilution for the spinal cord) raised against amino acids 393– 407 of the rat NK1R (catalog AB5060; Chemicon). This antiserum has been previously characterized for immunohistochemistry and Western blot analysis.16 Sections were then washed 3 times with PBS and incubated for 2 hours at room temperature with the secondary antibodies in PBS/Triton. Secondary antibodies were goat anti-rabbit immunoglobulin G conjugated to Alexa 488 fluorophore (Molecular Probes, Eugene, OR). Sections were then washed 4 more times with PBS and mounted in Prolong (Molecular Probes). Microscopy and image processing. Both colonic and spinal cord preparations were analyzed with a Zeiss Axioplan 2 research microscope equipped with fluorescence and Axiocam color digital camera system (Carl Zeiss Inc, Thornwood, NY). A Zeiss Plan-Apochromat 40⫻ oil-immersion objective (Carl Zeiss Inc) was used to collect images of colonic and spinal cord sections. In addition, confocal images were collected to illustrate NK1R-expressing neurons. Confocal images were acquired at UCLA’s Carol Moss Spivak Cell Imaging

GASTROENTEROLOGY Vol. 130, No. 6

Facility with a Leica TCS-SP confocal microscope (Wetzlar, Germany) as previously described.38 – 42 Images obtained with the 20⫻ objective consist of 2 optical sections 2.53 ␮m thick (full width half maximum) separated 2.48 ␮m. Images obtained with the 100⫻ objective consist of 2 or 3 optical sections (full width half maximum of 0.62 ␮m) separated 0.57 ␮m. Images were processed with Adobe Photoshop 5.5 (Kennesaw, GA), using the “curves” feature of the program to adjust the contrast. Images were initially acquired at a digital size of 1024 ⫻ 1024 pixels and were later cropped to the relevant part of the field. The pinhole was 1.0 Airy unit. Optical sections were averaged 4 times to reduce noise. The number of NK1R IR neurons was quantified using established protocols38 – 40 with minor modifications.41,42 Briefly, we determined the total number of NK1R IR neurons in the laminae I of the dorsal horn. We counted the number of NK1R IR neurons in 5 sections from the L1–L2 segment of the spinal cord from each rat. The person counting the neurons was unaware of the prior treatment given to the animals.

Experimental Design Visceral nociceptive response to chronic WA stress: effect of peripheral and spinal treatment with the NK1R antagonist SR140333. A total of 8 groups of 6 rats were included in this study. Animals were equipped with electrodes in the abdominal muscles for the EMG recording. After placement of the electrodes, rats were allowed to recover for 5–7 days. Acclimation to the experimental conditions was performed for 3 days preceding the start of the experiment. Each day, animals were transported to the testing room and placed for 30 minutes in the Plexiglas cylinders used for partial restraint during the CRD experiments. On day 0, a baseline response to CRD was evaluated (CRD#1). From day 1 to day 10, rats were submitted daily to either 1-hour WA for the stress group or to 1-hour sham WA for the control group. The response to CRD was recorded again 24 hours after the end of the last WA or sham WA session, on day 11 (CRD#2). The effect of the NK1R antagonist SR140333 (provided by Sanofi Aventis, Montpellier, France) on the response to CRD at day 11 was tested according to the following protocol. Four groups of rats were used to test the effect of peripheral injection of the NK1R antagonist. SR140333 (1 mg/kg) or vehicle (2% dimethyl sulfoxide in 0.9% saline, 1 mL/kg) was injected IP 1 hour after the end of CRD#2. Then, the response to CRD was again measured 1 hour after injection of the compound (CRD#3). SR140333 and vehicle were tested in both chronically stressed and sham stressed animals. The dose of 1 mg/kg was selected based on published reports.29,43 Four different groups of rats were used to test the effect of spinal injection of NK1R antagonist. At the time of surgical placement of EMG electrodes, animals were equipped with intrathecal catheters implanted chronically. SR140333 (20 ␮g/kg) or vehicle (2% dimethyl sulfoxide in 0.9% saline) was injected 1 hour after the end of CRD#2 via the intrathecal catheter. Volume of injection was 6 ␮L followed by a 10-␮L

May 2006

flush of vehicle. The response to CRD was measured again 30 minutes after injection (CRD#3). SR140333 and vehicle were tested in both chronically stressed and sham stressed animals. After completion of drug testing, the catheter position was verified in each animal by postmortem examination of the spinal cord, and only animals with the appropriate catheter position on the dorsal side of the spinal cord were included in the study. The dose of 20 ␮g/kg was selected based on a published report.44 Collection of colonic, spinal cord, and DRG samples for NK1R expression analysis. The different samples collected for molecular analysis were taken from animals that had not undergone surgery or CRD to avoid the potential bias that this procedure may induce regarding neurotransmitter production or release. This strategy permitted us to study the effect of chronic stress per se on NK1R and SP expression. Two groups of 8 rats were used for the collection of fresh samples to be processed for semiquantitative RT-PCR or realtime RT-PCR and Western blotting. Animals were subjected either to WA stress or sham WA 1 hour daily for 10 consecutive days. On day 11, animals were killed, and samples of distal colon, spinal cord, and DRG were quickly removed and then placed either in RNAlater solution for RT-PCR experiments or frozen on dry ice for Western blotting analysis. Spinal cord samples and DRG were collected from the lumbar level L1–L2, corresponding to one of the segments that receives primary afferents from the colon. This specific segment was previously shown to play a role in persistent visceral pain and visceral hyperalgesia.45 Two separate groups of 8 rats were used to generate tissues for immunohistochemical analysis of the colon and spinal cord. As previously described, samples of distal colon and spinal cord were collected after perfusion with fixative and processed for NK1R immunolabeling.

Data Presentation and Statistical Analysis To examine the pressure-response relationship, EMG amplitudes were normalized as percentage of the baseline response for the highest pressure (60 mm Hg) for each rat and averaged for each group of rats. This type of normalization has generally been used to account for individual variations of the EMG signal.29 The effect of stress and/or pharmacologic treatment on the EMG response to CRD within one group of animals was analyzed by comparing the poststress or posttreatment measurements with the baseline or pretreatment values at each distention pressure using repeated-measures 2-way analysis of variance (ANOVA) followed by Bonferroni posttest comparisons. We have presented the data showing the EMG response at day 11 for rats treated with compound or vehicle expressed as the mean change from baseline for different pressures of distention. This method of analysis has been previously validated in a similar model of EMG measurement in response to CRD.29 These data were analyzed using Student t test.

CHRONIC STRESS–INDUCED VISCERAL HYPERALGESIA

1733

Data for the expression of NK1Rs and SP obtained from RT-PCR, Western blot, and immunohistochemistry between stressed and control groups were compared using an unpaired t test.

Results Effect of Pharmacologic Blockade of NK1Rs on Chronic WA Stress-Induced Visceral Hyperalgesia IP injection of the NK1R antagonist SR140333.

There was a significant increase of the VMR following repeated exposure to WA stress at day 11 (CRD#2) compared with baseline (CRD#1). The increase was significant for the pressures of 40 and 60 mm Hg (P ⬍ .05, repeated-measures ANOVA followed by Bonferroni posttest). One hour later, the effect of systemic application of the NK1R antagonist SR140333 (at the previously established dose of 1 mg/kg27) or vehicle was tested on the VMR to CRD#3. As shown in Figure 1A, SR140333 abolished the stress-induced increase of the VMR compared with vehicle (Student t test, comparison between groups treated with SR140333 and vehicle). SR140333 application reduced the EMG response to a level similar to baseline (change in EMG response after SR140333 over baseline, ⫹2.2 ⫾ 8.7 at 40 mm Hg and ⫺8.0 ⫾ 10.6 at 60 mm Hg), while no significant effect of vehicle application was observed (change in EMG response after vehicle over baseline, ⫹51.2 ⫾ 18.2 at 40 mm Hg and ⫹49.1 ⫾ 16 at 60 mm Hg). To determine the effect of the NK1R antagonist in control conditions, we tested the response to SR140333 or vehicle injection in animals previously subjected to repeated sham WA stress. Compared with baseline, repeated exposure to sham WA stress had no significant effect on the VMR to CRD. As shown in Figure 1B, injection of vehicle or SR140333 did not change the response to CRD. Finally, there was no difference in the EMG response to CRD#3 compared with CRD#2 after vehicle injection in the WA group or after vehicle or SR140333 injection in the sham WA group, indicating that repeated CRD at day 11 does not affect the VMR. Intrathecal injection of the NK1R antagonist SR140333. Consistent with results from previous ex-

periments, repeated exposure to WA stress resulted in an increased VMR to CRD for the pressures of 40 and 60 mm Hg at day 11 compared with baseline (P ⬍ .05, repeated-measures ANOVA followed by Bonferroni posttest). While vehicle injection had no effect on the increased EMG response at day 11 (change in EMG

1734

BRADESI ET AL

GASTROENTEROLOGY Vol. 130, No. 6

response after vehicle over baseline, ⫹38.3 ⫾ 23.1 at 40 mm Hg and ⫹113.1 ⫾ 37.1 at 60 mm Hg), intrathecal SR140333 (20 ␮g/kg) abolished the enhanced VMR (change in EMG response after vehicle over baseline, ⫺16.7 ⫾ 15.3 at 40 mm Hg and ⫹1.9 ⫾ 9.6 at 60 mm Hg, Student t test, comparison between groups treated with SR14033 and vehicle; Figure 2A). The change in EMG response at the highest pressure of distention (60 mm Hg) in stressed rats injected with vehicle intrathecally was 113.13 ⫾ 37.14, whereas it was only 49.14 ⫾ 16.10 in stressed rats injected with vehicle IP. However, this difference did not reach statistical significance (P ⫽ .1767) and illustrates the interanimal variability of EMG response after chronic stress as previously discussed in a recent report.35

Figure 2. Effect of central administration of the NK1R antagonist SR140333 (20 ␮g/kg intrathecally) on the VMR to CRD (day 11). (A) EMG amplitude expressed as mean change from baseline after treatment with vehicle or SR140333 in rats previously exposed to repeated WA stress. Intrathecal injection of SR140333 abolished the chronic stress-enhanced VMR to CRD compared with vehicle at the pressures of distention of 40 and 60 mm Hg. (B) EMG amplitude expressed as mean change from baseline after treatment with vehicle or SR140333 in rats previously exposed to chronic sham WA stress. SR140333 did not affect the EMG response after chronic sham WA stress compared with vehicle. Data are expressed as mean ⫾ SE, n ⫽ 6 in each group, *P ⬍ .05 significantly different compared with vehicle, Student t test.

Figure 1. Effect of peripheral administration of the NK1R antagonist SR140333 (1 mg/kg IP) on the VMR to CRD (day 11). (A) EMG amplitude expressed as mean change from baseline after treatment with vehicle or SR140333 in rats previously exposed to repeated WA stress. IP injection of SR140333 abolished the WA stress-induced increase in the VMR to CRD at pressures of 40 and 60 mm Hg. (B) EMG amplitude expressed as mean change from baseline after treatment with vehicle or SR140333 in rats previously exposed to repeated sham WA stress. SR140333 did not affect the EMG response after chronic sham WA stress compared with vehicle. Data are expressed as mean ⫾ SE, n ⫽ 6 in each group, *P ⬍ .05 significantly different compared with vehicle, Student t test.

As shown in Figure 2B, in sham WA condition, neither vehicle nor intrathecal SR140333 affected the EMG response to CRD for any pressure of distention. Effect of Chronic WA Stress on NK1R and SP Expression Expression of NK1R and SP in the spinal cord. The effect of chronic WA stress on NK1R and SP expression in the spinal cord was assessed using real-time quantitative RT-PCR, Western blotting analysis, and immunohistochemistry.

May 2006

Figure 3. Expression of NK1Rs in L1–L2 spinal cord segments following repeated WA stress. (A) Levels of mRNA for NK1R measured by real-time quantitative RT-PCR. We observed a significantly higher level of NK1R mRNA in samples from chronic WA stress rats compared with control. Data are expressed as the relative NK1R PCR product to that of the housekeeping gene GAPDH, mean ⫾ SEM, n ⫽ 8 in each group, *P ⬍ .05, significantly different from sham WA, Student t test. (B) Levels of NK1R protein measured by Western blotting. A significant increase in the level of NK1R proteins in samples from chronic WA stress rats compared with control was observed. Data are expressed as normalized optical density, mean ⫾ SEM, n ⫽ 8 in each group, *P ⬍ .05, significantly different from sham WA, Student t test. (C) Representative Western blotting for NK1R in spinal cord extracts showing a prominent band at ⬃65 kilodaltons.

Real-time quantitative RT-PCR for NK1R mRNA in L1–L2 spinal cord samples. NK1R mRNA was expressed in the L1–L2 segment of the spinal cord, and the authenticity of the PCR product was verified by sequencing analysis. We found enhanced expression for NK1R mRNA in samples from WA stressed animals compared with the sham WA group. Relative expression of NK1R mRNA to glyceraldehyde-3-phosphate dehydrogenase was 2.5 ⫾ 0.3 in the sham WA group and 11.3 ⫾ 2.3 in the WA group (ex-

CHRONIC STRESS–INDUCED VISCERAL HYPERALGESIA

1735

pressed as arbitrary units, P ⫽ .0053, Student t test; Figure 3A). Western blotting of NK1R protein in samples of L1–L2 spinal cord. Western blot analysis in WA and control sham groups revealed a ⬃65-kilodalton band corresponding to the NK1R protein (Figure 3C). The authenticity of the NK1R protein was verified by simultaneous migration of a positive control for NK1R protein antiserum (cell lysate; Santa Cruz Biotechnology) at the same level. The specificity of the antibody immunostaining was confirmed by significant reduction of the intensity of the band in samples blotted with the antibody preadsorbed with an excess of receptor fragment used for the antibody production 393KTMTESSSFYSNMLA407. Quantitative densitometry of the Western blots showed a significant increase of 80% in NK1R protein expression in the WA group compared with the sham WA group (P ⫽ .0004, Student t test; Figure 3B). A representative illustration of the reduced signal intensity after preabsorption with peptide fragment in both spinal cord extracts and a positive control load is shown in Figure 4. Immunohistochemical localization of NK1Rs in spinal cord samples. In both control and stress conditions, a pattern of spinal NK1R immunoreactivity consistent with previous reports on dorsal horn NK1R localization was observed.41 NK1R IR neurons were localized in laminae I, V, and VI and around the central canal (laminae X), with the densest staining observed in lamina I (Figure 5A and B). In all regions, NK1R immunoreactivity was predominant on the plasma membrane, as shown in confocal pictures of spinal cord sections from both control and stressed animals. In some neurons from both groups, a few endosomes were found near the cell surface but did not meet our criteria for NK1R internalized neurons. In laminae I, a quantifiable increase in the

Figure 4. Representative illustration of Western blots showing the migration of spinal cord extracts incubated either with the primary anti-NK1R serum alone (A1) or the primary anti-NK1R serum preabsorbed with the receptor peptide fragment (B1); preincubation with the antigenic receptor fragment reduces the intensity of staining compared with A1. Similar results were observed with a positive control load migrating at the same level (⬃65 kilodaltons); preabsorption with the receptor peptide fragment attenuated the intensity of staining (B2) compared with incubation with primary antibody alone (A2).

1736

BRADESI ET AL

Figure 5. Representative confocal images of NK1R IR neurons in the dorsal horn of the L1–L2 spinal segment of rats subjected to (A) chronic sham WA stress or (B) chronic WA stress. Images in the main panels were taken with a 20⫻ objective (scale bars ⫽ 50 ␮m) and consist of 2 optical sections 2.53 ␮m thick separated 2.48 ␮m. Images in the insets were taken with a 100⫻ objective (scale bars ⫽ 10 ␮m) and consist of 2 or 3 optical sections 0.62 ␮m thick separated 0.57 ␮m. The densest NK1R immunostaining is found in laminae I of the dorsal horn. In both sham WA and WA stress conditions, immunoreactivity was predominant on the plasma membrane.

number of NK1R IR neurons in spinal cord samples from stressed rats compared with control was evident (18.7 ⫾ 1.7 vs 12.6 ⫾ 0.58, P ⫽ .0052, Student t test; Figure 6). Real-time quantitative RT-PCR for SP mRNA in L1–L2 spinal cord samples. We found detectable expression of preprotachykinin A (PPT-A) mRNA, the primary transcript for the synthesis of SP, in the spinal cord samples collected from the L1–L2 level (data not shown). There was no significant difference in the relative levels of PPT-A mRNA to glyceraldehyde-3-phosphate dehydrogenase, measured in samples from stressed animals compared with control (9.9 ⫾ 1.2 and 9.5 ⫾ 0.8 arbitrary units, respectively).

GASTROENTEROLOGY Vol. 130, No. 6

Expression of NK1R and SP in DRG neurons. DRG neurons showed detectable levels of NK1R mRNA expression (data not shown). Quantitative analysis of NK1R mRNA levels in the DRG did not show any significant change in the relative abundance between stressed and sham-stressed animals (8.9 ⫾ 2.8 vs 9.8 ⫾ 2.6 arbitrary units, respectively). There was detectable expression of PPT-A mRNA in the DRG collected from the L1–L2 level (data not shown). However, there was no significant difference in the relative levels of PPT-A mRNA measured in samples from stressed animals compared with controls (2.6 ⫾ 0.6 and 2.5 ⫾ 0.2 arbitrary units, respectively). Because of the lack of a difference between stress and control conditions, the proteins were not further quantified. Expression of NK1R in the distal colon. The effect of chronic WA stress on NK1R expression in fullthickness colon tissues was assessed using semiquantitative RT-PCR, Western blotting analysis, and immunohistochemistry. Semiquantitative RT-PCR for colonic NK1R. NK1R mRNA was expressed in the distal colon, and the authenticity of the PCR product was verified by sequencing analysis. We found significantly reduced expression for NK1R mRNA in samples from chronically stressed animals compared with control. A semiquantitative analysis of NK1R mRNA levels showed that WA stress resulted in a significant decrease in the relative abundance of colonic NK1R mRNA compared with sham WA stress (1.11 ⫾ 0.13 in sham WA, 0.75 ⫾ 0.08 in WA,

Figure 6. Quantification of NK1R IR neurons in the laminae I of the dorsal spinal cord from rats previously subjected to chronic WA stress or control sham WA stress. There are an increased number of NK1Rexpressing neurons in the spinal segment from stressed rats compared with control. Results are expressed as the mean number of NK1R IR-positive cells in the laminae I of one side of the dorsal horn from 5 sections/rat; mean ⫾ SEM, n ⫽ 8 rats in each group, *P ⬍ .05, significantly different from sham WA, Student t test.

May 2006

expressed as normalized arbitrary units, P ⬍ .05, Student t test; Figure 7A). NK1R protein expression in distal colon. Western blot analysis in control and WA stress groups revealed a ⬃65-kilodalton band corresponding to the NK1R protein (Figure 7C). As previously described for the spinal cord samples, the authenticity of the NK1R protein was verified by simultaneous migration of a positive control load (Santa Cruz Biotechnology, Santa Cruz, CA) at the

CHRONIC STRESS–INDUCED VISCERAL HYPERALGESIA

1737

same level. The specificity of the antibody immunostaining was confirmed by reduction of the intensity of the band in samples blotted with the antibody preadsorbed with an excess of receptor fragment used for the antibody production 393KTMTESSSFYSNMLA407. Optical density analysis of blots showed significantly less expression of the NK1R in the stress group compared with control (P ⫽ .0134, Student t test); a 31% reduction was observed in the WA group compared with control (Figure 7B). Immunohistochemical localization of NK1R in colonic samples. The distribution of NK1R in the rat colon was similar to previously reported results,16,46 with prominent localization in myenteric and submucosal neurons, muscle cells, and epithelial cells. The NK1R immunoreactivity was localized to the plasma membrane of neurons located in the myenteric plexus in samples from both control and stressed animals, with no evidence for receptor endocytosis. There was no detectable difference in the distribution and intensity of NK1R in WA and sham WA specimens. NK1R immunostaining was abolished by preadsorption of the antibody with an excess of the peptide antigen, confirming specificity of NK1R immunoreactivity (not shown).

Discussion

Figure 7. Expression of NK1Rs in the distal colon. (A) Levels of mRNA for NK1Rs measured by semiquantitative RT-PCR. A significant reduction in the level of NK1R mRNA was observed in samples from chronic WA stress rats compared with controls. Data are expressed as the amount of NK1R PCR product relative to that of 18S PCR product (arbitrary units, mean ⫾ SEM, n ⫽ 8 in each group, *P ⬍ .05, significantly different from sham WA, Student t test). (B) Levels of NK1R protein measured by Western blotting. A significant reduction in the level of NK1R proteins in samples from chronic WA stress rats compared with controls was observed. Data are expressed as normalized optical density, mean ⫾ SEM, n ⫽ 8 in each group, *P ⬍ .05, significantly different from sham WA, Student t test. (C) Representative Western blotting for NK1R in colon extracts shows a prominent band at ⬃65 kilodaltons.

The present study expands on previous observations that repeated psychological stress in male Wistar rats results in a phenotype characterized by increased autonomic responsiveness, anxiety-like behavior, and sustained visceral hyperalgesia, consistent with stress sensitization.35 Our results point to a major role for the SP/NK1R signaling system in mediating the visceral hyperalgesia component of this model, because the stress-induced exaggerated VMR to CRD was abolished by intrathecal administration of a selective NK1R antagonist and increased expression of NK1Rs was shown at the spinal cord level. The absence of peripheral upregulation of the SP/NK1R signaling system distinguishes this model from models of intestinal inflammation where peripheral up-regulation of this system has been reported.47,48 This, to our knowledge, represents the first evidence of increased expression of NK1R located on spinal neurons of the superficial dorsal horn in a model of sustained visceral hyperalgesia induced by chronic psychological stress. Pharmacologic Characterization of the Role of NK1R in Stress-Induced Visceral Hyperalgesia The selective NK1R antagonist SR140333, injected via either the intraperitoneal or intrathecal

1738

BRADESI ET AL

routes, normalized the exaggerated VMR to CRD associated with repeated WA stress. These findings, together with the lack of effect on baseline responses to CRD, support a predominant antihyperalgesic effect of the NK1R antagonist in this model and suggest a stress-induced up-regulation of the SP/NK1R signaling system either on peripheral and/or central components of visceral afferent pathways mediating visceral pain. Previous reports have shown an inhibitory effect of different NK1R antagonists on visceral hyperalgesia in several animal models of peripheral colonic sensitization. For example, Okano et al30 showed that intraduodenal administration of the NK1R antagonists TAK-637 or CP99,994 inhibit the enhanced nociceptive response to CRD in rabbits previously subjected to colonic irritation with acetic acid. In guinea pigs sensitized by intracolonic administration of acetic acid, central injection of TAK-637 abolishes visceral hyperalgesia.31 There is also evidence for a role of NK1Rs in the mediation of visceral hyperalgesia observed after psychological stressors, such as acute partial restraint stress in guinea pigs,31 partial restraint stress in rats,43 or acute WA stress in rats.29 However, despite this converging evidence for involvement of the SP/NK1R system in the expression of visceral hyperalgesia following physical or psychological stress, the sites of NK1R modulation have never been identified. The available data suggest that, depending on the nature of the sensitization paradigm, both peripheral and central sites may be involved.30,31 The NK1R antagonist SR140333 used in the present study has been characterized as a highly selective and functional antagonist for the rat NK1R,49,50 which shows poor ability to penetrate into the central nervous system under basal conditions.50 While these properties may suggest that the inhibitory effect of SR140333 injected IP might be mediated via an action on peripheral NK1Rs, several studies have shown increased blood-brain barrier permeability in rats following stressful stimulation.51,52 Our finding that intrathecal administration of SR140333 in chronically stressed rats normalized the enhanced response to CRD supports the critical contribution of spinal NK1Rs to the enhanced nociceptive response and is consistent with a recent report showing an inhibitory effect of intrathecally applied TAK-637 on visceral hyperalgesia in the guinea pig.31 However, the possibility that SR140333 injected into the spinal cord in stressed animals may have leaked into the systemic circulation, targeting peripheral receptors, cannot be excluded.

GASTROENTEROLOGY Vol. 130, No. 6

Stress-Induced Modulation of SP/NK1R Expression in the Spinal Cord and Colon We found increased NK1R mRNA and protein expression in the spinal cord in samples from stressed rats compared with controls. Comparable increased expression of NK1R in the spinal cord has been previously reported in models of peripheral inflammation, such as bladder irritation,53 or nerve injury associated with persistent pain.54 However, the mechanism(s) underlying increased spinal NK1R expression observed in association with peripheral inflammation is incompletely understood. In vitro studies in different cell types, including spinal neurons, have implicated several mediators and related intracellular signaling molecules, including the sensory neuropeptide calcitonin gene-related peptide (via activation of the adenosine 3=,5=-cyclic monophosphate responsive element),55 proinflammatory cytokines, in particular interleukin-1␤ (via activation of the nuclear factor ␬B pathway),20,54,56 or SP metabolites57 in NK1R expression. The analysis of NK1R immunostaining showed that enhanced protein expression corresponds to an increased number of neurons labeled for NK1Rs in the laminae I of the dorsal horn. In both control and stressed groups, NK1R distribution was more evident on the cell surface, without evidence for significant receptor internalization. Based on previous reports that showed the positive relationship between spinal SP release and NK1R internalization,58 the absence of endosomes labeled for NK1R in the cytoplasm argues against a significant release of spinal SP under baseline, nondistended conditions in both stressed and nonstressed animals. Thus, our data indicate that chronic stress triggers up-regulation of NK1R expression on the superficial layer of dorsal horn neurons and provides indirect evidence that this phenomenon is not related to increased SP release from central terminals of primary afferents. This hypothesis is supported by the lack of significant difference in the relative levels of PPT-A mRNA expression in DRG samples from stressed animals compared with controls, suggesting that increased neuropeptide release from sensitized primary afferents is not necessary for the expression of visceral hyperalgesia in this model. These findings contrast previous studies showing a prominent role of spinal release of SP (and glutamate) from the central terminals of primary afferent fibers in the development of spinal sensitization (also called central sensitization), associated with peripheral injury or inflammation and persistent pain.59 However, we cannot exclude the possibility of a transient spinal SP release

May 2006

from primary afferents that occurs early during the course of the 10 days of stress and thereby contributes to the development of the central sensitization process. In the gut, NK1Rs are located on epithelial cells, smooth muscle cells, myenteric neurons, interstitial cells of Cajal, and different types of inflammatory cells.46,48 Up-regulation of NK1Rs on a variety of these cell types has been characterized in clinical inflammatory conditions60 – 62 and in several forms of experimental intestinal inflammation.17,47,63 SP and its natural analogue, hemokinin, are produced at the sites of inflammation and act through the NK1R expressed on T cells, macrophages, and dendritic cells, leading to the production of mediators such as tumor necrosis factor ␣17,64 and interferon gamma65 and amplification of the Th1 response.66 Patients with ulcerative colitis and Crohn’s disease have increased NK1R expression on epithelial cells lining the mucosal surface and on endothelial cells of capillaries, venules, and colonic lymphoid aggregates.60 – 62 In rats, NK1R expression is increased in intestinal epithelial cells and in cells of the lamina propria in a model of enteritis induced by Clostridium difficile toxin A.47 It is now well established that NK1R and SP (as well as its analogue hemokinin) participate in many aspects of the neuroimmune response triggered by intestinal infection or inflammation, and increasing evidence shows that proinflammatory cytokines play a significant role in the regulation of NK1R expression.56 For example, it has previously been shown that the proinflammatory cytokine interleukin-1␤, via activation of the transcription factor nuclear factor ␬B, can stimulate NK1R expression in human THP-1 monocytes.56 Moreover, we have shown that the model of chronic WA stress is associated with signs of mucosal immune activation in the colon characterized by an increased number of mucosal mast cells and increased expression of mRNA for the cytokines interleukin-1␤ and interferon gamma.35 Based on these data, together with the report by Soderholm et al67 that a similar chronic stress paradigm in rats induces changes in gut permeability and signs of mucosal immune activation, one might expect an up-regulation of the SP/NK1 system in the colon of chronically stressed animals. However, our semiquantitative RT-PCR and Western blot analyses showed decreased NK1R expression at the mRNA and protein levels in stressed rats compared with control. Consistent with prior reports,46 we found prominent localization of NK1R immunostaining in myenteric and submucosal neurons, muscle cells, and epithelial cells of the rat colon but no difference in the

CHRONIC STRESS–INDUCED VISCERAL HYPERALGESIA

1739

pattern of distribution in NK1R-positive cells between stressed and control rats. The mechanism(s) underlying the observed down-regulation of NK1Rs in the colon is unclear but may be related to other aspects of general stress sensitization in this model. For example, Ihara et al suggested that, in pancreatic acinar cells, altered outputs of the autonomic nervous system or the hypothalamic-pituitary-adrenal axis are likely to modulate gut immune function, thereby regulating NK1R expression via glucocorticoids.68

Summary and Conclusions The findings from the present study show an up-regulation of NK1R on spinal neurons in a model of chronic WA stress associated with sustained visceral hyperalgesia. The pharmacologic efficacy of a spinal treatment with an NK1R antagonist to abolish the enhanced visceral response in this model suggests an important contribution of the spinal NK1R-expressing neurons in visceral hyperalgesia. The lack of enhanced SP gene expression in DRG or enhanced SP spinal release suggests that increased expression of NK1R and the maintenance of sustained visceral hyperalgesia is not dependent on ongoing input from sensitized peripheral primary afferents. When viewed together with our previous report35 indicating mild colonic immune activation after chronic WA stress exposure, our findings indicate that these subtle mucosal changes are not sufficient to stimulate increased expression of SP (and presumably calcitonin gene-related peptide) and their respective receptors in the periphery. Our results address the role of the SP/NK1R signaling system in the maintenance of sustained stress-induced visceral hyperalgesia. We cannot rule out that an earlier, transient peak of stress-induced immune activation during the 10-day WA stress paradigm occurs and that this peak is essential for initiating a long-lasting increased expression of the NK1R on dorsal horn cells. However, once established, the maintenance of the increased expression of spinal NK1R, and thus of the visceral hyperalgesia, may be driven primarily by descending input to the dorsal horn from the brainstem.25,26 For example, a spinal-bulbo-spinal loop has been proposed in rats following peripheral tissue irritation by which increased NK1Rs expressed on superficial dorsal horn neurons drive ascending projections to pontine serotonergic regions, which in turn send descending projections to the spinal cord.25 These serotonergic projections mediate a facilitatory effect on neurons in superficial and deeper layers of the dorsal horn, which is mediated by a 5-HT3 recep-

1740

BRADESI ET AL

tor.69 Future studies are needed to address these hypotheses.

References 1. Mayer EA, Craske M, Naliboff BD. Depression, anxiety, and the gastrointestinal system. J Clin Psychiatry 2001;62:28 –36. 2. Valentino RJ, Miselis RR, Pavcovich LA. Pontine regulation of pelvic viscera: pharmacological target for pelvic visceral dysfunctions. Trends Pharmacol Sci 1999;20:253–260. 3. Taché Y, Martinez V, Million M, Wang L. Stress and the gastrointestinal tract III. Stress-related alterations of gut motor function: role of brain corticotropin-releasing factor receptors. Am J Physiol Gastrointest Liver Physiol 2001;280:G173–G177. 4. Taché Y, Martinez V, Wang L, Million M. CRF1 receptor signaling pathways are involved in stress-related alterations of colonic function and viscerosensitivity: implications for irritable bowel syndrome. Br J Pharmacol 2004;141:1321–1330. 5. Camilleri M. Treating irritable bowel syndrome: overview, perspective and future therapies. Br J Pharmacol 2004;141:1237–1248. 6. Takayama H, Ota Z, Ogawa N. Effect of immobilization stress on neuropeptides and their receptors in rat central nervous system. Regul Pept 1986;15:239 –248. 7. Siegel RA, Duker EM, Pahnke U, Wuttke W. Stress-induced changes in cholecystokinin and substance P concentrations in discrete regions of the rat hypothalamus. Neuroendocrinology 1987;46:75– 81. 8. Brodin E, Rosen A, Schott E, Brodin K. Effects of sequential removal of rats from a group cage, and of individual housing of rats, on substance P, cholecystokinin and somatostatin levels in the periaqueductal grey and limbic regions. Neuropeptides 1994; 26:253–260. 9. Geracioti TD, Carpenter L, Owens MJ, Baker D, Ekhator NN, Horn PS, Strawn JR, Samacora G, Kinkead BK, Price LH, Nemeroff CB. Elevated cerebrospinal fluid substance P concentration in posttraumatic stress disorder and major depression. Am J Psychiatry (in press). 10. Russell IJ, Orr MD, Littman B, Vipraio GA, Alboukrek D, Michalek JE, Lopez Y, MacKillip F. Elevated cerebrospinal fluid levels of substance P in patients with the fibromyalgia syndrome. Arthritis Rheum 1994;37:1593–1601. 11. Vaeroy H, Sakurada T, Forre O, Kass E, Terenius L. Modulation of pain in fibromyalgia (fibrositis syndrome): cerebrospinal fluid (CSF) investigation of pain related neuropeptides with special reference to calcitonin gene related peptide (CGRP). J Rheumatol Suppl 1989;19:94 –97. 12. FitzGerald LZ, Chang L, Lee CK, Owens MJ, Mayer M, Naliboff BD, Nemeroff CB, Mayer EA. Elevated levels of central stress mediators in irritable bowel syndrome (abstr). Gastroenterology 2003; 124:A-252. 13. Castro AR, Pinto M, Lima D, Tavares I. Nociceptive spinal neurons expressing NK1 and GABAB receptors are located in lamina I. Brain Res 2004;1003:77– 85. 14. Honore P, Kamp EH, Rogers SD, Gebhart GF, Mantyh PW. Activation of lamina I spinal cord neurons that express the substance P receptor in visceral nociception and hyperalgesia. J Pain 2002; 3:3–11. 15. Sergeyev V, Fetissov S, Mathe AA, Jimenez PA, Bartfai T, Mortas P, Gaudet L, Moreau JL, Hokfelt T. Neuropeptide expression in rats exposed to chronic mild stresses. Psychopharmacology (Berl) 2005;178:115–124. 16. Grady EF, Baluk P, Bohm S, Gamp PD, Wong H, Portbury AL, Payan DG, Ansel J, Furness J, McDonald DM, Bunnett NW. Characterization of antisera specific NK1, NK2, and NK3 neurokinin receptors and their utilization to localize receptors in the rat gastrointestinal tract. J Neurosci 1996;16:6975– 6986.

GASTROENTEROLOGY Vol. 130, No. 6

17. Castagliuolo I, Keates AC, Qiu B, Kelly CP, Nikulasson S, Leeman SE, Pothoulakis C. Increased substance P responses in dorsal root ganglia and intestinal macrophages during Clostridium difficile toxin A enteritis in rats. Proc Natl Acad Sci U S A 1997;94: 4788 – 4793. 18. Mantyh CR, Pappas TN, Lapp JA, Washington MK, Neville LM, Ghilardi JR, Rogers SD, Mantyh PW, Vigna SR. Substance P activation of enteric neurons in response to intraluminal Clostridium difficile toxin A in the rat ileum. Gastroenterology 1996;111: 1272–1280. 19. Wershil BK, Castagliuolo I, Pothoulakis C. Direct evidence of mast cell involvement in Clostridium difficile toxin A-induced enteritis in mice. Gastroenterology 1998;114:956 –964. 20. Weinstock JV, Blum A, Metwali A, Elliott D, Arsenescu R. IL-18 and IL-12 signal through the NF-kappa B pathway to induce NK-1R expression on T cells. J Immunol 2003;170:5003–5007. 21. Duggan AW, Hendry IA, Morton CR, Hutchison WD, Zhao ZQ. Cutaneous stimuli releasing immunoreactive substance P in the dorsal horn of the cat. Brain Res 1988;451:261–273. 22. Mantyh PW. Neurobiology of substance P and the NK1 receptor. J Clin Psychiatry 2002;63:6 –10. 23. Mantyh PW, Rogers SD, Honore P, Allen BJ, Ghilardi JR, Li J, Daughters RS, Lappi DA, Wiley RG, Simone DA. Inhibition of hyperalgesia by ablation of lamina I spinal neurons expressing the substance P receptor. Science 1997;278:275–279. 24. Nichols ML, Allen BJ, Rogers SD, Ghilardi JR, Honore P, Luger NM, Finke MP, Li J, Lappi DA, Simone DA, Mantyh PW. Transmission of chronic nociception by spinal neurons expressing the substance P receptor. Science 1999;286:1558 –1561. 25. Satoh M, Kuraishi Y, Kawamura M. Effects of intrathecal antibodies to substance P, calcitonin gene-related peptide and galanin on repeated cold stress-induced hyperalgesia: comparison with carrageenan-induced hyperalgesia. Pain 1992;49:273–278. 26. Okano K, Kuraishi Y, Satoh M. Effects of intrathecally injected glutamate and substance P antagonists on repeated cold stressinduced hyperalgesia in rats. Biol Pharm Bull 1995;18:42– 44. 27. Mantyh PW, Hunt SP. Setting the tone: superficial dorsal horn projection neurons regulate pain sensitivity. Trends Neurosci 2004;27:582–584. 28. Suzuki R, Morcuende S, Webber M, Hunt SP, Dickenson AH. Superficial NK1-expressing neurons control spinal excitability through activation of descending pathways. Nat Neurosci 2002; 5:1319 –1326. 29. Schwetz I, Bradesi S, McRoberts JA, Sablad M, Miller JC, Zhou H, Ohning G, Mayer EA. Delayed stress-induced colonic hypersensitivity in male Wistar rats: role of neurokinin-1 and corticotropinreleasing factor-1 receptors. Am J Physiol Gastrointest Liver Physiol 2004;286:683– 691. 30. Okano S, Ikeura Y, Inatomi N. Effects of tachykinin NK1 receptor antagonists on the viscerosensory response caused by colorectal distention in rabbits. J Pharmacol Exp Ther 2002;300:925– 931. 31. Greenwood-Van Meerveld B, Gibson MS, Johnson AC, Venkova K, Sutkowski-Markmann D. NK1 receptor-mediated mechanisms regulate colonic hypersensitivity in the guinea pig. Pharmacol Biochem Behav 2003;74:1005–1013. 32. Laird JM, Olivar T, Roza C, De Felipe C, Hunt SP, Cervero F. Deficits in visceral pain and hyperalgesia of mice with a disruption of the tachykinin NK1 receptor gene. Neuroscience 2000; 98:345–352. 33. Abbadie C, Trafton J, Liu, H, Mantyh, PW, Basbaum AI. Inflammation increases the distribution of dorsal horn neurons that internalize the neurokinin-1 receptor in response to noxious and non-noxious stimulation. J Neurosci 1997;17:8049 – 8060. 34. Honore P, Menning PM, Rogers SD, Nichols ML, Basbaum AI, Besson JM, Mantyh PW. Spinal cord substance P receptor ex-

May 2006

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

pression and internalization in acute, short-term, and long-term inflammatory pain states. J Neurosci 1999;19:7670 –7678. Bradesi S, Schwetz I, Ennes HS, Lamy CM, Ohning G, Fanselow M, Pothoulakis C, McRoberts JA, Mayer EA. Repeated exposure to water avoidance stress in rats: a new model for sustained visceral hyperalgesia. Am J Physiol Gastrointest Liver Physiol 2005;289:G42–G53. Ness TJ, Gebhart GF. Colorectal distension as a noxious visceral stimulus: physiological and pharmacological characterization of pseudoaffective reflexes in the rat. Brain Res 1988;450:153– 169. Million M, Taché Y, Anton P. Susceptibility of Lewis and Fisher rats to stress-induced worsening of TNB-colitis: protective role of brain CRF. Am J Physiol Gastrointest Liver Physiol 1999;276: G1027–G1036. Mantyh PW, DeMaster E, Malhotra A, Ghilardi JR, Rogers SD, Mantyh CR, Liu H, Basbaum AI, Vigna SR, Maggio JE. Receptor endocytosis and dendrite reshaping in spinal neurons after somatosensory stimulation. Science 1995;268:1629 –1632. Schwei MJ, Honore P, Rogers SD, Salak-Johnson JL, Finke MP, Ramnaraine ML, Clohisy DR, Mantyh PW. Neurochemical and cellular reorganization of the spinal cord in a murine model of bone cancer pain. J Neurosci 1999;19:10886 –10897. Trafton JA, Abbadie C, Basbaum AI. Differential contribution of substance P and neurokinin A to spinal cord neurokinin-1 receptor signaling in the rat. J Neurosci 2001;21:3656 –3664. Marvizon JC, Martinez V, Grady EF, Bunnett NW, Mayer EA. Neurokinin 1 receptor internalization in spinal cord slices induced by dorsal root stimulation is mediated by NMDA receptors. J Neurosci 1997;17:8129 – 8136. Marvizon JC, Grady EF, Wazsak-McGee J, Mayer EA. Internalization of mu opioid receptors in rat spinal cord slices. Neuroreport 1999;10:2329 –2334. Bradesi S, Eutamene H, Garcia-Villar R, Fioramonti J, Bueno L. Stress-induced visceral hypersensitivity in female rats is estrogen-dependent and involves tachykinin NK1 receptors. Pain 2003;102:227–234. Powell KJ, Quirion R, Jhamandas K. Inhibition of neurokinin-1substance P receptor and prostanoid activity prevents and reverses the development of morphine tolerance in vivo and the morphine-induced increase in CGRP expression in cultured dorsal root ganglion neurons. Eur J Neurosci 2003;18:1572– 1583. Traub RJ. Evidence for thoracolumbar spinal cord processing of inflammatory, but not acute colonic pain. Neuroreport 2000;11: 2113–2116. Sternini C, Su D, Gamp PD, Bunnett NW. Cellular sites of expression of the neurokinin-1 receptor in the rat gastrointestinal tract. J Comp Neurol 1995;358:531–540. Pothoulakis C, Castagliuolo I, Leeman SE, Wang CC, Li H, Hoffman BJ, Mezey E. Substance P receptor expression in intestinal epithelium in clostridium difficile toxin A enteritis in rats. Am J Physiol Gastrointest Liver Physiol 1998;275:G68 –G75. Weinstock JV. The role of substance P, hemokinin and their receptor in governing mucosal inflammation and granulomatous responses. Front Biosci 2004;9:1936 –1943. Emonds-Alt X, Doutremepuich JD, Heaulme M, Neliat G, Santucci V, Steinberg R, Vilain P, Bichon D, Ducoux JP, Proietto V, Van Broeck D, Soubrié P, Le Fur G, Brelière JC. In vitro and in vivo biological activities of SR140333, a novel potent non-peptide tachykinin NK1 receptor antagonist. Eur J Pharmacol 1993;250: 403– 413. Rupniak NM, Carlson EJ, Shepheard S, Bentley G, Williams AR, Hill A, Swain C, Mills SG, Di Salvo J, Kilburn R, Cascieri MA, Kurtz MM, Tsao KL, Gould SL, Chicchi GG. Comparison of the functional blockade of rat substance P (NK1) receptors by

CHRONIC STRESS–INDUCED VISCERAL HYPERALGESIA

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

1741

GR205171, RP67580, SR140333, and NKP-608. Neuropharmacology 2003;45:231–241. Sharma HS, Cervos-Navarro J, Dey PK. Increased blood-brain barrier permeability following acute short-term swimming exercise in conscious normotensive young rats. Neurosci Res 1991; 10:211–221. Kandere-Grzybowska K, Gheorghe D, Priller J, Esposito P, Huang M, Gerard N, Theoharides TC. Stress-induced dura vascular permeability does not develop in mast cell-deficient and neurokinin-1 receptor knockout mice. Brain Res 2003;980:213–220. Ishigooka M, Zermann DH, Doggweiler R, Schmidt RA, Hashimoto T, Nakada T. Spinal NK1 receptor is upregulated after chronic bladder irritation. Pain 2001;93:43–50. Abbadie C, Brown JL, Mantyh PW, Basbaum AI. Spinal cord substance P receptor immunoreactivity increases in both inflammatory and nerve injury models of persistent pain. Neuroscience 1996;70:201–209. Abrahams LG, Reutter MA, McCarson KE, Seybold VS. Cyclic AMP regulates the expression of neurokinin1 receptors by neonatal rat spinal neurons in culture. J Neurochem 1999;73:50 –58. Simeonidis S, Castagliuolo I, Pan A, Liu J, Wang CC, Mykoniatis A, Pasha A, Valenick L, Sougioultzis S, Zhao D, Pothoulakis C. Regulation of the NK-1 receptor gene expression in human macrophage cells via an NF-␬ B site on its promoter. Proc Natl Acad Sci U S A 2003;100:2957–2962. Velazquez RA, McCarson KE, Cai Y, Kovacs KJ, Shi Q, Evensjo M, Larson AA. Upregulation of neurokinin-1 receptor expression in rat spinal cord by an N-terminal metabolite of substance P. Eur J Neurosci 2002;16:229 –241. Marvizon JC, Wang X, Matsuka Y, Neubert JK, Spigelman I. Relationship between capsaicin-evoked substance P release and neurokinin 1 receptor internalization in the rat spinal cord. Neuroscience 2003;118:535–545. Urban MO, Gebhart GF. The glutamate synapse: a target in the pharmacological management of hyperalgesic pain states. Prog Brain Res 1998;116:407– 420. Mantyh CR, Gates TS, Zimmerman ML, Welton ML, Passaro EPJ, Vigna SR, Maggio JE, Kruger L, Mantyh PW. Receptor binding sites for substance P, but not substance K or neuromedin K, are expressed in high concentrations by arterioles, venules and lymph nodules in surgical specimens obtained from patients with ulcerative colitis and Crohn’s disease. Proc Natl Acad Sci U S A 1988;85:3235–3239. Mantyh PW, Catton M, Maggio JE, Vigna SR. Alterations in receptors for sensory neuropeptides in human inflammatory bowel disease. Adv Exp Med Biol 1991;298:253–258. Renzi D, Pellegrini B, Tonelli F, Surrenti C, Calabro A. Substance P (neurokinin-1) and neurokinin A (neurokinin-2) receptor gene and protein expression in the healthy and inflamed human intestine. Am J Pathol 2000;157:1511–1522. Mantyh CR, Maggio JE, Mantyh PW, Vigna SR, Pappas TN. Increased substance P receptor expression by blood vessels and lymphoid aggregates in Clostridium difficile-induced pseudomembranous colitis. Dig Dis Sci 1996;41:614 – 620. Delgado AV, McManus AT, Chambers JP. Production of tumor necrosis factor-alpha, interleukin 1-beta, interleukin 2, and interleukin 6 by rat leukocyte subpopulations after exposure to substance P. Neuropeptides 2003;37:355–361. Blum AM, Metwali A, Elliott DE, Weinstock JV. T cell substance P receptor governs antigen-elicited IFN-gamma production. Am J Physiol Gastrointest Liver Physiol 2003;284:G197– G204. Weinstock JV, Blum A, Metwali A, Elliott D, Bunnett N, Arsenescu R. Substance P regulates Th1-type colitis in IL-10 knockout mice. J Immunol 2003;171:3762–3767. Soderholm JD, Yang PC, Ceponis P, Vohra A, Riddell R, Sherman PM, Perdue MH. Chronic stress induces mast cell-dependent

1742

BRADESI ET AL

bacterial adherence and initiates mucosal inflammation in rat intestine. Gastroenterology 2002;123:1099 –1108. 68. Ihara H, Nakanishi S. Selective inhibition of expression of the substance P receptor mRNA in pancreatic acinar AR42J cells by glucocorticoids. J Biol Chem 1990;265:22441–22445. 69. Suzuki R, Rygh LJ, Dickenson AH. Bad news from the brain: descending 5-HT pathways that control spinal pain processing. Trends Pharmacol Sci 2004;25:613– 617.

Received June 21, 2005. Accepted January 11, 2006. Address requests for reprints to: Emeran A. Mayer, MD, Center for Neurovisceral Sciences and Women’s Health, CURE Building

GASTROENTEROLOGY Vol. 130, No. 6

115, Room 223, VAGLAHS, 11301 Wilshire Boulevard, Los Angeles, California 90073. e-mail: [email protected]; fax: (310) 794-2864. Supported by National Institutes of Health grants P50 DK64539 (to E.A.M.), R24 AT00281 (to E.A.M.), DK47343 (to C.P.), DK41301 Morphology and Imaging Core (to C.S.) and Antibody Core (to G.O.), R01 DK57037 (to C.S.), and DK54155 (to C.S.); a Fellowship Award from the Crohn’s and Colitis Foundation (to S.S.); GlaxoSmithKline (Neurology and GI Centre of Excellence for Drug Discovery, Harlow, England); and R21 DK071767-01 (to S.B.). Presented in part at the 2005 annual meeting of the American Gastroenterological Association in abstract form (Gastroenterology 2005;128:A-494).