The role of palindromic and non-palindromic sequences in arresting DNA synthesis in vitro and in Vivo

.I. Mol. t2iol.

(1984) 180, 961-986

The Role of Palindromic and Non-palindromic Sequences in Arresting DNA Synthesis in Vitro and in Vivo DAVID T. WEAVER? AND MELVIN

L. DEPAMPHILIS

Department of Biological Chemistry Harvard Medical School Boston, MA 02115, U.S.A. (Received

29 March

1984, and in revised form

15 August

1984)

The nature of specific DNA sequences that arrest synthesis by mammalian DNA polymerase 6: in vitro was analyzed using circular, single-stranded Ml3 or 4x1’74 virion DNA templates annealed to a unique, terminally labeled, DNA primer. This method rigorously defined both the starting nucleotide position and the direction of synthesis, as well as making the amount of radioactivity proportional t,o the number rather than the length of nascent DNA chains. The precise nucleotide locations of arrest sites were determined over templates with complementary sequences by cloning unique DNA restriction fragments into Ml3 DNA and isolating virions containing either the Watson or Crick strand. Results were correlated with the locations of palindromic (self-complementary) sequences, repeated sequences, and repeated sequences with mirror-image orientation. Two classes of DNA synthesis arrest sites were identified, distinct in structure but equivalent in activity. Class I sites consisted of palindromic sequences that formed a stable hairpin structure in solution and arrested DNA polymerase on bot,h complementary templates. The polymerase stopped precisely at the base of the duplex DNA stem, regardless of the direction from which the enzyme approached. Class II sites consisted of non-palindromic sequences that could not be explained by either secondary structure or sequence symmetry elements, and whose complementary sequence was not an arrest site. Size limits, orientation and some sequence specificity for arrest sites were suggested by the data. Arrest sites were also observed in viva by mapping the locations of 3’-end-labeled nascent simian virus 40 DNA strands throughout the genome. Arrest sites closest to the region where termination of replication occurs were most pronounced, and the locations of 80% of the most prominent sites appeared to be recognized by cr-polymerase on the same template in vitro. However, class I sites were not identified in viao, suggesting that palindromic sequences do not, form hairpin structures at replication forks.

1. Introduction In vitro synthesis by DNA DePamphilis, 1982; Kaguni

polymerase & Clayton,

a (DePamphilis et al., 1980; Weaver & 1982) as well as other DNA polymerases

t Present address: Department hlA 02139. CT.S.A.

of Biology, Massachusetts Institute

of Technology. Boston.

961 0022-2836/84/360961-26 $03.00/O

0 1984 Academic Press Inc. (London) Ltd.

962

D. T. WEAVER

AND

M. L. DEPAMPHILIS

(Sherman & Gefter, 1976; Challberg & Englund, 1979; Huang et al., 1981; Weaver & DePamphilis, 1982; Kaguni & Clayton, 1982) is arrested at specific sequences in the single-stranded DNA template. A general correspondence has been observed between the positions of arrest sites and the positions of palindromic sequences. suggesting that the formation of stable “hairpins” in front of the enzyme is the major reason for polymerase pausing during DNA synthesis in vitro. A similar relationship has been proposed for RNA polymerases except that the enzyme pauses after a hairpin has formed in the RNA product (Mills et al., 1978; Platt, 1981; Kassavetis & Chamberlin, 1981; Hay & Aloni, 1984). However, further analysis of nucleotide sequences at DNA synthesis arrest sites observed by cc-polymerase (Weaver & DePamphilis, 1982; Kaguni & Clayton, 1982), Escherichia coli DNA polymerase III (LaDuca et al., 1983) and phage T4 DNA polymerase (Fairfield et al., 1983) has suggested that only a fraction of the sites are closely correlated with palindromic sequences in the template. The possibility that the remaining arrest sites represent secondary structures formed by interaction of sequences widely separated in the template was eliminated by cloning a 164 base 4x174 template region into Ml3 DNA and demonstrating that the arrest sites in this region were unchanged (Weaver & DePamphilis, 1982). Therefore, at least two types of DNA synthesis arrest sites were postulated: stable hairpin structures and specific primary sequences. In this paper, unique DNA primer-templates were constructed that allowed analysis of DNA synthesis in vitro over complementary DNA sequences. Symmetry elements in the sequence could then be observed by DNA polymerase from both directions. At least two classes of arrest sites were distinguished. Palindromic sequences (i.e. self-complementary sequences) that formed hairpin structures in solution (“class I”) arrested a-polymerase precisely at the base of the stem, regardless of which direction the enzyme approached. Specific nonpalindromic sequences (“class 11”) had no simple correlation with specific sequence symmetries and appeared in only one of two complementary template strands. Although DNA synthesis arrest sites are readily demonstrated with purified DNA templates and enzymes in vitro, their existence in vivo and their biological significance remains unclear. Perhaps some DNA synthesis arrest sites are utilized by the cell to attenuate DNA replication similar to the selection of some RNA synthesis arrest sites to terminate transcription (Platt, 1981; Kassavetis & Chamberlin, 1981). For example, simian virus 40 (SV40) replicating DNA pauses late in replication when about 91% of its synthesis is completed (DePamphilis & Wassarman, 1982), and mitochondrial replicating DNA pauses after the first 520 to 690 nucleotides of the H-strand have been synthesized, resulting in “D-loop” structures (Clayton, 1982). In each case, the 3’-ends of nascent DNA strands accumulated at specific sites in the DNA template (Tapper & DePamphilis, 1980; Doda et al., 1981). Replication forks in polyoma DNA accumulate at several discrete sites distributed throughout’ the genome (Buckler-White & Pigiet, 1982). Of the five sites at which mouse mitochondrial replication pauses, three correspond to sites that arrest purified Drosophila a-polymerase in vitro (Kaguni & Clayton, 1982). This correlation may appear tenuous since mitochondrial DNA

DNA SYNTHESIS

ARREST

SITES

963

synthesis is normally carried out by DNA y-polymerase (Clayton, 1982), but comparisons of purified replicative enzymes such as a-polymerases, phage T4 DNA polymerase, and E. coli DNA polymerase III reveal similar patterns of arrest sites (Weaver & DePamphilis, 1982; Kaguni & Clayton, 1982). Neither stimulate DNA synthesis by protein cofactors, CIC,, that specifically a-polymerase on extensively single-stranded templates (Pritchard et al., 1983), nor phage T4 proteins 32, 44162 and 45 that specifically stimulate T4 DNA polymerase (M. Charette, D. Weaver & M. DePamphilis, unpublished results) alter either the number or intensity of arrest sites. Therefore, it is possible that the complete DNA replication complex operating on native replicating chromosomes i,n Go also responds to DNA synthesis arrest signals in the template. To further explore this hypothesis, the locations of 3’-ends of nascent SV40 DNA strands synthesized in wivo were mapped over the same SV40 DNA t,emplate regions examined in vitro for their ability to arrest CV-1 cell cr-polymerase. CV-1 cells are the host for SV40 replication, and the evidence is compelling that DNA polymerase c1 is the enzyme responsible for all DNA synthesis at SV40 replication forks (DePamphilis & Wassarman, 1982). Nascent TINA strands were found to accumulate at specific DNA sites throughout the genome in a pattern similar to arrest sites observed in vitro. Near the termination region where the in viuo arrest’ sites were most’ pronounced, seven of the nine sites observed in ciao corresponded closely to class II arrest sites in vitro. Remarkably. t’wo strong class T sites that arrested a-polymerase in vitro did not generate a similar response in viao, suggesting that hairpin structures are not generated at, replication forks inside the cell.

2. Materials and Methods (a) DNA polymerases

DNA polymerase c( was isolated from CV-1 cells (Weaver & DePamphilis, 1982). AMV reverse transcriptase was purchased from Dr Joseph Beard (National Cancer Institute). Purified phage T7 DNA polymerase was a gift from Stanley Tabor and Dr Charles Richardson (Harvard Medical School). The Klenow fragment of DNA polymerase I of E. co& was purchased from New England Biolabs. (b) Recombinant DNA viruses M13mp7SV40 recombinants mSVO1 and mSV02 each contain one of the two complementary strands of the 311 bpt BstNI fragment (map position 5095 to 162) that spans t,he origin of SV40 DNA replication (Hay & DePamphilis, 1982). mSV07 and mSV08 contain opposite orientations of a 262 bp SV40 AccI-PstI restriction fragment that spans the EcoRI site (map position 1630 to 1892; Hay et al., 1984). mSVO9 and mSVl0 contain opposite orientations of a 258 bp SV40 KpnI-AoaI restriction fragment that spans the MspI site (map position 298 to 588; Hay et al., 1984). mSVl1 was prepared essentially as described for m&X03 (see section (c), below) and contains the 751 bp EcoRI-BamHI fragment from SV40 (map position 1783 to 2533) cloned into M13mp9. The cloned insert has the same orientation as mSV07 and mSVO9. M13mp5-parvovirus HI recombinants RsabSCl and RsabSC2 contain opposite orientations of a 158 bp RsaI restriction fragment (map positions 4868 to 5026; Rhode & Klaassen, 1982). m$XOl contains a 194 bp HaeIII t .Abbreriation used: bp. base-pair(s).

964

D. T. WEAVER

AND M. L. DEPAMPHILIS

fragment from 4X174 (map position 979 to 1173) cloned into M13mp7 (Weaver & DePamphilis, 1982). Ml3 single-stranded virion DNA and intracellular replicative form DNA (RFI) was prepared as described (Hay & DePamphilis, 1982; Maniatis et al., 1982). (c) Preparation

of mf$X03

A recombinant M13-4X174 DNA containing a palindromic sequence at one end of the +X174 DNA insert was prepared essentially as described by Weaver & DePamphilis (1982). M13mp7 RF1 DNA was linearized with AccI (New England Biolabs), digested with bacterial alkaline phosphatase (Bethesda Research Labs) to prevent recircularization during ligation, and joined with the 219 bp HpaII restriction fragment from 4x174 (map position 2802 to 3022). Recombinant virus was isolated and screened for the virion strand of the HpaII fragment by dot-blot hybridization using a 32P-labeled probe (Kafatos et al., 1979) prepared as follows. The 348 bp HpaII fragment, which is adjacent to the 219 bp HpaII fragment on the 4X174 genome, was hybridized to a 20-fold excess of 4X174 virion DNA at 65°C for 2 h in 10 mM-Tris . HCl (pH 7.8), 200 mM-NaCl. 1 mM-EDTA. This DNA primer was then extended by 1.4 units/20 pg of E. coli DNA polymerase I (Klenow fragment) at 37°C for 90 min in the presence of 1 gm-[a-32P]dATP (3000 Ci/mmol; New England Nuclear) and 50 PM each of dGTP, dTTP and dCTP in the hybridization buffer. Verification was provided by digesting m4X03 RF1 with appropriate restriction endonucleases as described by Maniatis et al. (1982). The orientation and base sequence of the cloned DNA was confirmed using the dideoxynucleotide DNA sequencing method of Sanger et aZ. (1978) and the Ml3 pentadecamer primer (New England Biolabs). (d) Preparation

of primer-templates

DNA restriction fragments, radiolabeled only at one of their 3’ or 5’.termini, were prepared according to the method of Weaver & DePamphilis (1982). These fragments were then hybridized to purified single-stranded. virion Ml3 recombinant DNA to provide initiation sites for DNA polymerase that were unique in terms of location and orientation on the template. mSV02 RF1 DNA was cut at either its single Hind111 or NcoI site. located within the SV40 DNA insert, and treated with AMV reverse transcriptase in the presence of [a-32P]dATP to label their recessed 3’-ends by addition of a single nucleotide. The Hind111 [3’-32P]DNA linear molecule was then digested with Hi& to liberate a 36 bp fragment that was radiolabeled only at the 3’.end produced by Hind111 (“Hind111 primer”, Fig. I). Similarly, the NcoI [3’-32P]DNA was digested with BgZI to generate a 38 bp primer radiolabeled only at the 3’ end produced by NcoI (“NcoI-38 primer, Fig. l), or with SphI to generate an analogous 87 bp primer (“NcoI-87 primer”, Fig. 1). A 5’-labeled DNA primer was prepared by cutting mSV02 RF1 DNA with BarnHI, changing the 5’-terminal phosphates on the duplex DNA to 32P (Hay & DePamphilis, 1982), and then digesting with sph1 to yield a 38 bp (5’-32P)-labeled restriction fragment (“A’piI primer”, Fig. 1). SV40(1) DNA was cut at its single EcoRI site and the resulting Y’-ends extended with two molecules of [a-32P]dATP in the presence of AMV reverse transcriptase. The [3’-32P]DNA was then digested with PvuII to liberate a 64 bp fragment radiolabeled only at the 3’-end generated by EcoRI (“EcoRI primer”). The SV40 EcoRI-cut linear DNA molecules were also radiolabeled at their 5’-ends and then digested wit,h PstI, liberating a 211 bp fragment uniquely labeled at the 5’-terminus generated by EcoRI (“P&I primer”. Fig. 1). SV40(1) DNA was cut at its single MdpI site, radiolabeled at its 3’-ends with one molecule of [32P]dCTP, and then digested with KpnI to release a 48 bp fragment uniquely labeled only at the end generated by MspI (“MsppI primer”, Fig. 1). Restriction fragments were electroeluted from preparative gels in the presence of 20 pg transfer RNA carrier (Hay & DePamphilis, 1982). Optimal recovery of radiolabeled DNA was obtained in 10 min at 400 V using Spectrapor dialysis membrane: longer times resulted in loss of single-stranded DNA in the membrane. DNA restriction fragments, in the presence of a B-fold excess of the appropriate singlestranded DNA template (mSV virion DNA), were then denatured in 10 m&r-Tris . HCl

DNA SYNTHESIS

ARREST

SITES

!Ni5

(pH 7.X), 1 mM-EDTA at, 100°C for 3 min, adjusted to 250 mM-NaCl. and renatured at 65°C‘ for at least 2 h in order to form a primer-template. Since only one strand of the primer restriction fragment was labeled, non-specific hybridizat’ion of the complementary strand would not interfere with the analysis of DNA synthesis. Ml3 synthetic 15 base oligodeoxyribonucleotide (“Ml3 primer”; 5 pmol; New England I
on unique pri*mcr-kmplatus

in vitro

C.&s of I)NA polymerase activity were defined as 1 nmol dNMP incorporated in 20 min at 37”(’ using DNase I activated DNA as the substrate (Pritchard & DePamphilis, 1983). (about’ I)NA polymerase was incubated with a particular 32P-labeled primer-template 4 /cg/ml) for 15 min at 37°C in 50 mM-Tris HCl (pH %O), 10 to 30 mM-KCl. 6 mmMgCl,. 50 pp gelatin/ml, 50 PM of each dNTP, and 1 mM-2-mercaptoethanol in a 25 ~1 reaction volumr. DNA pofymerase dilutions were prepared fresh for rach assay in 504, (r/r) , t’Ions were stopped by addition glycerol. 50 pg gelatin/ml, 50 mm-Tris . HCI (pH 8.0). R eat ot 2 ~1 0.3 M-IWTA. and then incubated with 100 pg proteinase K/ml for 30 min at 37”(‘. I)Nr\ was purified by extracting the samples with an equal volume of phenol saturated with 100 tnM-Tris HCl (pH S), then twice with an equal volume of chloroform/isoamyl alcohol (24 : 1, XT/V).DNA was precipitated by adjusting the sample to 20, sodium acetate. aclding 5 pg tRNA (carrier) and 2 vol. absolute ethanol, and incubating at - 70°C’ for 10 min. Precipitates were recovered by sedimentation in a Beckman Microfuge 12 for 10 min and resuspended in 4 pl 98% (v/v) formamide, 0.27, (w/v) bromphenol blue. 0.2”, (w/v) xylenr cylanol FF. 10 mM-EDTA in preparation for gel elect’rophoresis.

(f) Purijkation

of SV40(RI)

D&VA

SV40 wt800 (Hay it al., 1984), d1884 (Shenk et al., 1976), and inSV-MH (D. Weaver. S. Fields-Berry h MM. DePamphilis, unpublished resu1t.s) were propagated in t,he CV-1 ;2frican Green monkey kidney cell line (Anderson et al., 1977). and SV40 replicating intermediate (RI) DSA was purified according to Hay h Del’amphilis (1982) at 36 h I)ost-infwtion.

(g) h’nd-labeling of S V40( RI)

DLV-4 strands

(i) ori region.

The 3’-end of each DNA chain in purified SV40(RI) DNA (4 pg) were radiolabeled with one molecule of (32P]ATP by denaturing the DNA for 3 min at, lOO”C, quickly cooling it in and then incubating it with 3’-[c(-32P]dATP (cordycepin triphosphate. &-water. 1700 Ci/mmol; New England Nuclear) using calf thymus terminal transferase (Bethesda Research Labs) according to the method of Tu & Cohen (1980). (ii) MspI region SV4O(RI) radiolabeled DePamphilis

DNA (4 pg) was digested with MxpI, and its 5’-extended termini were with [y-“P]ATP (about 7OOOCi/mmol; ICN) as described by Hay & (1982). except’ that the DNA was not denat,ured.

966

D. T. WEAVER

AND

M. L. DEPAMPHILIS

(iii) EcoRI region The 3’-ends of nascent DNA chains in purified SV40(RI) DNA (4 pg) were radiolabeled with 5 pM-[C(-32P]dCTP (3000 Ci/mol; N ew England Nuclear) and 5 to 10 units T4 DNA polymerase (P-L Biochemicals) at 12 to 14°C for 20 min (Tapper & DePamphilis, 1980). Alternatively, SV40(RI) DNA was digested with EcoRI and its 5’-extended termini radiolabeled with [Y-~*P]ATP and polynucleotide kinase without prior denaturation. (h) Mapping

the genomic locations of 3’-ends of nascent SF’40 DNA chains synthesized in vivo

(i) ori region [3’-32P]DNA strands from SVPO(R1) DNA were fractionated by electrophoresis in a 10% polyacrylamide/8 M-urea gel (13 cm x 15 cm x 0.12 cm) using BatNI [5’-32P]DNA restriction fragments from SV40 DNA as size standards (Hay & DePamphilis. 1982). The autoradiogram revealed a peak of Okazaki fragments that migrated into the gel while long DNA strands remained at the top. DNA was electroeluted from individual sections of the gel (section (d), above). Chains 100 to 170 bases long were used to map from the Hind111 site on mSVO2 and chains 170 to 360 bases long were used to map from sph1 on mSVO1. In this way, sufficient material was obtained to map the 27-bp palindrome region in both directions with a single preparation of SV40(RI) [3’-32P]DNA. To provide duplex DNA substrates for cleavage by Hind111 or SphI, the [3’-32P]DNA strands were hybridized to SV40 DNA sequences cloned into Ml3 DNA (mSVO1, mSV02). 10 p of virion M13-SV40 DNA were added to 25 ~1 of one of the size classes of [3’-3QP]DNA, denatured at 100°C for 3 min, adjusted to 250 mM-NaCl, and then incubated at 65°C for at least 2 h. Intact mSV: [3’-32P]DNA hybrids were separated from unhybridized [32P]DNA chains by exclusion chromatography through a 7 ml column of Sepharose CL-4B in 10 m&l-Tris +HCl (pH 7.8), 1 mM-EDTA, 100 m&i-NaCl. About 5% of the [32P]DNA was generally recovered in the void volume. The DNA hybrids were precipitated with ethanol, redissolved in 50 mM-NaCl. 50 mM-Tris . HCl (pH 8.0), 10 mMMgCl,, 100 pg bovine serum albumin/ml (Hind111 conditions) or 150 mM-NaCl, 6 mMTris . HCl (pH 7.4), 6 mM-MgCl,, 10 mw-2-mercaptoethanol, 100 pg bovine serum albumin/ml (SphI conditions), the buffers recommended by the supplier for Hind111 or #phi restriction endonucleases, and digested at 37°C with 10 units of enzyme for 4 h. Reactions were terminated and prepared for gel electrophoresis (section (i), above). The orientation of 3’-labeled SV40(RI) DNA chains was defined by their complementarity to either mSVO1 or mSV02, which was confirmed by their release upon digestion with SphI or HindIII, respectively. (ii) Mspl region The 3’-ends of DNA strands that had been cut with MspI and then radiolabeled at the 5’-ends of the restriction site were mapped using the same procedures described for the ori region, except that hybridization ww carried out with mSVO9. (iii) EcoRZ region The [3’-32P]DNA strands released by EcoRI were mapped as described by Tapper & DePamphilis (1980). In addition, the procedure described for the MspI region was also carried out at the EcoRI region. In order to demonstrate that the EcoRI site was the common 5’-terminus for all of the released DNA bands, a second portion of [5’-32P]DNA : mSV07 hybrids was digested with DdeI which cut within the cloned SV40 sequence at a single site 75 bases downstream from the EcoRI site. As expected, all of the major [32P]DNA bands were replaced with a single 75-nucleotide (5’-32P)-labeled EcoRIDdeI DNA fragment. In contrast, digestion of the DNA hybrids with HindIII, an enzyme

DNA

SYNTHESIS

ARREST

SITES

9tii

that cuts the SV40 segment once on the upstream (5’) side of the EcoRI site, did not alter the disposition of the major [5’-32P]DNA fragments. Finally, when these procedures were carried out using SV40(RI) DNA whose 5’-ends had been radiolabeled without first digesting the molecules with EcoRI, no DNA bands appeared in the gel. (i) Gel electrophoresis

and DNA

sequencing

Purified [32P]DNA samples (from sections (e) and (h). above) in 4 ~1 of 980/b formamide, 1 mM-EDTA, 0.5% bromphenol blue and xylene cylanol FF were denatured at 90°C for 3 min and then fractionated in polyacrylamide gels by electrophoresis (42 cm x 33 cm x 0.04 cm) as described (Weaver & DePamphilis, 1982). The DNA sequence covered by DNA polymerase a was of the same region of 32P-labeled primer-template determined concurrently using the dideoxynucleotide method of Sanger et al. (1978) and substituting E. coli DNA polymerase I (Klenow fragment) for a-polymerase. The sequence of nascent chains at ori was determined by the method of Maxam & Gilbert (1980) using t,estriction fragments whose 5’-labeled end was either Hind111 or SphI. Thus. the :I’-penultimate nucleotide on [“P]DNA chains was identified by subtracting one nucleotide from its chain length and then comparing it directly with the appropriate sequenced f’ragment, on the same gel. Following gel electrophoresis, gels were directly exposed to preflashed Kodak XR-5 film with a DuPont Cronex Lightning Plus intensifying screen at -SOY’. and the resulting autoradiogram used to obtain densitometer tracings (Weaver B I)rPamphilis. 1982). ( j ) Controls

The accuracy of these techniques was confirmed using unique DNA restriction fragments. For example, digestion of linear SV40 EcoRI [5’-32P]DNA with PstI generated two fragments, each labeled only at one 5’-end, that were easily separated by gel electrophoresis. Hybridization of one of these fragments to mSV07 and mSV08, containing the two complementary strands from the EcoRI region of the SV40 genome. demonstrated that the 5’-end-labeled strand annealed only to the M13-SV40 clone containing its

complementary sequence. Subsequent digestion with a restriction enzyme that cut only once within the SV40 EcoRI region (e.g. DdeI) released the expected 75-base DdeI-EcoRI [5’-32P]DNA fragment from the mSV07 hybrid. Digestion with either EcoRI or HindIII, restriction enzymes that did not cut within the predicted duplex region of the hybrid molecule. failed to release any radiolabeled DNA fragments.

3. Results (a) Palindromic

DNA synthesis arrest sites

The sequence of SV40 DNA required for initiation of viral DNA replication (ori) contains a 27 bp palindrome that is capable of forming a hairpin structure with 12 bp in the stem and three unpaired bases in the loop when present in a singlestranded DNA template (Figs 1 and 3). Such a template was provided by two M 13-SV40 single-stranded, circular, recombinant virion DNAs, mSVO1 and mSV02. Each cloned DNA contained one of the two complementary SV40 strands from a 311 bp BstNI restriction fragment that spanned ori (Hay & DePamphilis. 1982), thus allowing DNA polymerase 01 to synthesize DNA through this palindromic sequence from either direction. A unique primer was provided by annealing a 36 base long SV40 Hind111 [3’-32P]DNA fragment to mSV02, placing the 3’.OH end of the primer 58 bases from the beginning of the palindrome (Fig. 1). To observe DNA synthesis from the opposite direction, an 87 base long

968

D. T. WEAVER

AND

M. L. DEPAMPHILIS

---3’

mSVOl 5’--cli &I *

1 t

44

1 07 t I

1 t ,

38

1

5omHI (25331

+ mSVll

3’---

o-p01

J 5

PIG. 1. Structure of M13-SV40 recombinant DN4s (designated mSV) with SV40 DNA shown as filled bars bordered by the restriction sites and map positions indicated. These DNAs were used as templates for the analysis of DNA synthesis arrest sites in nivo (hatched arrows) and in vitro (filled arrows). The 5’-ends of the hatched arrows begin at the restriction site used to cut nascent DNA chains after hybridization to the template; the direction of the arrow indicates the orientation of nascent chains, and the length of the arrow defines the region in which arrest sites were analyzed in viva. DNA synthesis in vitro was initiated at the ‘J-end of a primer [shaded blocks) hybridized to an mSV template. The filled arrows indicate the direction of DNA synthesis by a-polymerase and the region in which arrest sites were analyzed in vitro. The primers are referred to by the restriction site at their %-end and their length in nucleotides (number shown in block). In between mSV02 and mSVO1, the sequence required for initiation of SV40 DNA replication (ori) is indicated by a shaded block, within which a 27 base palindromic sequence is designated by a “pinwheel”. The consensus sequence. G,-,-CG,-Pu,. is indicated by six hatched blocks, and t,wo 21 base direct repeats are indicated by filled arrows,

SV40 Xc01 [3’-32P]DNA fragment was annealed to mSVO1, placing the 3’-OH end of the primer 26 bases from the beginning of the palindrome (Fig. 1). Purified primer-templates were then incubated with several concentrations of CV-1 DNA polymerase a under optimal conditions for DNA synthesis, but with unlabeled deoxyribonucleotide substrates present. Synthesis was stopped after 15 minutes, and the single-strand [32P]DNA products were fractionated by gel electrophoresis under denaturing conditions. The sequence of nascent DNA was determined concurrently by allowing E. coli DNA polymerase I (Klenow fragment) to initiate synthesis on the same primer-template in the presence of a dideoxynucleotide @anger et aE., 1978). These single-stranded [32P]DNA products were analyzed on the same gel used for the DNA polymerase a products, providing an accurate identification of the template nucleotide at which a-polymerase stopped. In addition, obtaining the correct DNA sequence in each experiment also confirmed

DNA SYNTHESIS

ARREST

SITES

!I69

that all 13*P]DNA chains did, in fact, begin at the same nucleot,ide position. Because the amount of radioactivity was proportional to the number of DSA (-hains of a particular length, the relative strength of each arrest’ site was readil! apparent. DKA polymerase a was arrested at several specific sites on the templat,es (Fig. 2). A major arrest site, 58 bases from the 3’-end of the Hind111 primer. corresponded to the beginning of the 27 base palindrome (Fig. 3), and consisted of tbur adjacent nucleotides with the greatest accumulation of nascent DNA chains at the first nucleotide preceding the stem structure of the potential hairpin. Further increases in the concentration of a-polymerase did not produce a significant extension of nascent DNA chains beyond this point, indicating this arrest site t,o be exceptionally strong. None of the arrest sites observed before the polymerase encountered the palindrome (Fig. 2, Hind111 primer, sites 12 and 33) caould be correlated with other potential hairpin structures. The key element of a palindromic sequence is that it appears identical t*o a 1)olymerase reading it from either direction. Therefore, one would expect’ an idrnt)ical arrest site at the other end of the palindrome when D1C’A synthesis is carried out on the complementary template. Accordingly, a-polymerase was arrested 26 nucleot,ides downstream from the NcoI(87) primer on mSVO1: this is thcb first nucleotide prior to the stem of the potential 27 base hairpin (Fig. 3). Xdditional a-polymerase failed to extend synthesis beyond posit’ion 27. (‘omparison of densitometer tracings revealed that the intensity of this arrest’ sit,e w-as essentially the same as the one observed with mSV02 at the other side of the same palindrome. Therefore, this palindromic sequence arrested DNA polymerase a in the same manner on both complementary templates. Sot all palindromic sequences function as arrest sites. Of the four palindromes present in the SV40 ori region, only the largest one (27 bp) blocked a-polymerase at, the beginning of its sequence on both complementary templates (Fig. 8). Prominent arrest sites in mSVO2 centered 12 and 33 bases from Hind111 might have been correlated with palindromes beginning 15 and 17 bases, respectively, from WindIII. However, analysis of arrest sites in the same region of mSVO1 did notf reveal similar arrest sit’es. To examine this region of the template, a 44 base RglI primer was used to initiate synthesis in the center of the 27 base palindrome, bypassing the strong arrest site 26 bases from the NcoI primer (data not shown). So arrest site was observed by a-polymerase when leaving this palindrome, only when entering it. Thus, the simplest explanation for palindromic arrest sites is formation of a stable hairpin structure that excludes polymerase from reading that portsion of the template. The smaller palindromes apparently did not form hairpins under the conditions of our enzyme assay, and the stability of the 27 base palindrome prevented the 17 base palindrome included within it’ from folding into a hairpin, If formation of a hairpin structure is solely responsible for arresting DNA polymerase at some palindromic sequences, then sequences flanking the palindrome should be irrelevant. For example, the sequences marking the entrance to the 27 base palindrome in mSVO2 are distinctly different than those in tnSVO1 (Figs 3 and 8). To further t’est this hypothesis. a region of @X174 DNA

I

2

34

5

C

T

A

G

template

I i-

1

123

Ncol(87) 45

mSVOl

1234567

qPn 1

template

-1

FM. P. DNA synthesis arrest sites in the SV40 wi region recognized by u-polymerase i?z ah. mSV02 template: the mSV02 DNA template was almealed with either (3’-3zP)-labeled Hi~II.1 primer or NcoI(38) p rimer (Fig. 1) and incubated with 0. 0.6, 1.1, 2-4 or 6 units of DNA polymerase c1(lanes 1 to 5). The sequencing gels. The DNA sequence corresponding to that’ of the DKA produrts were purified and then fractionated by electrophoresis in W& polyacryIamide nascent DNA chain was determined concomitantly using the dideoxynucleotide method on the same primer-template and fract’ionating the products on the same gel. The data from the Hind111 experiment is shown as an example. C, T, A and G refer to the dideoxynucleotide used. mSV01 template: the mSVOl SphI primer (Fig. 1) and incubated with 0.06. 1.1, 2.4. 6 unit,s or D?U’A t.emplate was annealed with either (3’-32P)-labeled LYco1(87) primer or (5’-32 P)-labeled axis refer to the dist,ance in 0. 0.6. 1.1. 2.4. 6. 9. 12 units of DNA polymerase a respectively, and analyzed as described above. Numbers on the vertical nucleotidrs from the DNA primer which is defined as 0.

I

HindIll

mSV02

DNA

SYNTHESIS

ARREST

971

SITES

gc’ g;

C.mAATAAA--li'-fd'.'Of

G-C

u t J1 87

NC01

G-C

HopIU 4 1

1353 +x174-

Q‘G

c,

101

Ml3 Pmer

TTACGGT~CTCCGCC'G.A-A‘o ... .. .. GAGGCGG. GTT.CA

EcoRI nn

HornHI

m~X03-CATTTTGCTGCCGGT~~C/TTA~GGGGCCTAGGC~CTCCGCC.G.A-A'

MC hmer r

Ml3mp9-CATTTTGCTGCCGGTCACTTAAGGGCCCCDGCAGC-40

L

/

FIG. 3. DNA synthesis arrest sites observed in vitro and their relationship to palindromic sequences. Palindromic sequences in mSV02, mSVO1, $X174 and m4X03 DNA templates are represented as hairpin structures with base-pairs indicated by dots (sequence hyphens have been omitted for clarity). The primer used and the direction of DNA synthesis is shown for each t.emplate. Numbers refer to distance in nucleotides either from the 3’-end of the primer or between two nucleotide sequences. Arrest sites are designated by boxes.

previously demonstrated t,o contain a strong arrest site at the entrance to a palindrome 111 bases from an Ha&I primer (Fig. 3; Weaver & DePamphilis. 1982) was cloned into M13mp7 DNA. This new template (m4X03) was annealed to the Ml3 primer (Materials and Methods, section (d)) labeled at its 3’-end with one [32P]dTMP to provide a unique initiation site 36 bases upstream from the same palindrome (Fig. 3). In both templates, a-polymerase was strongly arrested at the first two bases prior to entering the palindrome. Not only was the 34 base sequence approaching the palindrome totally different in the two templates, but m4X03 formed a 16 bp region of secondary structure that had to be disrupted before the 4X174 palindrome was encountered. Thus, changing the DNA template sequence directly in front of a palindrome made no difference in its ability to arrest DNA synthesis.

972

D. T. WEAVER

AND

M. L. DEPAMPHILIG

In order to demonstrate that the predicted hairpin structure was actually formed under the conditions used for DNA synthesis, advantage was taken of the fact that M13mp7 DNA contains two adjacent but inverted copies of the same polylinker cloning sequence containing several restriction sites (Messing et al., 1981). When DNA is cloned at one of these restriction sites, the resulting singlestranded virion DNA could potentially form a hairpin structure with the polylinker cloning sequence forming the stem and the DNA insert forming the loop. The existence of this structure has been demonstrated by its susceptibility to cleavage with the appropriate restriction endonuclease, resulting in release of the single-stranded cloned DNA insert’ (Ricca et al., 1982; Patton & Chae, 1982). Four Ml3 recombinant DNA molecules (m4XO1, m4XO3, mSV07 and mSV08) were tested for the existence of this hairpin under the same conditions used to analyze DNA synthesis by cc-polymerase. In each case. BamHI released all of the DNA insert which was identified by gel electrophoresis (data not shown). In each case, DNA polymerase a initiating synthesis at the Ml3 primer, was arrested at the base of the stem in the predicted hairpin structure (Fig. 3; e.g. m4X03). Furthermore, when formation of this hairpin was prevented by removing one copy of the polylinker cloning region (M13mp9; Messing, 1981), t’his arrest site was no longer detected although other arrest sites appeared further downstream (Fig. 3). Therefore, DNA polymerase tl was arrested by some, but not all, palindromic sequences because of their ability to form a stable hairpin structure in single-stranded DNA templates. (b) Non-palindromic

DNA

synthesis

arrest sites: analysis

of direct repeats

Many DNA synthesis arrest sites were not found at the base of potential hairpin structures that occurred within 140 bases of the primer. The possibility of hairpin structures forming through base-pairing of complementary regions far removed was experimentally eliminated by cloning a 162 base region of 4X174 DNA into Ml3 DNA and demonstrating that the 4X174 arrest sites remained unchanged (Weaver & DePamphilis, 1982). However, because these sites could not be predicted from template sequence alone (Weaver & DePamphilis, 1982), sequences were examined which were repeated either in the same or in a mirror image orientation in order to define the characteristics of an arrest site. mSV02 DNA contains two copies of a 21 bp sequence and six copies of Gs-,-C-G,-Pu, repeated with the same orientation (“direct repeats”) and no palindromic sequences (Figs 1 and 4); all palindromes in the SV40 segment of mSVO1 and mSV02 are found in the ori region (Fig. 8). This template was annealed to the [3’-32P]NcoI(38) primer (Fig. l), and incubated with various concentrations of DNA polymerase ~1. Numerous sites occurred throughout the region of direct repeats with the most intense sites closest to the primer (Fig. 2). Only the arrest. sites observed in the first 21 base repeat appeared to be repeated in the second 21 base repeat; no correlation was evident between arrest sites and the 8 t’o 9 base G+C-rich consensus sequence. Thus, the length of sequence required to generate such an arrest site is 21 bases or less. To observe DNA synthesis in the opposite direction, the SphI [5’-32P]DNA primer was hybridized to mSVO1 (Fig. l), the complementary sequence to mSV02,

DS.4

SYNTHESIS

ARREST

!I;3

SITES

extended with increasing amounts of a-polymerase. The strongest arrest sit,es were centered 13 and 24 bases, respectively, from the 5’phI primer (Figs 2 and 4). Although the site at position 24 was at the entrance to the first 21 base sequence in this direct repeat, this arrest site did not’ appear at the entrance t,o the second “1 base sequence. Therefore, the sequence required to stop polymerase does not t~xist solely within the 21 bp sequence. but must involve some of the flanking I)IvA. Although cc-polymerase traveled at least 115 bases from its primer (as noted by the presence of an arrest site), the enzyme failed to pause at any of thcl numerous sit,es recognized in the G +C-rich region of the complementar!. trmpta,te. (‘omparison of the data from these two DNA templates revealed a striking Iack of correlation between arrest sites observed by cc-polymerasr coming f’rom opposit’r directions. Therefore. there exists at least two groups of I)?;.\ synt hrsis arrest signals: palindromic sequences capable of forming stable hairpitl st’ruc%urrs that. arrest’ polymerase from either direction: and primary 11X.4 sequences that arrest polymerase. If polymerase stopped at the entrance to thcb first %I bp repeat, because it was the stem of a stable hairpin structure. then t’hch samrs stem should also exist with the second 21 bp repeat. resulting in a second arrest site identical to the first. Since this was not the case, format#ion of srcondarv structure is not, a likely explanation for this arrest site. and

((a) ,Von-palindromic

DNA

arrest

sites:

analysis

of mirror-ima,ge

repeats

I’nlike palindromic sequences, a sequence that is repeated with a mirror-image orientation cannot form hairpin structures. Mirror-image repeats thus allowed a correlation to be made between the orientation of a particular sequence and its abilit)y t,o arrest’ ol-polymerase. A 17 bp mirror-image repeat exists in a 15X bp parvovirus Hl sequence cloned into M13mp5 (RsabSCl and RsabSC2) by R,hodr 6t Klaassen (1982) (Fig. 6). When the Ml3 primer was used to initiate DNA synthesis on R.sabSC2, an intense arrest sit’e was observed 57 bases downstream JIO arrest s&e was (Fig. 5). at t’he entrance to the repeated sequence. However. observed as the enzyme left this repeat. Therefore, if the repeat)ed sequence was responsible for arresting the enzyme, it functioned only in one orienta,tion. A similar observation was made with two other smaller mirror-image repeats found in the SV40 ori region (Fig. 8). Alternatively, the informat~ion required to arrest polyrnerase at. these sites may have no correlation with sequence symmetry. and simply reflect a requirement for a specific sequence that overlaps the mirror-image repeat.. For example, the sequence and strength of arrest site 24 on m8VOl (Fig. 4) is similar to site 57 on RsabSC2; both sites are at the entrance to 3’-.I-(:(:-(:-((‘/T)-(:-(:-(:-G-5’. In contrast, only a minor arrest site was observed on Ksab,I)(l, the complementary templat’e, at the entrance t.o the C-rich strand of thr tnirror-image repeat (Figs 5 and 6). Although arrest site 57 in the RsabSC2 template appeared as strong as any of the palindromic sites previously examined, it could not be accounted for by the presfbncc of a stable hairpin structure. None was detected in a computer analysis of the parvovirus region (>4 bp stem, 3 to 20 base loop (Weaver &r DePamphilis. 1982)). Furthermore, based on our previous analysis of palindromic arrest sites (s&ion (a). above), an arrest sit’e of similar intensity would be expected at the

5’

I

3’ -imSV02)-

tt

TACCCCGCCTCTTACCCGCCTTGACCCGCCTCAATCCCCGCCCTACCCGCCTCAATCCCCGCCCTGATACCAACGACTGATTAACTCTAC mmBmBm w b AT~GCGGAGAATGGGCGGAACTGGGCGGAGTTAGGG~G~TGGGC~GTTAGGGGCGGG~TATGGTTGCTGACTAATTGA~TG

-(

I

mSVOl )-3’

120

5’

Rsa b9CI

RsabSC2 I 0

I

2

3

4

(a)

5

c

TAG

I

1 67

8G

(b)

Fm. 5. DNA synthesis arrest sites at a unique pawnvirus DNA sequence i,~ vitro. (a) The RsahS(J2 DNA template was annealed with the Ml3 primer, labeled at its X,-end with [3ZP]dTTP, and incubated with 0. 0.5, 2.6. 5. 9 and 12 units of DNA polymerase c( (lanes 0 to 5). DNA product analysis and dideoxy sequencing (lanes C, T, A and G) was done as for Fig. 2. (b) The Rsab9Cl DNA template was annealed with the Ml3 primer, labeled at its 3’-end as described above, and incubated with 6, 12 and 18 units of DNA polymerase a (lanes 6 to 8). A single dideoxy sequencing track (lane G) points out the position of the mirror-image repeat in the parvovirus sequence. Numbers on the vertical axis designate (IV) DNA the distance in nuclcotides from the primer (P). The b oundary- of the Ml3 and parvvvirus on the Rsab9Cl template is designated on the vertical axis.

I). T. WEAVER

976

$ND

M. L. DEPAMPHILIS

57 Ml3+PV-HI

Lyi3-b

461

J m I

3-(Rsab9CZlt25-TGAACCAGGTATCGCTTGCATACATAGAGGGTGGGGGGGTGGGATTTTTGTATC -ACTTGGTCCATAGCGAACGTATGTATCTCCCACCCCCCCACCCTAAAAACATAG-l22+(Rsab9Cll-3' 5'

5

+fmJ

L136

FIG. 6. Non-palindromic DNA synthesis arrest sites of a-polymerase in a unique parvovirus DNA sequence. Densitometer tracings of lane 4 and lane 7 (Fig. 6) are plotted with the relevant parvovirus Hl (PV-Hl) DNA sequence. The vertical arrows designate t,he position on the RsabSC2 or Rsab9Cl template nucleotides at which DNA synthesis arrest sites occurred and the numbers refer to the distance from the Ml3 primer. The lengths of the arrows are proportional to the height of the corresponding peaks in densitometer tracings. Bold arrows indicate a mirror-image repeat in the template sequence. The hatched box designates a 10 base sequence which has alternating purine and pyrimidine nucleotides. Sequence hyphens have been omitt,ed for clarity.

same sequence on the complementary template before the enzyme passed “arrest site 57”. Potential long-range base-pairing with Ml3 sequences was excluded because the potential secondary structures (10 to 15 bp, 80% homology) did not correlate with the positions of arrest sites. As observed with all other class II arrest sites, increasing concentrations of DNA polymerase LXextended synthesis past the parvovirus arrest site, as indicated by several ot’her strong arrest sites up to 200 bases from the primer. Either AMV reverse transcriptase or E. coli DNA polymerase I Klenow fragment were also arrested in this region of the template. which complicated the sequence analysis. Therefore, identification of the arrest site was limited to GAG, 56 to 58 nucleotides from the primer. Phage T7 DNA polymerase was also arrested at this site to the same extent as cr-polymerase. The AMV polymerase was tested at 42°C where imperfect hairpin structures, had they existed, would have been less stable. The parvovirus sequence also revealed a correlation between arrest sites and double-stranded DNA containing alternating purine and pyrimidine residues (Fig. 6). Arrest site 57 on RsabSC2 and an arrest site of equivalent intensity 160 bases from the primer on RsabSCl (Fig. 5) were symmetrically located about the center of a ten base stretch of alternating purinelpyrimidine residues. Since a-polymerase was arrested on both strands after it synthesized this sequence, the left-handed helical nature of duplex DNA containing alternating purines and pyrimidines (Wells et al., 1982) may represent a third class of arrest sites. However, in contrast to the strong arrest site on Rsa9C2, the strong site on RsabSCl did not arrest AMV reverse transcript’ase (Fig. 5). (d) DNA synthesis arrest sites in vivo To determine whether or not DNA synthesis arrest sites were expressed in viva as well as in vitro, the genomic positions of 3’-termini of nascent SV40 DNA

DNA

SYNTHESIS

ARREST

SITES

9;;

chains synthesized in virus-infected CV-1 cells were mapped near the termination region using the procedure described by Tapper & DePamphilis (1980). Purified SV40(RI) DNA was radiolabeled at its 3’-ends, and the longest strands were isolated, hybridized to SV40 linear DNA, digested with EcoRI, and [32P]DNA fragments fractionated by gel electrophoresis under denaturing conditions. EcoR,I cauts SV40 DNA at a single site about 800 bp from the place where most replication forks terminate synthesis. Prior to EcoRI digestion of [32P]DNA hybrids, all [32P]DNA was greater than 900 nucleotides (Fig. 9(a). lanes d to f). After digestion, [32P]DNA fragments were observed 200 to 900 nucleotides from the EcoRI site (Fig. 9(a), lanes a to c), revealing the presence of DNA synthesis arrest sites proximal to the termination region. The major sites appeared as clusters of five or fewer nucleotides, the limit of resolution in this gel. ,411 alternative method was employed to detect in vivo arrest sequences at, a resolution where single nucleotide differences could be determined (Materials and Methods. section (h)). Five or six arrest sites were found 75 to 150 bases downstream from the EcoRI site (data not shown). Analysis of a second wild-type strain, SV-S, revealed no differences from wt800 in this region. Similar results were also obt’ained downstream from the MspI site using the mSVO9 template (Hay et nl.. 1984). Eight arrest sites were also observed within a 230 base region downstream of the MspI site. The intensities of these [32P]DNA bands, while distinct. were only two to fourfold above background and therefore relativ+ minor arrest sites compared eit’her with in v&o arrest sit,es or with in, zGvoarrest sites closer to the termination region. In addition to wild-type SV40, two viable mutants were also examined that contained either a 240 bp insertion (inSV-MH) or 184 bp deletion (d1884) located from 2000 to 2600 bp from the arrest sites 200 to 800 bases from EcoRI. Although these mutants do not change the sequence over which these arrest sites were mapped. they do slightly alter the distance from ori to the termination site for each replication fork. The resulting pattern of arrest sites in these mutants were ident,ical to each other (Fig. 9(a), lanes b and c). The relative intensities of DNA hands from each of the mutants were less than observed with wild-type viral DNA, particularly at distances greater than 350 bases from the EcoRI site (Fig. 9(b)). Therefore, surprisingly small changes in the size of the genome can alter the expression of DNA synthesis arrest sites in z&o. One prominent arrest’ site appeared 440 nucleotides from the EcoRI site in both mutants, but was absent in wild-type (Fig. 9(a), lanes a to c). This may reflect a difference in DNA sequence between the two strains. (e) Absence of palindromic

arrest sites in vivo

The SV40 ori region contains a 27 bp palindromic sequence that’ acts as a strong DNA synthesis arrest site in vitro, apparently because it forms a stable hairpin when present in a single-stranded DNA template (section (a), above). Does this palindromic sequence also form a hairpin when a replication bubble is initiated in viva? To locat’e in vivo DNA synthesis arrest sites in the ori region, the 3’.ends of DNA chains in purified SV40(RI) DNA were radiolabeled and mapped from t,hr

97x

I). T. WEAVER

AND M. L. DEPAMPHILIS

Hind111 site as described in Materials and Methods (sections (g) and (h)). HindIII cuts mSVO2 at a single site located in the SV40 ori region (Fig. 1). Digestion with Hind111 released several discrete bands of [32P]DNA (Fig. 7) whose autoradiographic intensity was similar to bands observed in high resolution gels of the MspI and EcoRI regions. No bands were observed without Hind111 digestion. These in vivo arrest sites were most pronounced at nucleotides 5222 to 5237, corresponding to the first part of the 27 bp palindromic sequence (5230 to 5248) in the ori sequence encountered by the DNA polymerase (Figs 7 and 8). A second, less intense arrest site was located 31 to 37 bases from the Hind111 site at positions 5202 to 5208. This site is next to the transition point for bidirectional replication (5210 to 5211; Hay & DePamphilis, 1982). Arrest sites on the complementary strand of t)he ori region were mapped by hybridizing [3’-32P]DNA chains 170 to 360 bases long to mSVO1 DNA, and then digested with ~Sph1which cuts mSVO1 at a single site within the SV40 sequence (Fig. 1). In comparison to mSV02, no significant DNA bands were released from the mSVO1 template (Fig. 7). Therefore, the 27 bp palindrome that functioned in vitro as an arrest site, did not do so in vivo. DNA synthesis in vivo did not pause at the entrance to the palindromic sequence on both templates, and, in contrast to the in vitro arrest site on mSVO2 at nucleotides 5227 to 5230, the in vivo site was not concentrated at the base of the potential hairpin structure. A similar result was also observed at replication forks near the termination region (section (f), below). (f) Comparison of in vivo with in vitro DNA synthesis arrest sites Analysis of the progress of DNA polymerase a along a purified DNA template in vitro clearly revealed the presence of specific DNA sequences capable of arresting DNA synthesis (sections (a) to (c), above; Weaver & DePamphilis, 1982). A similar, but not necessarily identical, phenomenon also appears in several regions of the SV40 genome during its replication in vivo (sections (d) and (e), above; Tapper & DePamphilis, 1980). In an effort to elucidate t,he relationship between these two phenomena, the genomic positions of DNA synthesis arrest’ sites recognized in vitro on an SV40 DNA template were compared directly with the sites recognized in vivo in the same template region. In the ori region, at least eight DNA synthesis arrest sites were mapped on the two complementary templates but only two of these sites may have been expressed in vivo (Fig. 8). A similar analysis was carried out at the EcoRI-BamHI region (Fig. 9). mSVl1 DNA, which represents the template on the forward arms of replication forks in the EcoRT-BamHI region of the genome, was annealed with a 211 base primer whose (5’-32P)-end had been generated by cleavage at the SV40 EcoRI site, and its 3’.end by cleavage at the PstI site (Fig. 1). Thus, DNA synthesis in vitro on this primer-template was in the same direction as continuous DNA synthesis of long nascent DNA strands in vivo. The primer was extended for 15 minutes with products were different concentrations of a-polymerase, and the r3’P]DNA fractionated by gel electrophoresis. Since the 5’.ends of the nascent DNA chains synthesized in vitro (Fig. Q(a), lanes 1 to 5) were identical to the 5’-ends of [3’-32P]DNA strands synthesized in vivo and released by EcoRI (Fig. Q(a), lanes

-

+

C

T

A

G

FIG. 7. In viva DNA synthesis arrest sites in the origin region for SV40 DXA replication. mHVO2 and mSVO1 single-stranded DNAs were hybridized to SVIO(R1) [3’-32P]DNA as described in Materials and Methods (section (h)). Hybrids contaming the 100 to 170 base labeled fragments were digested with Hind111 ( + ) and those containing the 170 to 360 base labeled fragments were digested with SphI ( + ) and then fractionated by polyarr~lamide gel electrophoresis. I’ndigested hybrids (-) and the corresponding DNA sequence (C. T 1s T+C, A is A +G. and 6) were fractionated in parallel in either X0, (NindIII) or 6Y, (8phI) gels. The position of the 27 bp palindrome on the mRV02 template is Indicated hy thr “pirIM-heel”.

5’

mSVO1

NC01

3’

5’

FIG. 8. Summary of in vitro and in viva DNA synthesis arrest sites in the SV40 ori region. mSV02 and mSVO1 DNA template sequences are shown from SV40 map positions 5172 to 40 with palindromic sequences indicated by a pinwheel and mirror-image repeated sequences indicated by bold arrows. The ori sequence required to initiate viral DNA replication is indicated by breeze marks. The origin of bidirectional DNA replication is indicated by the large shaded arrows which show where continuous DNA synthesis in the dnertion of the arrow begins on each side of the ori region. Early mRNA (E-mRNA) is synthesized from the mSVO1 DNA template in the direction indicated. 3’.Ends of HindIII(36), XcoI(8T) and B&44) primers were used to initiate DXA synthesis in vitro. The nucleotide positions where DNA polymerase a was arrested are noted by vertical arrows; the length of the arrow is proportional to the relative intensities of arrest site from the data in which the site was most prominent. The numbered arrows refer to distance in nurleotides from the primer. I)ensitometer tracings of the arrest sites observed in c,i~o on the template sequence represented by mSVO2 are shown b,v hatched peaks. Sequence hyphens have been omitted for clarity.

3’

mSV02

SV40 o/i (65 bp)

DNA ln

Vl

SYNTHESIS

ARREST

SITES

!I8 1

In VIVO

vo

finviva

-EcoRt

d1884

I

1

t

-

‘A-“-

-

a-P01

S54321

Sfedcba

243

993 823 673 552

444 369

31 I

24s

(b)

(a)

Fro. 9. C:omparison of DNA synthesis arrest sites observed in vitro with those observed over the same sequence in Go. (a) In Gno: purified SV4O(RI) DNA from wtSV40 (lanes a and d), dlH84 (lanes k)and c) and i&V-MH (lanes c and f) were radiolabeled at the 3’-ends of their long nascent DSA strands, and hybridized to linear SV40 DNA. Samples were analyzed by electrophoresis in -loo I)olyacrylamide gels under denat.uring conditions before (- lanes) and after ( + lanes) digestion w&h E:coKl along with SV40 B&I [5’-32P]DNA restriction fragments as standard (S). and the [3zP]DSA hands detected by autoradiography. In vitro: the mSVl1 DNA template was annealed to a 111 base [.C3*P]DNA primer (see Fig. 1) and then incubated with DNA polymerase a: at concentrations of 0. 2.5. 6, 12 and l.5 units (lanes I to 5). The DNA products were then analyzed by electrophoresis in 40, I)olyacrylamide gels under denaturing conditions along with SV40 BstNI DNA st,andards (S), and the [‘*P]DNA bands detected by autoradiography. Numbers on the vertical axis indicate the size in bases of t)he designated bands. (b) Densitometer tracings: densitometer tracings are shown of lanes a. b. 2. 3. 1 and 5 of (a). Numbers indicate the size in bases of the designated peaks. The direction of l)SA synthesis in &YI and in aim is from right to left as indicated on the horizontal axis. The junction between Ml3 and SV40 sequences in mSVl1 is also indicated along with the position of a palindromit sc’yuence that can form a hairpin with 7 bp in the stem and 10 bases in the loop. The Y’-end of the P.qtl (21 I ) primer is indicat)ed by t’he position of the 211 base peak (P).

a to (3): nascent DNA chains that were arrested at the same genomic site would have the same length. Densitometer tracings of the autoradiograms in Figure 9(a) allowed easy comparison of the major arrest sites (Fig. 9(b)). Of the nine most prominent

sites

detected

in viva in the

SV40

region

of

mSV11.

seven

sites

982

D. T. WEAVER

AND

M. L. DEPAMPHILIS

corresponded to arrest sites observed in vitro (compare panels 2 to 5 with panel a at a resolution of f5 bases). Since the in vitro data represent synchronous DNA synthesis beginning at a unique point, and the in vivo data represent the steadystate distribution of nascent DNA synthesis during the peak period of viral DNA replication, only the positions of arrest sites are comparable, not their relative amplitudes. Three DNA bands observed in vitro would not be expected to appear in the in vivo data. The 211 base DNA band observed in vitro is the unextended [5’-32P]primer, the 230 base DNA band presumably represents the normal processivity of a-polymerase (Weaver & DePamphilis, 1982; Pritchard et al., 1983), and the 750 base DNA band lies on t’he border of Ml3 and SV40 DNA sequences. However, the major arrest site recognized in vitro 405 bases from the EcoRT site might be expected to also appear as a major arrest’ site in wivo, since it’ is the strongest arrest site in this region. In fact, this site corresponds to the primer-proximal side of a palindrome capable of forming a hairpin structure with seven sequential base-pairs in its stem and ten bases in its loop. Thus. in vitro the 405 base DNA band probably represents a class I arrest site which cannot form a hairpin in vivo and therefore no longer impedes DNA synthesis.

4. Discussion (a) Palindromic

and non-palinodromic

DNA

synthesis

arrest sites in vitro

There are at least two classes of DNA synthesis arrest sites that can be recognized experimentally in vitro. Class I sites result from secondary structure formed by the folding of self-complementary palindromic DNA sequences into a “hairpin”. This was demonstrated by the fact that DNA polymerase a was arrested predominantly at the first base before entering a palindromic sequence from either direction (Figs 2, 3 and 8). Furthermore, by cloning a 4X174 DNA sequence containing a palindrome into Ml3 DNA (m4X03), the palindromic sequence itself was shown to block DNA synthesis in either background (Fig. 3; Weaver & DePamphilis, 1982). If hairpin formation was prevented by deleting one arm of a palindromic sequence, the arrest site was no longer observed (Fig. 3). Some palindromes did not arrest a-polymerase (Fig. 8), presumably because their hairpin conformation was not sufficiently stable. Most of the DNA sequences that arrested a-polymerase could not be explained by a close encounter with a hairpin of the class I kind. Furthermore. three lines of evidence rule out the presence of long-range secondary structure to explain these class II sites (non-palindromic arrest sites). (1) The M13mp7 sequence contains many potential long-range secondary structures consist,ing of 10 to 15 bp with 80% homology. However, in the template regions examined for arrest sites (Figs 4, 6 and 8), only 10% of these structures occurred within five bases downstream of an arrest site. Since our analysis of palindromic arrest sites revealed that polymerase pauses directly at, the base of secondary structure, most of the predicted long-range secondary structures would not account for the formation of class II sites. (2) A 12 and a 14 base sequence with SOS/, complementarity to the 21 base direct repeat in template mSV01 were found at positions 42 and 1395 in M13mp7. Since these homologies could form a stable secondary structure with

DNA4 SYNTHESIS

ARREST

SITES

9x3

either of the two 21 bp repeats, they should have produced an arrest site at the entrance to both repeats. Instead, a-polymerase paused only at the entrance to the first repeat (Fig. 4), suggesting that this arrest site was not due to formation of long-range secondary structure. (3) Class II sites in &X174 DNA (bases 1174 to 980) were isolated from potential long-range secondary structures either bj cloning t,hem into a new DNA background (M13mp7) or by converting the flanking 4X174 sequences into double-stranded DNA (Weaver & DePamphilis. 1982). Since these changes had no effect on the pattern of arrest sites in this region, these sites were defined exclusively by those sequences within 24 bases upstream and 140 bases downstream of the arrest point,; long-range interactions between template sequences were not involved. Nevertheless, a homology search of +X174 and M13mp7 genomes revealed seven regions in 4X174 and five regions in Ml3 that contained greater than 5 bp of perfect homology with sequences in the 80 base region containing the class II arrest sites. Therefore, long-range secondary structures which could theoretically form in this region of the 4x174 t’emplate, were clearly not the explanation for the appearance of these DNA synthesis arrest sites. What sequences are responsible for class II sites? These sites could not be correlated with either direct or mirror-image repeated sequences. However, analysis of direct repeats suggested that class II sites contained greater than eight or nine bases but less than 22 bases. The arrest site pattern in the first 21 base repeated element in the mSV02 template was repeated in the second 21 base element (Fig. 4). Furthermore, analysis of the complementary template further suggests that sequences both in front of and behind the actual arrest site are required: entrance to the first 21 base repeat arrested a-polymerase whereas entrance to the second repeat did not (Fig. 4, mSVO1 template). Analysis of mirror-image repeats suggests that the orientation of class II sites is critical: arrest sites observed in the first repeat were not observed in the second (Figs 6 and 8). One example of a class II site may be composed in part by the template sequence 3’-(A/T)3(G/C)-A-G-G-G-(C/T)-G-G-G-G-5’; arrest site 24 on mSVO1 includes bases 2 to 6 and arrest site 57 on RsabSC2 includes bases 4 to 6 from the 5’-end (Figs 4 and 6). A similar site on RsabSCl that is C-rich instead of G-rich was only a minor arrest site (Fig. 6). A second example of a class II site rnas result from stretches of alternating purine and pyrimidine residues in the newI) synthesized double-stranded DNA. Sequences of this type have been shown to favor a left-handed helix (Wells et al., 1982) that may force DNA polymerase to pause until equilibrium generates a right-handed helix. A stretch of ten such residues acted as a strong arrest site for cl-polymerase as it completed synthesis through this region (Fig. 6). In fact, arrest site 57 on RsabSC2 may be a composite of both of these arrest sequences because AMV reverse transcriptase was also arrested at this location. whereas it was not, arrested as it left the alternating purine/pyrimidine stretch on RsabSCl (Fig. 5). When the intensities of individual 32P-end-labeled DNA bands relative t,o the background were compared, class II sites were found to be equivalent to class I sites in their ability to arrest DNA polymerase a. For example, the two strong non-palindromic arrest sites found in parvovirus DNA (Fig. <5)were as intense as

984

D. T. WEAVER

AND

M. L. DEPAMPHILIS

any of the palindromic sites (Figs 2 and 9). In fact, one of these class II sites arrested both AMV reverse transcriptase and DNA polymerase I, both enzymes traverse without pausing through all of the class I sites so far examined. Examples of class I and class II sites on the same template also revealed similar intensities for both types of arrest sites; in one case the class II sites appeared more intense than the class I site (Fig. 9; Fig. 2, mSVO1 template, SphI primer, class I site is 115 and others are class II). (b) Expressiork

of

LISA synthesis arrest sites in vivo

The 3’-ends of nascent DNA strands on the forward sides of SV40 replication forks accumulated at specific nucleotide positions throughout the genome. The most pronounced of these in vivo DNA replication arrest sites appeared in the EcoRI-BnmHT region approaching t,he termination site for replication, as previously reported (Tapper & DePamphilis, 1980). The locat,ions of about 80% of the prominent in viva sites compared favorably with in vitro sites in the same template. At the nucleotide level, in viva and in vitro arrest sites comprised the same size range of nucleotides, one t’o eight bases. However, the relative intensities of in vivo sites above background were generally lower than in vitro sites in the same region (e.g. Figs 8 and 9). The data suggest that all DNA synthesis arrest sites identified in vitro are not suppressed by the formation of a replication complex inside living cells. This conclusion is consistent with the observation that specific protein cofactors for DNA polymerase a (Pritchard et al., 1983) or phage T4 DNA polymerase (M. Charette, D. Weaver & M. DePamphilis, unpublished results) dramatically stimulated DNA synthesis by the homologous enzyme on extensively single-stranded templates without altering the pattern of arrest sites. One would not expect secondary DNA structure to be involved in arresting DNA replication in vivo. The cruciform conformation of palindromes in doublestranded DNA is kinetically unfavored under physiological conditions (Courey & Wang, 1983; Gellert et aE., 1983; Singleton, 19g3; Sinden & Pettijohn, 1984), and cruciforms have not been detected in vivo (Sinden et nl.. 1983) or in isolated chromosomes (Herman et al., 1978). Only the single-stranded regions of replication forks might allow transient formation of hairpins, and these structures were not detected as arrest sites in vivo. The strong 27 base palindromic arrest site within SV40 ori was easily detected on both complementary templates in vitro, but in viva only one site relatively broad in size and comparatively weak in intensity was observed overlapping the entrance to this palindrome and this was on the mSV02 template (Fig. 8). The failure to arrest polymerase precisely at the base of the putative hairpin, the comparatively weak intensity, and the absence of template all suggest that. t,his a corresponding site on the complementary palindromic sequence did not fold into a hairpin during DNA replication in viva. An alternative explanation is that only continuous DNA synthesis on the forward arms of replication forks such as occurs in this region of mSV02 would allow folding of the hairpin downstream; while initiation of DNA synthesis which occurs within the palindrome on the mSVO1 template would prevent hairpin formation

DNA SYNTHESIS

ARREST

!M

SITES

on that side of ori. This first explanation appears correct since another palindromic arrest site far removed from ori (E’coRI-BumHI region) that was strongly expressed in vitro was also either absent or displaced on the forward arms forks where DNA synthesis is continuous (Fig. 9). Finally. the of replication t,ermination site for DNA replication in plasmid R6K has been shown to arrest replication forks both in wivo and in vitro (Germino & Bastia, 1981). and does not caontain palindromic sequences (Bastia et al., 1981). This work was supported by the National Cancer Institute (CA15579) and the American (‘ancrr Society (MV-114). D.T.W. was supported in part by the Albert J. R,yan I’oundat,ion. REFERENCES i\nderson, S.. Kaufmann, G. & DePamphilis, M. L. (1977). Biochemistry, 16, 4990-4998. Ilastia. D.. Germino, J., Crosa.
Buckler-White. A. eJ. & Pigiet, V. (1982). J. Viral. 44, 499-508. (Ihallberg, M. & Englund, P. (1979). J. Biol. Chem. 254. 7820-7826. Clayton, D. A. (1982). Cell, 28, 693-705. Courey, A. J. & Wang, J. C. (1983). Cell, 33, 817-829. I)ePamphilis, M. L. & Wassarman, P. M. (1982). In Organization and RepZication of I’ircrl 1)A’L4 (Kaplan, A. S., ed.), pp. 37-114, CRC Press, Boca Raton, FL. I)rPamphilis, M. L.. Anderson, S., Cusick, M.. Hay, R., Herman. T., Krokan, H.. Shelton. E.. Tack. L., Tapper, D., Weaver, D. & Wassarman, P. M. (1980). In Mechanktic r~budies of ZIN.4 Replication and Genetic Recombination, ZCN-C’C‘LA Symposia on Molecular and Cell&r Biology (Alberts. B.. ed.), vol. 19. pp. 55-78. Academic Press.

Sew York. I)oda. ?J. N.. Wright. C. T. &. Clayton. D. A. (1981). Prof.

Tat. Acad. Sri..

1’S.d.

78. 61 16

6120.

Fairfield. F. R.. Newport,
(iermino. J. & Bastia. D. (1981). Cell, 23, 681-687. Hap. N. bt Aloni, Y. (1984). b&l. Acids Res. 12, 14OlL1414. Hay. R. T. & DePamphilis, M. L. (1982). Cell, 28, 767-779. Hay. R. T.. Hendrickson, E. A. & DePamphilis, M. L. (1984). J. Mol. Biol. 175, 493-510. Herman. T. M.. DePamphilis, M. L. $ Wassarman, P. M. (1979). Biochemistry. 18. 4563-~ 4571. Huang, (‘. (‘.. Hearst. J. E. & Alberts, B. (1981). J. Biol. Chem. 256. 4087-4094. Kafatos. F..
22, 5177-5188.

Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). kfolecuZar Cloning, pp. M-97. (‘ol(i Spring Harbor Press, Cold Spring Harbor. llaxam. A. & Gilbert, W. (1980). Methods Enzymol. 65, 499-559. 1lrssing. .J. ( 1981). 3rd Cleceland Symposium on Macromolecules: ZZecowtbinant Z),Va4 (Walton. A.. ed.), pp. 143-153. Elsevier. Amsterdam. Messing, *I.. Crea, R. Cy:Seeburg, P. (1981). Nucl. Acids Res. 9, 309-321. Mills. I).. Dobkin. (:. 62 Kramer, F. (1978). Cell, 15. 541-550.

986

D. T. WEAVER

AND

M. L. DEPAMPHILIS

Patton, J. & Chae, C. (1982). Anal. B&hem. 126, 231-234. Platt, T. (1981). CeZZ,24, 10-23. Pritchard, C. G. & DePamphilis, M. L. (1983). J. Biol. Chem. 258, 9801-9809. Pritchard, C. G., Weaver, D. T., Baril, E. F. & DePamphilis, M. L. (1983). J. Biol. Chem. 258, 9810-9819. Rhode, S. L. t Klaassen, B. (1982). J. Viral. 41, 990-999. Ricca, G., Taylor, J. & Kalinyak, J. (1982). Proc. Nat. Acad. Sci., U.S.A. 79, 724-728. Sanger, F., Coulson, A. R.. Friedmann, T., Air, G. M., Barrel], B., Brown, N., Fiddes, J., Hutchinson, C., Slocombe. P. & Smith, M. (1978). J. Mol. Biol. 125. 225-246. Shenk, T. E., Carbon, J. & Berg, P. (1976). J. I’irol. 18, 664-670. Sherman, L. & Gefter, M. (1976). J. Mol. BioZ. 103, 61-76. Sinden, R. R. & Pettijohn, D. E. (1984). J. BioZ. Chem. 259, 6593-6600. Sinden, R. R., Broyles, S. S. & Pettijohn. D. E. (1983). Proc. Nat. Acad. Sci., U.S.A. 80, 1797-1801. Singelton, C. K. (1983). J. BioZ. Chem. 258, 7661-7668. Tapper, D. P. & DePamphilis, M. L. (1980). Cell, 22, 97-108. Tu, C. & Cohen, S. (1980). Gene, 10, 177-183. Weaver, D. T. & DePamphilis, M. L. (1982). J. BioZ. Chem. 257, 2075-2086. Wells, R. D., Brennan, R., Chapman, K. A., Goodman, T. C., Hart, P. A., Hillen, W., Kellog, D. R.. Kilpatrick, M. W.. Klein. R. D.. Klysik, J., Lambert, P. F., Larson, J. E.. Miglietta, J. J., Neuendorf, S. K., O’Connor, T. R., Singleton, C. K., Stirdivant, S. M., Veneziale, C. M., Wartell, R. M. & Zacharias, W. (1982). Cold Spring Harbor Symp. @ant. BioZ. 47, 77-84.

Edited

by M. Gellert