- Email: [email protected]
The role of store-operated Ca2+ channels in adrenocorticotropin release by rat pituitary cells
Regulatory Peptides 156 (2009) 57–64
Contents lists available at ScienceDirect
Regulatory Peptides j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / r e g p e p
The role of store-operated Ca2+ channels in adrenocorticotropin release by rat pituitary cells Miho Yamashita, Yutaka Oki ⁎, Kazumi Iino, Chiga Hayashi, Kosuke Yogo, Fumie Matsushita, Shigekazu Sasaki, Hirotoshi Nakamura Second Division, Department of Medicine, Hamamatsu University School of Medicine, Hamamatsu, Japan
a r t i c l e
i n f o
Article history: Received 2 November 2008 Received in received form 6 March 2009 Accepted 6 May 2009 Available online 13 May 2009 Keywords: ACTH Store-operated calcium channel Arginine vasopressin CRH
a b s t r a c t In this study, we investigated the role of store-operated Ca2+ channels (SOCC) on ACTH release using microperifusion system. The SOCC blockers, SKF96365 and MRS1845, did not affect the ACTH response to single AVP stimulation. After the depletion of intracellular Ca2+ stores by treating with ionomycin, SOCC blockers reduced the initial spike phase of ACTH response to AVP, which is mediated by inositol 1,4,5-trisphosphate-induced intracellular Ca2+ release from the endoplasmic reticulum (ER). The sustained plateau phase of ACTH response, which is mediated by protein kinase C leading Ca2+ influx via L-type voltage-dependent Ca2+ channels, was not affected. Addition of L-type voltage-dependent Ca2+ channel blocker nimodipine with the SOCC blockers reduced both the initial spike and sustained phases of ACTH response to AVP. Even after ER Ca2+ depletion, the SOCC blockers did not affect the ACTH response to CRH, which is mediated by cAMP-dependent protein kinase A. Transient receptor potential (TRP) C channel is the strongest candidate for SOCC, and RT-PCR revealed that all types of TRPC homologue mRNA were expressed in rat anterior pituitary cells. In conclusion, the SOCC mediates the initial spike phase of ACTH response to AVP, possibly via ER Ca2+ store refilling to induce maximum response. © 2009 Elsevier B.V. All rights reserved.
1. Introduction ACTH release from the anterior pituitary is regulated by hypothalamic factors such as corticotropin-releasing hormone (CRH) and arginine vasopressin (AVP) [1]. CRH, the most important ACTH secretagogue, induces ACTH release by binding to the CRH-1 receptors, inducing activation of adenylyl cyclase and thereby stimulating protein kinase A (PKA) signal transduction [2]. In contrast, AVP, a less potent secretagogue than CRH, induces ACTH release by binding to V1b receptors, subsequently activating phospholipase C-mediated hydrolysis of phosphatidylinositol bisphosphate to produce inositol-1,4,5-trisphosphate (IP3) [3], which mobilizes intracellular calcium stores [4] and diacylglycerol, which activates phospholipids/calcium-dependent protein kinase C [5]. In rat anterior pituitary cells, Ca2+ is known to play important roles in the ACTH release by CRH and AVP. In previous reports, using a microperifusion system, CRH, which produces a monophasic sustained plateau type of ACTH secretory response, requires the extracellular Ca2+ influx via L-type voltage-dependent Ca2+ channels (VDCC) to induce the maximal ACTH release [6]. On the other hand, AVP elicits a biphasic
⁎ Corresponding author. Second Division, Department of Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama Higashi-ku, Hamamatsu, 431-3192, Japan. Tel: +81 53 435 2353; fax: +81 53 435 2354. E-mail address: [email protected] (Y. Oki). 0167-0115/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2009.05.004
ACTH secretory response, consisting of an initial transient spike phase and a subsequent sustained plateau phase. The initial spike phase is mediated by the activation of phospholipase C and the generation of IP3, which mobilizes intracellular Ca2+ from endoplasmic reticulum (ER), whereas the sustained phase depends upon extracellular Ca2+ influx via L-type VDCC which is a result of protein kinase C (PKC) activation [7,8]. Putney established the concept that the depletion of ER Ca2+ activates plasma membrane-localized Ca2+ influx channel known as store-operated Ca2+ channels (SOCC) [9] and Ca2+ release activated calcium (CRAC) current was subsequently identified in T cells [10] using patch-clamp techniques. SOCC is mainly reported on non-excitable cells, but is studied in pituitary clonal cell lines [11], insulin-secreting ß-cells [12] and chromaffin cells [13]. Because ACTH release induced by AVP involves Ca2+ mobilization from the ER, we have investigated the role of SOCC in the ACTH secretory response to AVP from rat anterior pituitary cells. 2. Materials and methods 2.1. Reagents Human/rat CRH (h/r CRH) and AVP were purchased from Peptide Institute Inc. (Osaka, Japan). Other chemicals were purchased from Sigma Chemical Co. (St Louis, MO). MRS1845 (N-propargylnitrendipene), SKF96365, 2-aminoethoxydiphenyl borate (2-APB) and nimodipine
58
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
Table 1 Oligonucleotide primers used for RT-PCR. Target
Sequence
Predicted size
Accession number
Location
rGADPH
GCCAAAAGGGTCATCATCTCCG ACATTGGGGGTAGGAACACGGA CTGCCACAGATGTTACAAGATTTTGGG GGCGAACTTCCACTCTTTATCC CAGTTTCACCCGATTGGCGTAT CTTTGGGGATGGCAGGATGTTA CCTGAGCGAAGTCACACTCCCAC CCACTCTACATCACTGTCATCC GCCTACACCTTTCAATGTCATCCC CTTAGGTTATGTCTCTCGGAGGC CTATGAGACCAGAGCTATTGATG CTACCAGGGAGATGACGTTGTATG GTGCCAAGTCCAAAGTCCCTGC CTGGGCCTGCAGTACGTATC CCTGTACTCCTACTACCGAGGTGC CACCATGGTGACATTATAAACG
376
X02231
402
NM_053558
487
AF136401
529
NM_021771
492
NM_053434
220
AY064411
315
NM_053559
184
XM_225159
411–432 763–784 1507–1533 1882–1908 1606–1627 2071–2092 1269–1291 1776–1797 1962–1985 2431–2453 1954–1976 2151–2174 2296–2317 2591–2610 1815–1838 1974–1996
rTRPC1 rTRPC2 rTRPC3 rTRPC4 rTRPC5 rTRPC6 rTRPC7
were dissolved in dimethylsulfoxide (DMSO). Ionomycin was dissolved in ethanol. 2.2. Animals Experiments were conducted under the guidelines of the Ethical Committee of Animal Experiments of Hamamatsu University School of Medicine. Male Sprague–Dawley rats, weighing 150–250 g, were housed for one week in a temperature controlled (24 °C) room with lights on from 0700 to 1900 h daily. They were given free access to standard rat chow and water. Rats were killed by decapitation in the morning. 2.3. RNA extraction and RT-PCR Rat tissue was quickly frozen in liquid nitrogen. Total RNA was extracted from homogenates of frozen tissue using ISOGEN (Nippon Gene, LTD. Tokyo, Japan) as per manufacturer's instructions. cDNA, made from 1 µg total RNA of each tissue, was used for PCR amplification following the protocol of OneStep RT-PCR kit (QIAGEN, Tokyo, Japan). Primers used for amplification of transient receptor potential (TRP) C and GAPDH gene fragments, which have been reported by others [14,15], are shown in Table 1. For PCR amplification, a 30 min reverse transcript step at 50 °C was followed by 15 min initial PCR activation step at 95 °C. The second amplification cycle protocol included a 0.5 min denaturation step at 94 °C, a 1.0 min annealing step at 54–58 °C and a 1.0 min primer extension step at 72 °C for 28–32 cycles. Amplified products were separated on 1.5% agarose gels in Tris acetated/ EDTA buffer, visualized with 1 µg/ml ethidium bromide. 2.4. Primary cell culture The procedure used in this study has previously been reported [16]. In brief, the pituitary glands were immediately removed after decapitation and placed in HEPES dissociation buffer (137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, 25 mM HEPES, 10 mM glucose and 0.1% BSA, pH 7.3). The neurointermediate lobes were removed and the anterior lobes were cut into pieces. The anterior lobes were placed in 0.1% collagenase (type II, Worthington Biochemical Corp. Freehold, NJ.) dissolved in HEPES dissociation buffer containing 80 µg/dl DNAse (type I, Worthington Biochemical Corp. Freehold, NJ). After 90 min at 37 °C on a gentle moving shaker, the pituitary pieces were washed twice with 10 ml HEPES dissociation buffer and resuspended in 1 ml culture medium. Medium 199 (M199) supplemented with 10 mM HEPES, 10 mM NaHCO3, 0.1% BSA, 100 U/ml penicillin, 100 mg/ml streptomycin and 10% FCS, pH 7.4 was used as culture medium. The pituitary pieces were dispersed mechanically by repeated gentle
aspiration and the cell suspension was filtered through 44-µm nylon net to remove tissue fragments. For static suspension culture for microperifusion experiments, 7 × 105 cells in 0.25 ml M199 culture medium were carefully laid on top of 40 ml preswollen Sephadex G-10 resin (Amersham Bioscience AB, Uppsala, Sweden) in culture medium in individual wells of 48-well tissue culture dishes. Cells were cultured for 3 days in a humidified CO2 incubator at 37 °C without changing the medium. 2.5. Microperifusion The microperifusion system and its operation have been described previously [16]. The cells were mixed with 40 µl Sephadex G-10 resin and gently agitated and loaded into a 50 µl microperifusion chamber. The remaining dead space above the cell-resin bed was filled with preswollen Sephadex G-10 resin. Before the experiments were started, the cells were preperifused with perifusion medium (serum-free culture medium) for 120 min. Each chamber was perifused at a flow rate of 100 µl/min. One minute (100 µl) effluent fractions were collected in tubes and stored at −20 °C until the time of radioimmunoassay (RIA). Each experiment was repeated six times. 2.6. RIA ACTH RIA was performed using rabbit antiserum against ACTH1–24. The characteristics of the assay have been reported [17]. The minimum detection limit of the assay was 1 pg/tube. 2.7. Statistical analyses The results are expressed as the mean± SEM. Statistical analysis was performed by one-way analysis of variance (ANOVA) followed by Scheffe's multiple range test or Student's two-tailed unpaired t-test as appropriate. p b 0.05 was considered significant. Mean basal ACTH secretion in each experiment was determined in 5 consecutive fractions, which were collected immediately before stimulation with each secretagogue. The response to each agent was calculated as the integrated area under the curve above basal secretion. The total response to AVP was defined as the area under the curve during the full 10 min stimulation; the spike phase of the response to AVP was defined as the initial 3 min and the sustained phase as the remaining 7 min of stimulation as previously reported [7]. The response to CRH was defined as the area under the curve during the full 10 min stimulation. 3. Results 3.1. Effects of SOCC blockers on the ACTH response to AVP Cells were preperifused with perifusion medium alone for 120 min, then perifused with SOCC blocker (50 µM SKF96365, 10 µM MRS1845 or 10 µM 2-APB) or vehicle alone for 15 min before exposure to 100 nM AVP as indicated in Fig. 1. SKF96365 did not affect either the initial spike phase (261.2± 28.5 vs. 229.2 ± 45.8 pg/3 min, p N 0.05) or the sustained plateau phase (201.7 ± 59.5 vs. 256.6 ± 26.2 pg/7 min, p N 0.05) of the ACTH response to single AVP stimulation (Fig.1A). MRS1845 also did not affect either phase (183.6 ± 12.9 vs. 210.5 ± 12.0 pg/3 min for spike phase, p N 0.05; 191.8± 30.6 vs. 177.7 ± 20.1 pg/7 min for sustained phase, p N 0.05; Fig. 1B). 2-APB reduced the initial spike phase of the ACTH secretory response to AVP by 41.3% (118.7± 9.7 vs. 202.3 ± 21.0 pg/3 min, p b 0.05), but did not affect the sustained plateau phase (160.5 ± 40.9 vs. 160.5 ± 40.9 pg/7 min, p N 0.05; Fig. 1C). 3.2. Effects of ionomycin pretreatment on the ACTH response to AVP After 120 min preperifusion with perifusion medium alone, the cells were perifused with perifusion medium containing 2 µM
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
59
Fig. 1. Effect of SOCC blocker on the ACTH secretory response to AVP. Each identical chamber for each test substance was loaded with 7 × 105 rat anterior pituitary cells (cultured for 4 days). The cells were preperifused with serum-free medium 199 for 120 min, then perifused with medium containing 10 µM MRS1845 (A) or 50 µM SKF96365 (B) or 10 µM 2-APB (C) or vehicle alone from 15 min prior to and during 10 min 100 nM AVP addition. Each circle represents the means (n = 6/group), bracket indicates the SEM. Open circle, cells perifused with vehicle; close circle, cells perifused with reagent. Each column represents the mean of determinations of the integrated area under the curve above basal secretion, bracket indicates the SEM. Total indicates the area under the curve during the full 10 min stimulation, spike indicates the area under the curve of initial 3 min of stimulation, sustained indicates the area under the curve of remaining 7 min of stimulation. Open columns represent cells perifused with vehicle; solid columns represent cells perifused with SOCC. Statistical analysis was performed by Student's two-tailed unpaired t-test. MRS1845 and SKF96365 did not affect the ACTH response to AVP, whereas 2-APB inhibited the spike phase of ACTH response. †, p b 0.05 compared with vehicle alone. 2-APB; 2-aminoethoxydiphenyl borate.
ionomycin or vehicle alone for 10 min. After returning to reagent-free perifusion medium for 60 min, the cells were exposed to AVP for 10 min as indicated in Fig. 2. The pretreatment with ionomycin had no
influence on the ACTH response to AVP (241.6 ± 42.0 vs. 223.2 ± 44.6 pg/3 min for spike phase, p N 0.05; 196.1 ± 24.8 vs. 208.1 ± 27.2 pg/7 min for sustained phase, p N 0.05; Fig. 2).
60
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
Fig. 2. Effect of 2 µM ionomycin pretreatment in the ACTH response to 100 nM AVP. The cells were preperifused with serum-free medium for 120 min, and then the medium containing 2 µM ionomycin or vehicle was perifused for 10 min. After another 60 min perifusion with reagent-free medium, 100 nM AVP was perifused for 10 min. Each circle represents the means (n = 6/group), bracket indicate the SEM. Open circle, cells perifused with vehicle; close circle, cells perifused with reagent. Each column represents the mean of determinations of the integrated area under the curve above basal secretion, bracket indicates the SEM. Open columns represent cells perifused with vehicle; solid columns represent cells perifused with ionomycin. Statistical analysis was performed by Student's two-tailed unpaired t-test. Pretreatment by ionomycin 1 h ahead of stimulation by AVP did not affect the ACTH response. Iono; ionomycin.
3.3. Effects of SOCC blockers on the ACTH response to AVP after ionomycin treatment After 120 min preperifusion with perifusion medium alone, the cells were perifused with medium containing 50 µM SKF96365, 10 µM
MRS1845 or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After returning to the medium containing each SOCC blocker without ionomycin for another 60 min, the cells were exposed to 100 nM AVP for 10 min as indicated in Fig. 3. SKF96365 reduced the initial spike phase of the ACTH secretory
Fig. 3. Effect of SOCC blockers on the ACTH response to AVP after pretreatment with ionomycin. After 120 min preperifusion, the cells were perifused with medium containing 50 µM SKF96365 (A), or 10 µM MRS1845 (B), or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After another 60 min perifusion with medium containing each reagent, 100 nM AVP was perifused for 10 min following addition to medium. Each circle represents the mean (n = 6/group), bracket indicates the SEM. Open circle, cells perifused with vehicle; closed circle, cells perifused with reagent. Each column represents the mean of area under the curve above basal secretion, bracket indicates the SEM. Open columns represent cells perifused with vehicle; solid columns represent cells perifused with reagents. Statistical analysis was performed by Student's two-tailed unpaired t-test. SOCC blockers reduced the initial spike phase of the ACTH response to AVP. †, p b 0.05 compared with vehicle alone. Iono; ionomycin.
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
61
Fig. 4. Effect of SOCC blockers with L-type VDCC blocker on the ACTH response to AVP after pretreatment with ionomycin. After 120 min preperifusion, the cells were perifused with medium containing either 10 µM MRS1845 or 10 µM MRS1845 with 1 µM nimodipine or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After another 60 min perifusion with medium containing each reagent, 100 nM AVP was perifused for 10 min following addition to medium. Each mark represents the means (n = 6/group), bracket indicates the SEM. Open circle, cells perifused with vehicle; closed circle, cells perifused with 10 µM MRS1845; closed triangle, cells perifused with 10 µM MRS1845 and 1 µM nimodipine. Each column represents the mean of area under the curve above basal secretion, bracket indicates the SEM. Open columns represent cells perifused with vehicle, solid columns represent cells perifused with 10 µM MRS1845, hatched columns represent cells perifused with 10 µM MRS1845 and 1 µM nimodipine. Statistical analysis was performed by one-way ANOVA followed by Scheffe's multiple range test. Addition of L-type VDCC blocker reduced both the initial spike phase and sustained plateau phase of the ACTH response to AVP significantly. †, p b 0.05 compared with vehicle alone. *, p b 0.05 compared with 10 µM MRS1845. Iono; ionomycin.
Fig. 5. Effect of SOCC blockers on the ACTH response to CRH after pretreatment with ionomycin. After 120 min preperifusion, the cells were perifused with medium containing 50 µM SKF96365 (A) or 10 µM MRS1845 (B) or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After another 60 min perifusion with medium containing each reagent, 1 nM CRH was perifused for 10 min addition to medium. Each circle represents the means (n = 6/group), bracket indicates the SEM. Open circle, cells perifused with vehicle; closed circle, cells perifused with reagent. Each column represents the mean of area under the curve above basal secretion, bracket indicates the SEM. Open columns represent cells perifused with vehicle; solid columns represent cells perifused with reagents. Statistical analysis was performed by Student's two-tailed unpaired t-test. SOCC blockers did not affect the ACTH response to CRH. Iono; ionomycin.
62
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
response to AVP by 45.6% (87.0 ± 14.8 vs. 160.0 ± 25.8 pg/3 min, p b 0.05), but did not affect the sustained plateau phase (103.0 ± 22.4 vs. 144.2 ± 25.8 pg/7 min, p N 0.05; Fig. 3A). MRS1845 also reduced the initial spike phase by 38.7% (81.1 ± 11.5 vs. 132.2 ± 11.9 pg/3 min, p b 0.05), but did not affect the sustained plateau phase (80.0 ± 10.4 vs. 92.1 ± 17.0 pg/7 min p N 0.05; Fig. 3B).
3.6. TRPCs gene expression in rat anterior pituitary
3.4. Effects of SOCC blockers with L-type VDCC blocker on the ACTH response to AVP after ER depletion
4. Discussion
After 120 min preperifusion with perifusion medium alone, the cells were perifused with medium containing either 10 µM MRS1845 or the combination of 10 µM MRS1845 plus 1 µM nimodipine, an L-type VDCC blocker, or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After returning to medium containing each SOCC blocker without ionomycin for another 60 min, the cells were exposed to 100 nM AVP for 10 min as indicated in Fig. 4. The addition of L-type VDCC blocker with SOCC blocker reduced both the initial spike phase of ACTH release by 64.0% compared to the vehicle (86.3±4.6 vs. 240.3±15.7 pg/ 3 min, pb 0.05) and sustained plateau phase by 73% (69.7±7.5 vs. 258.8± 29.1 pg/7 min, pb 0.05). Compared to the MRS1845 alone, addition of nimodipine reduced the initial spike phase by 42.0% (86.3±4.6 vs.148.9± 13.6 pg/3 min, pb 0.05) and the sustained plateau phase by 61.0% (69.7± 7.5 vs. 179.1±30.2 pg/7 min, pb 0.05; Fig. 4).
3.5. Effects of SOCC blockers on the ACTH response to CRH after ER depletion After 120 min preperifusion with perifusion medium alone, the cells were perifused with medium containing SOCC blocker, 50 µM SKF96365 or 10 µM MRS1845 or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After another 60 min perifusion with medium containing each SOCC blocker, the cells were exposed to 1 nM CRH for 10 min as indicated in Fig. 5. Neither SKF96365 (952.6 ± 84.0 vs. 895.1 ± 68.8 pg/10 min, p N 0.05) nor 10 µM MRS1845 (744.1 ± 30.7 vs. 766.4 ± 31.6 pg/10 min, p N 0.05) affected the ACTH response to CRH (Fig. 5).
Fig. 6. Expression of TRPC channel mRNA in rat tissue. 1 µg of total RNA was used for RTPCR. Amplified products were separated on agarose gels and stained with ethidium bromide. Bars on the left indicate the size of the transcripts (base pairs, bp). Anterior pituitary cells contained mRNA transcripts of all seven subunits. La: ladder, B: brain, Lu: lung, H: heart, K: kidney, T: testis, P: pituitary.
To investigate the expression of TRPC homologues, which are suggested as candidate genes of SOCC, in the rat anterior pituitary, RTPCR was performed. The rat anterior pituitary showed the transcription of all TRPC homologues, which displayed a pattern similar to the brain (Fig. 6).
Exocytosis is a Ca2+-regulated process involving an increased intracellular calcium concentration and subsequent channel opening. Intracellular Ca2+ stores contribute significantly to Ca2+ signaling in rat corticotrophs [8,18]. AVP has been shown to trigger a transient and plateau pattern of Ca2+ signaling in rat corticotrophs, which can be mimicked by IP3, inducing the intracellular Ca2+ release from the ER. Ca2+ can also be released from the ER with Ca2+ ionophores, such as ionomycin or A23187. In previous reports, AVP, oxytocin, and angiotensin II all activated the IP3/diacylglycerol/PKC pathway to elicit an initial spike phase of ACTH release. The acute depletion of ER Ca2+ stores by ionomycin diminishes the spike phase of this response in microperifusion [8]. These findings indicate that the ER Ca2+ store is essential for ACTH response to AVP. Interestingly, the patterns of ACTH response to AVP and CRH are quite similar to those of intracellular Ca2+ concentration in response to corresponding secretagogues [19]. Therefore, the ACTH secretory pattern in response to the secretagogues reflects the intracellular Ca2+ concentration in a microperifusion system. Although the concentration (100 nM) of AVP used in this study was greater than the physiological dose, it was necessary to demonstrate both the spike and sustained ACTH responses to AVP [20]. The stimulation of the cell surface receptors, which activate phospholipase C leading to Ca2+ release through IP3 or ryanodine receptors in the ER, activates SOCC in the plasma membrane. In this study, the ACTH response to the first AVP challenge was not affected by SKF96365 or MRS 1845. This supports the major idea of Ca2+ entry through SOCC, which is widely believed to refill Ca2+ into the ER. SKF96365 is one of the novel reagents known to inhibit SOCC, but also inhibits other channels such as L-type VDCC over similar concentration ranges [21]. MRS1845 is a more selective SOCC blocker [22]. Both SOCC blockers did not inhibit either the sustained plateau phase of ACTH response to AVP or the ACTH response to CRH. This demonstrated that these two reagents did not block L-type VDCC because both responses are dependent on L-type VDCC. 2-APB has been originally known as an IP3 receptor antagonist, but recently has proven to be most useful in manipulating SOC entry [23]. The inhibitory effect of 2-APB on IP3 receptors is controversial depending on cell types. In this study, 2-APB inhibited the spike phase of the ACTH response to the first AVP challenge, indicating that 2-APB inhibited the IP3 receptor. Therefore, 2-APB was not suitable for the evaluation of Ca2+ refilling into the ER through SOCC in our system. SOCC can be activated by any conditions that empty the Ca2+ store. These conditions include 1) elevation of intracellular IP3, 2) application of a Ca2+ ionophore to permeabilize the ER membrane, 3) dialyzing the cytoplasm with high concentrations of the Ca2+ chelators such as EGTA or BAPTA, 4) exposure to the sarcoplasmic/ endoplasmic reticulum Ca2+-ATPase (SERCA) inhibitors like thapsigargin, 5) sensitizing the IP3 receptor to resting levels of IP3 with agent like thimerosal and 6) loading membrane-permeable metal Ca2+ chelators like N,-N,-N′,-N′-tetrakis(2-pyridylmethyl)ethylenediamine directly into the store [24]. Because our preliminary study showed that the ACTH responses to repeated AVP stimulations were not altered by SOCC blockers (data not shown), we considered the possibility that the Ca2+ depletion of ER by AVP was not enough to distinctly show the effect of SOCC. It is well known that thapsigargin (Tg) is quite useful as an activator of SOCC through Ca2+ depletion of ER. However, it is difficult to observe the recovery of the Ca2+ pool in Tg-pre-treated
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
cells even after 24 h of the incubation with Tg-free medium [25]. For this reason, we thought that Tg was not suitable for our experiments. Ionomycin is one of the SOCC activators and has been reported to induce CRAC current [26,27]. Pretreatment with ionomycin did not affect the AVP response, revealing that the effect of ionomycin was cleared off within 60 min and the ER Ca2+ might be refilled. The SOCC blocker partially reduced the initial spike phase of the ACTH response to AVP after Ca2+ depletion with ionomycin, suggesting that the refilling of the ER Ca2+ store is partially mediated by SOCC. The mechanism of store refilling is not fully understood. It was first thought that the store-operated Ca2+ entry occurred because extracellular Ca2+ passed directly into the intracellular stores [9]. However, subsequent works demonstrated that extracellular Ca2+ passed first into the cytosol and then was pumped into the store by SERCA [28]. Stromal interacting molecule protein (STIM1), the ER resident Ca2+ binding protein regulating SOCC, was recently identified and may enlighten the mechanism of SOCC [29,30]. Upon Ca2+ store depletion, STIM1 migrates from a relatively homogeneous distribution throughout the ER to discrete puncta below the plasma membrane [31,32]. This puncta forms in subregions of junctional ER located 20 nm from the plasma membrane [32], causing the local activation of CRAC entry at individual junctions. By concentrating Ca2+ influx near SERCA pumps, it optimizes the efficiency of store refilling, explaining why, in certain systems, the store can reload with extracellular Ca2+ without a detectable rise in the cytosol. The SOCC blocker did not affect the ACTH response to CRH even after ionomycin treatment, indicating that the CRH-induced signal cascade does not require the activation of SOCC. The ACTH response to CRH is mediated mainly by L-type VDCC [33], supporting our result. This study also showed that the SKF96365 and MRS1845 did not display their ability as L-type VDCC blockers in our study. The combination of L-type VDCC blocker and SOCC blocker showed the additive effect on the reduction of the AVP-induced ACTH response. In previous reports, nimodipine, a potent L-type VDCC blocker, reduced both phases of the response to AVP, indicating that the extracellular Ca2+ enters mainly through L-type VDCC during AVP stimulation [6]. Because the concentration of nimodipine is high enough to block L-type VDCC, the additional inhibition by the combination of both blockers indicates that the effect of the SOCC blocker is not via L-type VDCC in normal pituitary cells. Molecular candidates for the SOCC may be emerging from the discovery of the Drosophila TRP channels and seven canonical mammalian TRP homologues [34]. TRPC channels are non-selective, Ca2+ permeable cation channels that are activated by the stimulation of G protein-coupled and tyrosine phosphorylated receptors. TRPC channels become a strong candidate for SOCC. Our study showed that the pituitary expressed all types of homologues, which is similar to the expression in the brain. With few exceptions, the TRPC channels are broadly expressed, and given cell type, generally contain multiple TRPCs [35]. Although there is still some controversy over which subtypes of the TRPC channels function as SOCC, the most predominant homologue for SOCC is currently TRPC1. Treatment with antisense oligonucleotide, which inhibits transcription of the endogenous TRPC1 and TRPC3 specifically reducing Ca2+ influx, and STIM1 are reported to regulate the TRPC1 channel activity [36]. These findings support the consideration that TRPC1 may be SOCC, but further investigation is necessary. The functions of the various homologues are unknown, but it can be speculated that they give the diversity in SOCC properties. Even when both L-type VDCC blocker and SOCC blocker were added simultaneously, the initial spike phase of ACTH release in response to AVP was not completely abolished. If the spike response of ACTH to AVP is fully dependent on ER Ca2+ store, ER should be partially refilled with Ca2+. One possibility is that the refilling from the cytosol is ongoing, because we could not inhibit the function of SERCA completely. There is also another possibility that the other mechanisms, which can refill the ER storage with Ca2+, exist. One
63
possible mechanism is a Na+–Ca2+ exchanger, which is expressed in the plasma membrane and also in ER of neurons and other excitable cells [37,38]. Na+–Ca2+ exchangers have been reported to modulate ER Ca2+ concentration in osteoblasts [39]. In conclusion, the refilling of Ca2+ into ER through SOCC is required for the maximum ACTH response to AVP but not CRH in rat pituitary cells. Acknowledgements This study was supported, in part, by a grant in Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology. References [1] Vale W, Vaughan J, Smith M, Yamamoto G, Rivier J, Rivier C. Effects of synthetic ovine corticotropin-releasing factor, glucocorticoids, catecholamines, neurohypophysial peptides, and other substances on cultured corticotropic cells. Endocrinology 1983;113:1121–31. [2] Labrie F, Veilleux R, Lefevre G, Coy DH, Sueiras-Diaz J, Schally AV. Corticotropinreleasing factor stimulates accumulation of adenosine 3', 5'-monophosphate in rat pituitary corticotrophs. Science 1982;216:1007–8. [3] Bilezikjian LM, Blount AL, Vale WW. The cellular actions of vasopressin on corticotrophs of the anterior pituitary: resistance to glucocorticoid action. Mol Endocrinol 1987;1:451–8. [4] Berridge MJ, Irvine RF. Inositol trisphosphate, a novel second messenger in cellular signal transduction. Nature 1984;312:315–21. [5] Nishizuka Y. The role of protein kinase C in cell surface signal transduction and tumour promotion. Nature 1984;308:693–8. [6] Won JG, Oki Y, Orth DN. Roles of intracellular and extracellular calcium in the kinetic profile of adrenocorticotropin secretion by perifused rat anterior pituitary cells. II. Arginine vasopressin, oxytocin, and angiotensin-II stimulation. Endocrinology 1990;126:858–68. [7] Oki Y, Nicholson WE, Orth DN. Role of protein kinase-C in the adrenocorticotropin secretory response to arginine vasopressin (AVP) and the synergistic response to AVP and corticotropin-releasing factor by perifused rat anterior pituitary cells. Endocrinology 1990;127:350–7. [8] Oki Y, Peatman TW, Qu ZC, Orth DN. Effects of intracellular Ca2+ depletion and glucocorticoid on stimulated adrenocorticotropin release by rat anterior pituitary cells in a microperifusion system. Endocrinology 1991;128:1589–96. [9] Putney Jr JW. A model for receptor-regulated calcium entry. Cell Calcium 1986;7:1–12. [10] Lewis RS, Cahalan MD. Mitogen-induced oscillations of cytosolic Ca2+ and transmembrane Ca2+ current in human leukemic T cells. Cell Regul 1989;1:99–112. [11] Secondo A, Taglialatela M, Cataldi M, Giorgio G, Valore M, Di Renzo G, et al. Pharmacological blockade of ERG K+ channels and Ca2+ influx through storeoperated channels exerts opposite effects on intracellular Ca2+ oscillations in pituitary GH3 cells. Mol Pharmacol 2000;58:1115–28. [12] Thore S, Dyachok O, Gylfe E, Tengholm A. Feedback activation of phospholipase C via intracellular mobilization and store-operated influx of Ca2+ in insulinsecreting beta-cells. J Cell Sci 2005;118:4463–71. [13] Fomina AF, Nowycky MC. A current activated on depletion of intracellular Ca2+ stores can regulate exocytosis in adrenal chromaffin cells. J Neurosci 1999;19:3711–22. [14] Bergdahl A, Gomez MF, Wihlborg AK, Erlinge D, Eyjolfson A, Xu SZ, et al. Plasticity of TRPC expression in arterial smooth muscle: correlation with store-operated Ca2+ entry. Am J Physiol Cell Physiol 2005;288:C872–80. [15] Wu X, Zagranichnaya TK, Gurda GT, Eves EM, Villereal ML. A TRPC1/TRPC3mediated increase in store-operated calcium entry is required for differentiation of H19-7 hippocampal neuronal cells. J Biol Chem 2004;279:43392–402. [16] Halili-Manabat C, Oki Y, Iino K, Iwabuchi M, Morita H, Yoshimi T. The role of sodium in mediating adrenocorticotropin secretion by perifused rat anterior pituitary cells. Endocrinology 1995;136:2937–42. [17] Tominaga T, Oki Y, Tanaka I, Ikeda Y, Nanno M, Yoshimi T. Effect of sodium valproate on the secretion of proopiomelanocortin derived peptides from cultured rat anterior pituitary cells. Endocrinol Jpn 1989;36:809–15. [18] Tse A, Lee AK. Arginine vasopressin triggers intracellular calcium release, a calcium-activated potassium current and exocytosis in identified rat corticotropes. Endocrinology 1998;139:2246–52. [19] Leong DA. A complex mechanism of facilitation in pituitary ACTH cells: recent single-cell studies. J Exp Biol 1988;139:151–68. [20] Watanabe T, Orth DN. Detailed kinetic analysis of adrenocorticotropin secretion by dispersed rat anterior pituitary cells in a microperifusion system: effects of ovine corticotropin-releasing factor and arginine vasopressin. Endocrinology 1987;121:1133–45. [21] Merritt JE, Armstrong WP, Benham CD, Hallam TJ, Jacob R, Jaxa-Chamiec A, et al. SK&F 96365, a novel inhibitor of receptor-mediated calcium entry. Biochem J 1990;271:515–22. [22] Harper JL, Camerini-Otero CS, Li AH, Kim SA, Jacobson KA, Daly JW. Dihydropyridines as inhibitors of capacitative calcium entry in leukemic HL-60 cells. Biochem Pharmacol 2003;65:329–38.
64
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
[23] Bootman MD, Collins TJ, Mackenzie L, Roderick HL, Berridge MJ. Peppiatt CM. 2-aminoethoxydiphenyl borate (2-APB) is a reliable blocker of store-operated Ca2+ entry but an inconsistent inhibitor of InsP3-induced Ca2+ release. FASEB J 2002;16:1145–50. [24] Parekh AB, Putney Jr JW. Store-operated calcium channels. Physiol Rev 2005;85:757–810. [25] Short AD, Bian J, Ghosh TK, Waldron RT, Rybak SL, Gill DL. Intracellular Ca2+ pool content is linked to control of cell growth. Proc Natl Acad Sci U S A 1993;90:4986–90. [26] Alonso-Torre SR, Alvarez J, Montero M, Sanchez A, Garcia-Sancho J. Control of Ca2+ entry into HL60 and U937 human leukaemia cells by the filling state of the intracellular Ca2+ stores. Biochem J 1993;289(Pt 3):761–6. [27] Hsu S, O'Connell PJ, Klyachko VA, Badminton MN, Thomson AW, Jackson MB, et al. Fundamental Ca2+ signaling mechanisms in mouse dendritic cells: CRAC is the major Ca2+ entry pathway. J Immunol 2001;166:6126–33. [28] Montero M, Alonso-Torre SR, Alvarez J, Sanchez A, Garcia-Sancho J. The pathway for refilling intracellular Ca2+ stores passes through the cytosol in human leukaemia cells. Pflugers Arch 1993;424:465–9. [29] Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell Jr JE, et al. STIM is a Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx. Curr Biol 2005;15:1235–41. [30] Zhang SL, Yu Y, Roos J, Kozak JA, Deerinck TJ, Ellisman MH, et al. STIM1 is a Ca2+ sensor that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane. Nature 2005;437:902–5.
[31] Luik RM, Wu MM, Buchanan J, Lewis RS. The elementary unit of store-operated Ca2+ entry: local activation of CRAC channels by STIM1 at ER-plasma membrane junctions. J Cell Biol 2006;174:815–25. [32] Wu MM, Buchanan J, Luik RM, Lewis RS. Ca2+ store depletion causes STIM1 to accumulate in ER regions closely associated with the plasma membrane. J Cell Biol 2006;174:803–13. [33] Kuryshev YA, Childs GV, Ritchie AK. Corticotropin-releasing hormone stimulates Ca2+ entry through L- and P-type Ca2+ channels in rat corticotropes. Endocrinology 1996;137:2269–77. [34] Pedersen SF, Owsianik G, Nilius B. TRP channels: an overview. Cell Calcium 2005;38:233–52. [35] Montell C, Birnbaumer L, Flockerzi V. The TRP channels, a remarkably functional family. Cell 2002;108:595–8. [36] Worley PF, Zeng W, Huang GN, Yuan JP, Kim JY, Lee MG, et al. TRPC channels as STIM1-regulated store-operated channels. Cell Calcium 2007;42:205–11. [37] DiPolo R, Beauge L. Sodium/calcium exchanger: influence of metabolic regulation on ion carrier interactions. Physiol Rev 2006;86:155–203. [38] Kiedrowski L, Brooker G, Costa E, Wroblewski JT. Glutamate impairs neuronal calcium extrusion while reducing sodium gradient. Neuron 1994;12:295–300. [39] Jung SY, Park YJ, Park YJ, Cha SH, Lee MZ, Suh CK. Na+–Ca2+ exchanger modulates Ca2+ content in intracellular Ca2+ stores in rat osteoblasts. Exp Mol Med 2007;39:458–68.
Contents lists available at ScienceDirect
Regulatory Peptides j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / r e g p e p
The role of store-operated Ca2+ channels in adrenocorticotropin release by rat pituitary cells Miho Yamashita, Yutaka Oki ⁎, Kazumi Iino, Chiga Hayashi, Kosuke Yogo, Fumie Matsushita, Shigekazu Sasaki, Hirotoshi Nakamura Second Division, Department of Medicine, Hamamatsu University School of Medicine, Hamamatsu, Japan
a r t i c l e
i n f o
Article history: Received 2 November 2008 Received in received form 6 March 2009 Accepted 6 May 2009 Available online 13 May 2009 Keywords: ACTH Store-operated calcium channel Arginine vasopressin CRH
a b s t r a c t In this study, we investigated the role of store-operated Ca2+ channels (SOCC) on ACTH release using microperifusion system. The SOCC blockers, SKF96365 and MRS1845, did not affect the ACTH response to single AVP stimulation. After the depletion of intracellular Ca2+ stores by treating with ionomycin, SOCC blockers reduced the initial spike phase of ACTH response to AVP, which is mediated by inositol 1,4,5-trisphosphate-induced intracellular Ca2+ release from the endoplasmic reticulum (ER). The sustained plateau phase of ACTH response, which is mediated by protein kinase C leading Ca2+ influx via L-type voltage-dependent Ca2+ channels, was not affected. Addition of L-type voltage-dependent Ca2+ channel blocker nimodipine with the SOCC blockers reduced both the initial spike and sustained phases of ACTH response to AVP. Even after ER Ca2+ depletion, the SOCC blockers did not affect the ACTH response to CRH, which is mediated by cAMP-dependent protein kinase A. Transient receptor potential (TRP) C channel is the strongest candidate for SOCC, and RT-PCR revealed that all types of TRPC homologue mRNA were expressed in rat anterior pituitary cells. In conclusion, the SOCC mediates the initial spike phase of ACTH response to AVP, possibly via ER Ca2+ store refilling to induce maximum response. © 2009 Elsevier B.V. All rights reserved.
1. Introduction ACTH release from the anterior pituitary is regulated by hypothalamic factors such as corticotropin-releasing hormone (CRH) and arginine vasopressin (AVP) [1]. CRH, the most important ACTH secretagogue, induces ACTH release by binding to the CRH-1 receptors, inducing activation of adenylyl cyclase and thereby stimulating protein kinase A (PKA) signal transduction [2]. In contrast, AVP, a less potent secretagogue than CRH, induces ACTH release by binding to V1b receptors, subsequently activating phospholipase C-mediated hydrolysis of phosphatidylinositol bisphosphate to produce inositol-1,4,5-trisphosphate (IP3) [3], which mobilizes intracellular calcium stores [4] and diacylglycerol, which activates phospholipids/calcium-dependent protein kinase C [5]. In rat anterior pituitary cells, Ca2+ is known to play important roles in the ACTH release by CRH and AVP. In previous reports, using a microperifusion system, CRH, which produces a monophasic sustained plateau type of ACTH secretory response, requires the extracellular Ca2+ influx via L-type voltage-dependent Ca2+ channels (VDCC) to induce the maximal ACTH release [6]. On the other hand, AVP elicits a biphasic
⁎ Corresponding author. Second Division, Department of Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama Higashi-ku, Hamamatsu, 431-3192, Japan. Tel: +81 53 435 2353; fax: +81 53 435 2354. E-mail address: [email protected] (Y. Oki). 0167-0115/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2009.05.004
ACTH secretory response, consisting of an initial transient spike phase and a subsequent sustained plateau phase. The initial spike phase is mediated by the activation of phospholipase C and the generation of IP3, which mobilizes intracellular Ca2+ from endoplasmic reticulum (ER), whereas the sustained phase depends upon extracellular Ca2+ influx via L-type VDCC which is a result of protein kinase C (PKC) activation [7,8]. Putney established the concept that the depletion of ER Ca2+ activates plasma membrane-localized Ca2+ influx channel known as store-operated Ca2+ channels (SOCC) [9] and Ca2+ release activated calcium (CRAC) current was subsequently identified in T cells [10] using patch-clamp techniques. SOCC is mainly reported on non-excitable cells, but is studied in pituitary clonal cell lines [11], insulin-secreting ß-cells [12] and chromaffin cells [13]. Because ACTH release induced by AVP involves Ca2+ mobilization from the ER, we have investigated the role of SOCC in the ACTH secretory response to AVP from rat anterior pituitary cells. 2. Materials and methods 2.1. Reagents Human/rat CRH (h/r CRH) and AVP were purchased from Peptide Institute Inc. (Osaka, Japan). Other chemicals were purchased from Sigma Chemical Co. (St Louis, MO). MRS1845 (N-propargylnitrendipene), SKF96365, 2-aminoethoxydiphenyl borate (2-APB) and nimodipine
58
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
Table 1 Oligonucleotide primers used for RT-PCR. Target
Sequence
Predicted size
Accession number
Location
rGADPH
GCCAAAAGGGTCATCATCTCCG ACATTGGGGGTAGGAACACGGA CTGCCACAGATGTTACAAGATTTTGGG GGCGAACTTCCACTCTTTATCC CAGTTTCACCCGATTGGCGTAT CTTTGGGGATGGCAGGATGTTA CCTGAGCGAAGTCACACTCCCAC CCACTCTACATCACTGTCATCC GCCTACACCTTTCAATGTCATCCC CTTAGGTTATGTCTCTCGGAGGC CTATGAGACCAGAGCTATTGATG CTACCAGGGAGATGACGTTGTATG GTGCCAAGTCCAAAGTCCCTGC CTGGGCCTGCAGTACGTATC CCTGTACTCCTACTACCGAGGTGC CACCATGGTGACATTATAAACG
376
X02231
402
NM_053558
487
AF136401
529
NM_021771
492
NM_053434
220
AY064411
315
NM_053559
184
XM_225159
411–432 763–784 1507–1533 1882–1908 1606–1627 2071–2092 1269–1291 1776–1797 1962–1985 2431–2453 1954–1976 2151–2174 2296–2317 2591–2610 1815–1838 1974–1996
rTRPC1 rTRPC2 rTRPC3 rTRPC4 rTRPC5 rTRPC6 rTRPC7
were dissolved in dimethylsulfoxide (DMSO). Ionomycin was dissolved in ethanol. 2.2. Animals Experiments were conducted under the guidelines of the Ethical Committee of Animal Experiments of Hamamatsu University School of Medicine. Male Sprague–Dawley rats, weighing 150–250 g, were housed for one week in a temperature controlled (24 °C) room with lights on from 0700 to 1900 h daily. They were given free access to standard rat chow and water. Rats were killed by decapitation in the morning. 2.3. RNA extraction and RT-PCR Rat tissue was quickly frozen in liquid nitrogen. Total RNA was extracted from homogenates of frozen tissue using ISOGEN (Nippon Gene, LTD. Tokyo, Japan) as per manufacturer's instructions. cDNA, made from 1 µg total RNA of each tissue, was used for PCR amplification following the protocol of OneStep RT-PCR kit (QIAGEN, Tokyo, Japan). Primers used for amplification of transient receptor potential (TRP) C and GAPDH gene fragments, which have been reported by others [14,15], are shown in Table 1. For PCR amplification, a 30 min reverse transcript step at 50 °C was followed by 15 min initial PCR activation step at 95 °C. The second amplification cycle protocol included a 0.5 min denaturation step at 94 °C, a 1.0 min annealing step at 54–58 °C and a 1.0 min primer extension step at 72 °C for 28–32 cycles. Amplified products were separated on 1.5% agarose gels in Tris acetated/ EDTA buffer, visualized with 1 µg/ml ethidium bromide. 2.4. Primary cell culture The procedure used in this study has previously been reported [16]. In brief, the pituitary glands were immediately removed after decapitation and placed in HEPES dissociation buffer (137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, 25 mM HEPES, 10 mM glucose and 0.1% BSA, pH 7.3). The neurointermediate lobes were removed and the anterior lobes were cut into pieces. The anterior lobes were placed in 0.1% collagenase (type II, Worthington Biochemical Corp. Freehold, NJ.) dissolved in HEPES dissociation buffer containing 80 µg/dl DNAse (type I, Worthington Biochemical Corp. Freehold, NJ). After 90 min at 37 °C on a gentle moving shaker, the pituitary pieces were washed twice with 10 ml HEPES dissociation buffer and resuspended in 1 ml culture medium. Medium 199 (M199) supplemented with 10 mM HEPES, 10 mM NaHCO3, 0.1% BSA, 100 U/ml penicillin, 100 mg/ml streptomycin and 10% FCS, pH 7.4 was used as culture medium. The pituitary pieces were dispersed mechanically by repeated gentle
aspiration and the cell suspension was filtered through 44-µm nylon net to remove tissue fragments. For static suspension culture for microperifusion experiments, 7 × 105 cells in 0.25 ml M199 culture medium were carefully laid on top of 40 ml preswollen Sephadex G-10 resin (Amersham Bioscience AB, Uppsala, Sweden) in culture medium in individual wells of 48-well tissue culture dishes. Cells were cultured for 3 days in a humidified CO2 incubator at 37 °C without changing the medium. 2.5. Microperifusion The microperifusion system and its operation have been described previously [16]. The cells were mixed with 40 µl Sephadex G-10 resin and gently agitated and loaded into a 50 µl microperifusion chamber. The remaining dead space above the cell-resin bed was filled with preswollen Sephadex G-10 resin. Before the experiments were started, the cells were preperifused with perifusion medium (serum-free culture medium) for 120 min. Each chamber was perifused at a flow rate of 100 µl/min. One minute (100 µl) effluent fractions were collected in tubes and stored at −20 °C until the time of radioimmunoassay (RIA). Each experiment was repeated six times. 2.6. RIA ACTH RIA was performed using rabbit antiserum against ACTH1–24. The characteristics of the assay have been reported [17]. The minimum detection limit of the assay was 1 pg/tube. 2.7. Statistical analyses The results are expressed as the mean± SEM. Statistical analysis was performed by one-way analysis of variance (ANOVA) followed by Scheffe's multiple range test or Student's two-tailed unpaired t-test as appropriate. p b 0.05 was considered significant. Mean basal ACTH secretion in each experiment was determined in 5 consecutive fractions, which were collected immediately before stimulation with each secretagogue. The response to each agent was calculated as the integrated area under the curve above basal secretion. The total response to AVP was defined as the area under the curve during the full 10 min stimulation; the spike phase of the response to AVP was defined as the initial 3 min and the sustained phase as the remaining 7 min of stimulation as previously reported [7]. The response to CRH was defined as the area under the curve during the full 10 min stimulation. 3. Results 3.1. Effects of SOCC blockers on the ACTH response to AVP Cells were preperifused with perifusion medium alone for 120 min, then perifused with SOCC blocker (50 µM SKF96365, 10 µM MRS1845 or 10 µM 2-APB) or vehicle alone for 15 min before exposure to 100 nM AVP as indicated in Fig. 1. SKF96365 did not affect either the initial spike phase (261.2± 28.5 vs. 229.2 ± 45.8 pg/3 min, p N 0.05) or the sustained plateau phase (201.7 ± 59.5 vs. 256.6 ± 26.2 pg/7 min, p N 0.05) of the ACTH response to single AVP stimulation (Fig.1A). MRS1845 also did not affect either phase (183.6 ± 12.9 vs. 210.5 ± 12.0 pg/3 min for spike phase, p N 0.05; 191.8± 30.6 vs. 177.7 ± 20.1 pg/7 min for sustained phase, p N 0.05; Fig. 1B). 2-APB reduced the initial spike phase of the ACTH secretory response to AVP by 41.3% (118.7± 9.7 vs. 202.3 ± 21.0 pg/3 min, p b 0.05), but did not affect the sustained plateau phase (160.5 ± 40.9 vs. 160.5 ± 40.9 pg/7 min, p N 0.05; Fig. 1C). 3.2. Effects of ionomycin pretreatment on the ACTH response to AVP After 120 min preperifusion with perifusion medium alone, the cells were perifused with perifusion medium containing 2 µM
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
59
Fig. 1. Effect of SOCC blocker on the ACTH secretory response to AVP. Each identical chamber for each test substance was loaded with 7 × 105 rat anterior pituitary cells (cultured for 4 days). The cells were preperifused with serum-free medium 199 for 120 min, then perifused with medium containing 10 µM MRS1845 (A) or 50 µM SKF96365 (B) or 10 µM 2-APB (C) or vehicle alone from 15 min prior to and during 10 min 100 nM AVP addition. Each circle represents the means (n = 6/group), bracket indicates the SEM. Open circle, cells perifused with vehicle; close circle, cells perifused with reagent. Each column represents the mean of determinations of the integrated area under the curve above basal secretion, bracket indicates the SEM. Total indicates the area under the curve during the full 10 min stimulation, spike indicates the area under the curve of initial 3 min of stimulation, sustained indicates the area under the curve of remaining 7 min of stimulation. Open columns represent cells perifused with vehicle; solid columns represent cells perifused with SOCC. Statistical analysis was performed by Student's two-tailed unpaired t-test. MRS1845 and SKF96365 did not affect the ACTH response to AVP, whereas 2-APB inhibited the spike phase of ACTH response. †, p b 0.05 compared with vehicle alone. 2-APB; 2-aminoethoxydiphenyl borate.
ionomycin or vehicle alone for 10 min. After returning to reagent-free perifusion medium for 60 min, the cells were exposed to AVP for 10 min as indicated in Fig. 2. The pretreatment with ionomycin had no
influence on the ACTH response to AVP (241.6 ± 42.0 vs. 223.2 ± 44.6 pg/3 min for spike phase, p N 0.05; 196.1 ± 24.8 vs. 208.1 ± 27.2 pg/7 min for sustained phase, p N 0.05; Fig. 2).
60
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
Fig. 2. Effect of 2 µM ionomycin pretreatment in the ACTH response to 100 nM AVP. The cells were preperifused with serum-free medium for 120 min, and then the medium containing 2 µM ionomycin or vehicle was perifused for 10 min. After another 60 min perifusion with reagent-free medium, 100 nM AVP was perifused for 10 min. Each circle represents the means (n = 6/group), bracket indicate the SEM. Open circle, cells perifused with vehicle; close circle, cells perifused with reagent. Each column represents the mean of determinations of the integrated area under the curve above basal secretion, bracket indicates the SEM. Open columns represent cells perifused with vehicle; solid columns represent cells perifused with ionomycin. Statistical analysis was performed by Student's two-tailed unpaired t-test. Pretreatment by ionomycin 1 h ahead of stimulation by AVP did not affect the ACTH response. Iono; ionomycin.
3.3. Effects of SOCC blockers on the ACTH response to AVP after ionomycin treatment After 120 min preperifusion with perifusion medium alone, the cells were perifused with medium containing 50 µM SKF96365, 10 µM
MRS1845 or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After returning to the medium containing each SOCC blocker without ionomycin for another 60 min, the cells were exposed to 100 nM AVP for 10 min as indicated in Fig. 3. SKF96365 reduced the initial spike phase of the ACTH secretory
Fig. 3. Effect of SOCC blockers on the ACTH response to AVP after pretreatment with ionomycin. After 120 min preperifusion, the cells were perifused with medium containing 50 µM SKF96365 (A), or 10 µM MRS1845 (B), or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After another 60 min perifusion with medium containing each reagent, 100 nM AVP was perifused for 10 min following addition to medium. Each circle represents the mean (n = 6/group), bracket indicates the SEM. Open circle, cells perifused with vehicle; closed circle, cells perifused with reagent. Each column represents the mean of area under the curve above basal secretion, bracket indicates the SEM. Open columns represent cells perifused with vehicle; solid columns represent cells perifused with reagents. Statistical analysis was performed by Student's two-tailed unpaired t-test. SOCC blockers reduced the initial spike phase of the ACTH response to AVP. †, p b 0.05 compared with vehicle alone. Iono; ionomycin.
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
61
Fig. 4. Effect of SOCC blockers with L-type VDCC blocker on the ACTH response to AVP after pretreatment with ionomycin. After 120 min preperifusion, the cells were perifused with medium containing either 10 µM MRS1845 or 10 µM MRS1845 with 1 µM nimodipine or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After another 60 min perifusion with medium containing each reagent, 100 nM AVP was perifused for 10 min following addition to medium. Each mark represents the means (n = 6/group), bracket indicates the SEM. Open circle, cells perifused with vehicle; closed circle, cells perifused with 10 µM MRS1845; closed triangle, cells perifused with 10 µM MRS1845 and 1 µM nimodipine. Each column represents the mean of area under the curve above basal secretion, bracket indicates the SEM. Open columns represent cells perifused with vehicle, solid columns represent cells perifused with 10 µM MRS1845, hatched columns represent cells perifused with 10 µM MRS1845 and 1 µM nimodipine. Statistical analysis was performed by one-way ANOVA followed by Scheffe's multiple range test. Addition of L-type VDCC blocker reduced both the initial spike phase and sustained plateau phase of the ACTH response to AVP significantly. †, p b 0.05 compared with vehicle alone. *, p b 0.05 compared with 10 µM MRS1845. Iono; ionomycin.
Fig. 5. Effect of SOCC blockers on the ACTH response to CRH after pretreatment with ionomycin. After 120 min preperifusion, the cells were perifused with medium containing 50 µM SKF96365 (A) or 10 µM MRS1845 (B) or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After another 60 min perifusion with medium containing each reagent, 1 nM CRH was perifused for 10 min addition to medium. Each circle represents the means (n = 6/group), bracket indicates the SEM. Open circle, cells perifused with vehicle; closed circle, cells perifused with reagent. Each column represents the mean of area under the curve above basal secretion, bracket indicates the SEM. Open columns represent cells perifused with vehicle; solid columns represent cells perifused with reagents. Statistical analysis was performed by Student's two-tailed unpaired t-test. SOCC blockers did not affect the ACTH response to CRH. Iono; ionomycin.
62
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
response to AVP by 45.6% (87.0 ± 14.8 vs. 160.0 ± 25.8 pg/3 min, p b 0.05), but did not affect the sustained plateau phase (103.0 ± 22.4 vs. 144.2 ± 25.8 pg/7 min, p N 0.05; Fig. 3A). MRS1845 also reduced the initial spike phase by 38.7% (81.1 ± 11.5 vs. 132.2 ± 11.9 pg/3 min, p b 0.05), but did not affect the sustained plateau phase (80.0 ± 10.4 vs. 92.1 ± 17.0 pg/7 min p N 0.05; Fig. 3B).
3.6. TRPCs gene expression in rat anterior pituitary
3.4. Effects of SOCC blockers with L-type VDCC blocker on the ACTH response to AVP after ER depletion
4. Discussion
After 120 min preperifusion with perifusion medium alone, the cells were perifused with medium containing either 10 µM MRS1845 or the combination of 10 µM MRS1845 plus 1 µM nimodipine, an L-type VDCC blocker, or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After returning to medium containing each SOCC blocker without ionomycin for another 60 min, the cells were exposed to 100 nM AVP for 10 min as indicated in Fig. 4. The addition of L-type VDCC blocker with SOCC blocker reduced both the initial spike phase of ACTH release by 64.0% compared to the vehicle (86.3±4.6 vs. 240.3±15.7 pg/ 3 min, pb 0.05) and sustained plateau phase by 73% (69.7±7.5 vs. 258.8± 29.1 pg/7 min, pb 0.05). Compared to the MRS1845 alone, addition of nimodipine reduced the initial spike phase by 42.0% (86.3±4.6 vs.148.9± 13.6 pg/3 min, pb 0.05) and the sustained plateau phase by 61.0% (69.7± 7.5 vs. 179.1±30.2 pg/7 min, pb 0.05; Fig. 4).
3.5. Effects of SOCC blockers on the ACTH response to CRH after ER depletion After 120 min preperifusion with perifusion medium alone, the cells were perifused with medium containing SOCC blocker, 50 µM SKF96365 or 10 µM MRS1845 or vehicle alone from 15 min prior to and during 10 min 2 µM ionomycin addition. After another 60 min perifusion with medium containing each SOCC blocker, the cells were exposed to 1 nM CRH for 10 min as indicated in Fig. 5. Neither SKF96365 (952.6 ± 84.0 vs. 895.1 ± 68.8 pg/10 min, p N 0.05) nor 10 µM MRS1845 (744.1 ± 30.7 vs. 766.4 ± 31.6 pg/10 min, p N 0.05) affected the ACTH response to CRH (Fig. 5).
Fig. 6. Expression of TRPC channel mRNA in rat tissue. 1 µg of total RNA was used for RTPCR. Amplified products were separated on agarose gels and stained with ethidium bromide. Bars on the left indicate the size of the transcripts (base pairs, bp). Anterior pituitary cells contained mRNA transcripts of all seven subunits. La: ladder, B: brain, Lu: lung, H: heart, K: kidney, T: testis, P: pituitary.
To investigate the expression of TRPC homologues, which are suggested as candidate genes of SOCC, in the rat anterior pituitary, RTPCR was performed. The rat anterior pituitary showed the transcription of all TRPC homologues, which displayed a pattern similar to the brain (Fig. 6).
Exocytosis is a Ca2+-regulated process involving an increased intracellular calcium concentration and subsequent channel opening. Intracellular Ca2+ stores contribute significantly to Ca2+ signaling in rat corticotrophs [8,18]. AVP has been shown to trigger a transient and plateau pattern of Ca2+ signaling in rat corticotrophs, which can be mimicked by IP3, inducing the intracellular Ca2+ release from the ER. Ca2+ can also be released from the ER with Ca2+ ionophores, such as ionomycin or A23187. In previous reports, AVP, oxytocin, and angiotensin II all activated the IP3/diacylglycerol/PKC pathway to elicit an initial spike phase of ACTH release. The acute depletion of ER Ca2+ stores by ionomycin diminishes the spike phase of this response in microperifusion [8]. These findings indicate that the ER Ca2+ store is essential for ACTH response to AVP. Interestingly, the patterns of ACTH response to AVP and CRH are quite similar to those of intracellular Ca2+ concentration in response to corresponding secretagogues [19]. Therefore, the ACTH secretory pattern in response to the secretagogues reflects the intracellular Ca2+ concentration in a microperifusion system. Although the concentration (100 nM) of AVP used in this study was greater than the physiological dose, it was necessary to demonstrate both the spike and sustained ACTH responses to AVP [20]. The stimulation of the cell surface receptors, which activate phospholipase C leading to Ca2+ release through IP3 or ryanodine receptors in the ER, activates SOCC in the plasma membrane. In this study, the ACTH response to the first AVP challenge was not affected by SKF96365 or MRS 1845. This supports the major idea of Ca2+ entry through SOCC, which is widely believed to refill Ca2+ into the ER. SKF96365 is one of the novel reagents known to inhibit SOCC, but also inhibits other channels such as L-type VDCC over similar concentration ranges [21]. MRS1845 is a more selective SOCC blocker [22]. Both SOCC blockers did not inhibit either the sustained plateau phase of ACTH response to AVP or the ACTH response to CRH. This demonstrated that these two reagents did not block L-type VDCC because both responses are dependent on L-type VDCC. 2-APB has been originally known as an IP3 receptor antagonist, but recently has proven to be most useful in manipulating SOC entry [23]. The inhibitory effect of 2-APB on IP3 receptors is controversial depending on cell types. In this study, 2-APB inhibited the spike phase of the ACTH response to the first AVP challenge, indicating that 2-APB inhibited the IP3 receptor. Therefore, 2-APB was not suitable for the evaluation of Ca2+ refilling into the ER through SOCC in our system. SOCC can be activated by any conditions that empty the Ca2+ store. These conditions include 1) elevation of intracellular IP3, 2) application of a Ca2+ ionophore to permeabilize the ER membrane, 3) dialyzing the cytoplasm with high concentrations of the Ca2+ chelators such as EGTA or BAPTA, 4) exposure to the sarcoplasmic/ endoplasmic reticulum Ca2+-ATPase (SERCA) inhibitors like thapsigargin, 5) sensitizing the IP3 receptor to resting levels of IP3 with agent like thimerosal and 6) loading membrane-permeable metal Ca2+ chelators like N,-N,-N′,-N′-tetrakis(2-pyridylmethyl)ethylenediamine directly into the store [24]. Because our preliminary study showed that the ACTH responses to repeated AVP stimulations were not altered by SOCC blockers (data not shown), we considered the possibility that the Ca2+ depletion of ER by AVP was not enough to distinctly show the effect of SOCC. It is well known that thapsigargin (Tg) is quite useful as an activator of SOCC through Ca2+ depletion of ER. However, it is difficult to observe the recovery of the Ca2+ pool in Tg-pre-treated
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
cells even after 24 h of the incubation with Tg-free medium [25]. For this reason, we thought that Tg was not suitable for our experiments. Ionomycin is one of the SOCC activators and has been reported to induce CRAC current [26,27]. Pretreatment with ionomycin did not affect the AVP response, revealing that the effect of ionomycin was cleared off within 60 min and the ER Ca2+ might be refilled. The SOCC blocker partially reduced the initial spike phase of the ACTH response to AVP after Ca2+ depletion with ionomycin, suggesting that the refilling of the ER Ca2+ store is partially mediated by SOCC. The mechanism of store refilling is not fully understood. It was first thought that the store-operated Ca2+ entry occurred because extracellular Ca2+ passed directly into the intracellular stores [9]. However, subsequent works demonstrated that extracellular Ca2+ passed first into the cytosol and then was pumped into the store by SERCA [28]. Stromal interacting molecule protein (STIM1), the ER resident Ca2+ binding protein regulating SOCC, was recently identified and may enlighten the mechanism of SOCC [29,30]. Upon Ca2+ store depletion, STIM1 migrates from a relatively homogeneous distribution throughout the ER to discrete puncta below the plasma membrane [31,32]. This puncta forms in subregions of junctional ER located 20 nm from the plasma membrane [32], causing the local activation of CRAC entry at individual junctions. By concentrating Ca2+ influx near SERCA pumps, it optimizes the efficiency of store refilling, explaining why, in certain systems, the store can reload with extracellular Ca2+ without a detectable rise in the cytosol. The SOCC blocker did not affect the ACTH response to CRH even after ionomycin treatment, indicating that the CRH-induced signal cascade does not require the activation of SOCC. The ACTH response to CRH is mediated mainly by L-type VDCC [33], supporting our result. This study also showed that the SKF96365 and MRS1845 did not display their ability as L-type VDCC blockers in our study. The combination of L-type VDCC blocker and SOCC blocker showed the additive effect on the reduction of the AVP-induced ACTH response. In previous reports, nimodipine, a potent L-type VDCC blocker, reduced both phases of the response to AVP, indicating that the extracellular Ca2+ enters mainly through L-type VDCC during AVP stimulation [6]. Because the concentration of nimodipine is high enough to block L-type VDCC, the additional inhibition by the combination of both blockers indicates that the effect of the SOCC blocker is not via L-type VDCC in normal pituitary cells. Molecular candidates for the SOCC may be emerging from the discovery of the Drosophila TRP channels and seven canonical mammalian TRP homologues [34]. TRPC channels are non-selective, Ca2+ permeable cation channels that are activated by the stimulation of G protein-coupled and tyrosine phosphorylated receptors. TRPC channels become a strong candidate for SOCC. Our study showed that the pituitary expressed all types of homologues, which is similar to the expression in the brain. With few exceptions, the TRPC channels are broadly expressed, and given cell type, generally contain multiple TRPCs [35]. Although there is still some controversy over which subtypes of the TRPC channels function as SOCC, the most predominant homologue for SOCC is currently TRPC1. Treatment with antisense oligonucleotide, which inhibits transcription of the endogenous TRPC1 and TRPC3 specifically reducing Ca2+ influx, and STIM1 are reported to regulate the TRPC1 channel activity [36]. These findings support the consideration that TRPC1 may be SOCC, but further investigation is necessary. The functions of the various homologues are unknown, but it can be speculated that they give the diversity in SOCC properties. Even when both L-type VDCC blocker and SOCC blocker were added simultaneously, the initial spike phase of ACTH release in response to AVP was not completely abolished. If the spike response of ACTH to AVP is fully dependent on ER Ca2+ store, ER should be partially refilled with Ca2+. One possibility is that the refilling from the cytosol is ongoing, because we could not inhibit the function of SERCA completely. There is also another possibility that the other mechanisms, which can refill the ER storage with Ca2+, exist. One
63
possible mechanism is a Na+–Ca2+ exchanger, which is expressed in the plasma membrane and also in ER of neurons and other excitable cells [37,38]. Na+–Ca2+ exchangers have been reported to modulate ER Ca2+ concentration in osteoblasts [39]. In conclusion, the refilling of Ca2+ into ER through SOCC is required for the maximum ACTH response to AVP but not CRH in rat pituitary cells. Acknowledgements This study was supported, in part, by a grant in Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology. References [1] Vale W, Vaughan J, Smith M, Yamamoto G, Rivier J, Rivier C. Effects of synthetic ovine corticotropin-releasing factor, glucocorticoids, catecholamines, neurohypophysial peptides, and other substances on cultured corticotropic cells. Endocrinology 1983;113:1121–31. [2] Labrie F, Veilleux R, Lefevre G, Coy DH, Sueiras-Diaz J, Schally AV. Corticotropinreleasing factor stimulates accumulation of adenosine 3', 5'-monophosphate in rat pituitary corticotrophs. Science 1982;216:1007–8. [3] Bilezikjian LM, Blount AL, Vale WW. The cellular actions of vasopressin on corticotrophs of the anterior pituitary: resistance to glucocorticoid action. Mol Endocrinol 1987;1:451–8. [4] Berridge MJ, Irvine RF. Inositol trisphosphate, a novel second messenger in cellular signal transduction. Nature 1984;312:315–21. [5] Nishizuka Y. The role of protein kinase C in cell surface signal transduction and tumour promotion. Nature 1984;308:693–8. [6] Won JG, Oki Y, Orth DN. Roles of intracellular and extracellular calcium in the kinetic profile of adrenocorticotropin secretion by perifused rat anterior pituitary cells. II. Arginine vasopressin, oxytocin, and angiotensin-II stimulation. Endocrinology 1990;126:858–68. [7] Oki Y, Nicholson WE, Orth DN. Role of protein kinase-C in the adrenocorticotropin secretory response to arginine vasopressin (AVP) and the synergistic response to AVP and corticotropin-releasing factor by perifused rat anterior pituitary cells. Endocrinology 1990;127:350–7. [8] Oki Y, Peatman TW, Qu ZC, Orth DN. Effects of intracellular Ca2+ depletion and glucocorticoid on stimulated adrenocorticotropin release by rat anterior pituitary cells in a microperifusion system. Endocrinology 1991;128:1589–96. [9] Putney Jr JW. A model for receptor-regulated calcium entry. Cell Calcium 1986;7:1–12. [10] Lewis RS, Cahalan MD. Mitogen-induced oscillations of cytosolic Ca2+ and transmembrane Ca2+ current in human leukemic T cells. Cell Regul 1989;1:99–112. [11] Secondo A, Taglialatela M, Cataldi M, Giorgio G, Valore M, Di Renzo G, et al. Pharmacological blockade of ERG K+ channels and Ca2+ influx through storeoperated channels exerts opposite effects on intracellular Ca2+ oscillations in pituitary GH3 cells. Mol Pharmacol 2000;58:1115–28. [12] Thore S, Dyachok O, Gylfe E, Tengholm A. Feedback activation of phospholipase C via intracellular mobilization and store-operated influx of Ca2+ in insulinsecreting beta-cells. J Cell Sci 2005;118:4463–71. [13] Fomina AF, Nowycky MC. A current activated on depletion of intracellular Ca2+ stores can regulate exocytosis in adrenal chromaffin cells. J Neurosci 1999;19:3711–22. [14] Bergdahl A, Gomez MF, Wihlborg AK, Erlinge D, Eyjolfson A, Xu SZ, et al. Plasticity of TRPC expression in arterial smooth muscle: correlation with store-operated Ca2+ entry. Am J Physiol Cell Physiol 2005;288:C872–80. [15] Wu X, Zagranichnaya TK, Gurda GT, Eves EM, Villereal ML. A TRPC1/TRPC3mediated increase in store-operated calcium entry is required for differentiation of H19-7 hippocampal neuronal cells. J Biol Chem 2004;279:43392–402. [16] Halili-Manabat C, Oki Y, Iino K, Iwabuchi M, Morita H, Yoshimi T. The role of sodium in mediating adrenocorticotropin secretion by perifused rat anterior pituitary cells. Endocrinology 1995;136:2937–42. [17] Tominaga T, Oki Y, Tanaka I, Ikeda Y, Nanno M, Yoshimi T. Effect of sodium valproate on the secretion of proopiomelanocortin derived peptides from cultured rat anterior pituitary cells. Endocrinol Jpn 1989;36:809–15. [18] Tse A, Lee AK. Arginine vasopressin triggers intracellular calcium release, a calcium-activated potassium current and exocytosis in identified rat corticotropes. Endocrinology 1998;139:2246–52. [19] Leong DA. A complex mechanism of facilitation in pituitary ACTH cells: recent single-cell studies. J Exp Biol 1988;139:151–68. [20] Watanabe T, Orth DN. Detailed kinetic analysis of adrenocorticotropin secretion by dispersed rat anterior pituitary cells in a microperifusion system: effects of ovine corticotropin-releasing factor and arginine vasopressin. Endocrinology 1987;121:1133–45. [21] Merritt JE, Armstrong WP, Benham CD, Hallam TJ, Jacob R, Jaxa-Chamiec A, et al. SK&F 96365, a novel inhibitor of receptor-mediated calcium entry. Biochem J 1990;271:515–22. [22] Harper JL, Camerini-Otero CS, Li AH, Kim SA, Jacobson KA, Daly JW. Dihydropyridines as inhibitors of capacitative calcium entry in leukemic HL-60 cells. Biochem Pharmacol 2003;65:329–38.
64
M. Yamashita et al. / Regulatory Peptides 156 (2009) 57–64
[23] Bootman MD, Collins TJ, Mackenzie L, Roderick HL, Berridge MJ. Peppiatt CM. 2-aminoethoxydiphenyl borate (2-APB) is a reliable blocker of store-operated Ca2+ entry but an inconsistent inhibitor of InsP3-induced Ca2+ release. FASEB J 2002;16:1145–50. [24] Parekh AB, Putney Jr JW. Store-operated calcium channels. Physiol Rev 2005;85:757–810. [25] Short AD, Bian J, Ghosh TK, Waldron RT, Rybak SL, Gill DL. Intracellular Ca2+ pool content is linked to control of cell growth. Proc Natl Acad Sci U S A 1993;90:4986–90. [26] Alonso-Torre SR, Alvarez J, Montero M, Sanchez A, Garcia-Sancho J. Control of Ca2+ entry into HL60 and U937 human leukaemia cells by the filling state of the intracellular Ca2+ stores. Biochem J 1993;289(Pt 3):761–6. [27] Hsu S, O'Connell PJ, Klyachko VA, Badminton MN, Thomson AW, Jackson MB, et al. Fundamental Ca2+ signaling mechanisms in mouse dendritic cells: CRAC is the major Ca2+ entry pathway. J Immunol 2001;166:6126–33. [28] Montero M, Alonso-Torre SR, Alvarez J, Sanchez A, Garcia-Sancho J. The pathway for refilling intracellular Ca2+ stores passes through the cytosol in human leukaemia cells. Pflugers Arch 1993;424:465–9. [29] Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell Jr JE, et al. STIM is a Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx. Curr Biol 2005;15:1235–41. [30] Zhang SL, Yu Y, Roos J, Kozak JA, Deerinck TJ, Ellisman MH, et al. STIM1 is a Ca2+ sensor that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane. Nature 2005;437:902–5.
[31] Luik RM, Wu MM, Buchanan J, Lewis RS. The elementary unit of store-operated Ca2+ entry: local activation of CRAC channels by STIM1 at ER-plasma membrane junctions. J Cell Biol 2006;174:815–25. [32] Wu MM, Buchanan J, Luik RM, Lewis RS. Ca2+ store depletion causes STIM1 to accumulate in ER regions closely associated with the plasma membrane. J Cell Biol 2006;174:803–13. [33] Kuryshev YA, Childs GV, Ritchie AK. Corticotropin-releasing hormone stimulates Ca2+ entry through L- and P-type Ca2+ channels in rat corticotropes. Endocrinology 1996;137:2269–77. [34] Pedersen SF, Owsianik G, Nilius B. TRP channels: an overview. Cell Calcium 2005;38:233–52. [35] Montell C, Birnbaumer L, Flockerzi V. The TRP channels, a remarkably functional family. Cell 2002;108:595–8. [36] Worley PF, Zeng W, Huang GN, Yuan JP, Kim JY, Lee MG, et al. TRPC channels as STIM1-regulated store-operated channels. Cell Calcium 2007;42:205–11. [37] DiPolo R, Beauge L. Sodium/calcium exchanger: influence of metabolic regulation on ion carrier interactions. Physiol Rev 2006;86:155–203. [38] Kiedrowski L, Brooker G, Costa E, Wroblewski JT. Glutamate impairs neuronal calcium extrusion while reducing sodium gradient. Neuron 1994;12:295–300. [39] Jung SY, Park YJ, Park YJ, Cha SH, Lee MZ, Suh CK. Na+–Ca2+ exchanger modulates Ca2+ content in intracellular Ca2+ stores in rat osteoblasts. Exp Mol Med 2007;39:458–68.