- Email: [email protected]
β-catenin pathway in the effect of implant topography on MG63 differentiation
Biomaterials 33 (2012) 7993e8002
Contents lists available at SciVerse ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
The role of the Wnt/b-catenin pathway in the effect of implant topography on MG63 differentiation Wei Wang a,1, Lingzhou Zhao b,1, Qianli Ma a,1, Qintao Wang b, Paul K. Chu c, *, Yumei Zhang a, * a
Department of Prosthetic Dentistry, School of Stomatology, The Fourth Military Medical University, No. 145 West Changle Road, Xi’an 710032, China Department of Periodontology and Oral Medicine, School of Stomatology, The Fourth Military Medical University, No. 145 West Changle Road, Xi’an 710032, China c Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 11 July 2012 Accepted 29 July 2012 Available online 11 August 2012
Wnt/b-catenin signaling plays a key role in bone formation. To assess the role of this signaling cascade in the response of osteoblasts to the implant topography, human MG63 osteoblasts are cultured on micropitted/nanotubular surface topographies (MNTs) and the transcriptional expressions of Wnt/bcatenin pathway receptors, activators, and inhibitors are measured. b-catenin signaling and cell differentiation are studied in the absence and presence of exogenous Dickkopf 1 (Dkk1) on the MNTs and exogenous Wnt3a on a smooth surface. The expressions of the Wnt/b-catenin pathway receptor lowdensity lipoprotein receptor-related protein 6 and pathway ligand Wnt3a are up-regulated by the MNTs whereas those of the pathway inhibitors including Dkk1/2 and secreted frizzled-related protein 1/ 2 are down-regulated by the MNTs, indicating regulation of the Wnt/b-catenin pathway modulators to activate the pathway. Consequently, the b-catenin signaling activity is enhanced by the MNTs as well as cell differentiation in terms of osteogenesis-related gene expressions and alkaline phosphatase and collagen products. On the smooth surface, exogenous Wnt3a stimulates b-catenin signaling and cell differentiation while exogenous Dkk1 attenuates the enhancement by the MNTs. The results explicitly demonstrate that the implant topography regulates the product of the Wnt/b-catenin pathway modulators from the cells and in turn activates the cell Wnt/b-catenin pathway promoting osteoblast differentiation. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Wnt bcatenin MG63 Differentiation Micro/nano-textured topography
1. Introduction The surface topography of a biomedical implant plays an important role in regulating protein adsorption and cell focal adhesion assembly, which change the intracellular signaling pathways and consequently influence the cell phenotype and overall biological response to the implant [1e3]. Various types of topographies on the micro- and nanoscale have been developed to target better osseointegration [4]. Since the natural bone extracellular matrix (ECM) is composed of nano- to microscale functional blocks, a hierarchical micro/nano-textured topography (MNT) is expected to yield better biological effects. The MNTs combining nanotubes and micropitted topography exhibit more pronounced effects on osteoblast maturation as well as mesenchymal stem cell osteogenic differentiation [5,6]. Nonetheless, the molecular mechanism by
* Corresponding authors. E-mail addresses: [email protected] (P.K. Chu), [email protected] (Y. Zhang). 1 Co-first authors. 0142-9612/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.biomaterials.2012.07.064
which the topographical cue affects the functions of cells and tissues is still not well understood and this has hampered optimization of biomaterials topography. The Wnt/b-catenin pathway which plays an essential role in bone mass and bone cell functions [7e9] is involved in the responses of cells to various stimulants including bone morphogenetic protein (BMP) [10], strain [11], oxygen-related stress [12], and implant surface properties [13]. It has also been shown that the Wnt/b-catenin pathway mediates the biological effects of the implant surface topography [14e16], although how the topographical cues affect the Wnt/b-catenin pathway is not well known. In addition to the direct influence on cell functions through cells/ biomaterials interactions, biomaterials also modulate the cell secretion profiles to indirectly affect cell behaviors via autocrine/ paracrine modes [17]. b-catenin cytosol accumulation and nucleus translocation, the key event of the canonical Wnt pathway activation, are comprehensively modulated by Wnt proteins and a large number of antagonists secreted by cells. The canonical Wnt pathway is initiated by Wnt proteins [18]. Furthermore, there is a large number of antagonists in the Wnt/b-catenin pathway, including the Dickkopf (Dkk) family and secreted frizzled-related
7994
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
protein (sFRP) [19e21]. Hence, the surface topography may influence the osteoblast functionalities by regulating the Wnt/b-catenin pathway modulators secreted from the cells that in turn modulate the cell Wnt/b-catenin pathway. To test the hypothesis, human MG63 osteoblasts are cultured on the MNTs combining the nanotube and micropitted topography and the transcriptional expressions of the Wnt/b-catenin pathway receptors, activators, and inhibitors are measured in this work. The b-catenin signaling and cell differentiation are studied in the presence and absence of exogenous Dkk1 for cells on the MNTs and exogenous Wnt3a for cells on a smooth surface. This study aims at advancing our understanding of the biological effects of implant topographies and providing insight into how implant osseointegration can be systematically enhanced.
2.4. Western blot assay The MG63 cells cultured on the MNTs at a density of 2 104 cells/well were treated with 100 ng/mL of human rhWnt3a, and those on the smooth surface were treated with the Wnt inhibitor human rhDkk1. The culture medium containing either Wnt3a or Dkk1 was changed every 48 h for a total period of 7 days. For total cellular proteins, the cells were lysed in the RIPA buffer (150 mM NaCl, 1% deoxycholate, 50 mM Tris (PH 7.4), 5 mM EDTA, 1% TritonX-100, 1 mM NaF, and 1 mM Na3VO4). Alternatively, the cytosolic and nuclear fractions were prepared using the Nuclear and Cytoplasmatic Extraction Kit (Millipore, Billerica, MA, USA). Equal amounts of extracts were separated by 10% SDS-PAGE and transferred to the polyvinylidene fluoride membrane (Bio-Rad). Blots were blocked for 1 h in 5% bovine serum albumin (BSA, Gibco), followed by incubation with the primary antibodies overnight at 4 C and then the horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody for 1 h at room temperature. Blots were analyzed using Western-Light Chemiluminescent Detection System (Peiqing, China). The monoclonal antibody against b-catenin was purchased from Cell Signaling Technology and monoclonal antibody against aetubulin was acquired from Abcam.
2. Materials and methods
2.5. ALP staining
2.1. Specimen preparation
The Wnt3a and Dkk1 treatment processes were the same as above. The cells were seeded on the substrates at a density of 2 104 cells/well and cultured in the osteogenic medium. The osteogenic medium was supplemented with 10 mM bglycerophosphate (Sigma), 50 mg/mL ascorbic acid (Sigma), and 107 M dexamethasone (Sigma). After culturing for 7 days, the cells were washed with phosphate buffered saline (PBS) and fixed, and ALP staining was performed with the BCIP/NBT alkaline phosphatase color development kit (Beyotime) for 15 min. The stain was washed with PBS thrice and then images were acquired.
Pure titanium (99.9%, 10 10 1 mm3, Northwest Institute for Nonferrous Metal Research, China) was used as the substrate. After polishing with SiC sandpaper from 400 to 1500 grits and ultrasonic cleaning, the samples were treated with 0.5 wt % hydrofluoric acid for 30 min, rinsed with distilled water, and dried. The samples were anodized in an electrolyte containing 0.5 wt % hydrofluoric acid and 1 M phosphoric acid for 1 h with a DC power supply and a platinum cathode at 5 and 20 V to fabricate the MNTs (R-5 and R-20). The polished smooth surface (S) was used as the control. The morphology of the samples was inspected by field-emission scanning electron microscopy (FE-SEM, S-4800, Hitachi, Japan). The samples were sterilized by cobalt 60 before cell plating.
2.2. Cell culture Human MG63 osteoblasts obtained from ATCC company were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin and incubated in a humidified atmosphere of 5% CO2 at 37 C. Only early passage cells were used in the experiments.
2.3. Quantitative real time PCR The MG63 cells were seeded on the samples at a density of 2 104/well and cultured for 3 and 7 days to evaluate the gene expressions of the Wnt3a, Wnt5a, Axin2, low-density lipoprotein receptor-related protein 5 (LRP5), LRP6, sFRP1/2, Dkk1 and Dkk2. The MG63 cells cultured on the MNTs at a density of 2 104 cell/ well were treated with 100 ng/mL of human recombinant (rh) Wnt3a (R&D System), and those on the smooth surface were treated with the Wnt inhibitor human rhDkk1 (R&D System). After total incubation for 7 days, the expressions of runt-related transcription factor 2 (Runx2), alkaline phosphatase (ALP), BMP, and collagen type I (ColI) were determined. The total RNA was isolated using the Trizol reagent (Invitrogen). 1 mg of total RNA was converted to cDNA using the the PrimeScriptÔ RT reagent kit (TaKaRa). The real-time PCR reactions were performed using SYBR Premix ExÔ Taq II (TaKaRa) on the CFX96Ô PCR System (Bio-rad). b-actin was used as a housekeeping gene and the primers are listed in Table 1.
Table 1 Primers used in real time PCR. Gene
Forward primer sequence (50 e30 )
Reverse primer sequence (50 e30 )
Axin2 Wnt3a Wnt5a LRP5 LRP6 sFRP1 sFRP2 Dkk1 Dkk2 Runx2 ALP BMP ColI b-actin
GGAGAAATGCGTGGATACC GTCCCGTCCCTCCCTTTC TCTCAGCCCAAGCAACAAGG TGGATTTGAACTCGGACTC GCAGAGGAGAACTATGAAAGC ATCAGCCAGTCTCAGATGCC AAGGAAAAGCCCACCCGAATC CCAGACCATTGACAACTACC TGACTTGGGATGGCAGAATC CACTGGCGCTGCAACAAGA CCTTGTAGCCAGGCCCATTG CAACACCGTGCTCAGCTTCC TCCACATACCTTTATTCCAGGAATC TGGCACCCAGCACAATGAA
GCTGCTTGGAGACAATGC ACCTCTCTTCCTACCTTTCCC GCCAGCATCACATCACAACAC GGGAAGAGATGGAAGTAGC GTTGGAGGCAGTCAGAGG AAATCGCCGTCTCTCTCAGG ACAACAACCAACCAGACCCAAG CAGGCGAGACAGATTTGC CAGAAATGACGAGCACAGC CATTCCGGAGCTCAGCAGAATAA GGACCATTCCCACGTCTTCAC TTCCCACTCATTTCTGAAAGTTCC CCCGGGTTTAGAGACAACTTC CTAAGTCATAGTCCGCCTAGAAGCA
2.6. Collagen secretion The cell culture and Wnt3a and Dkk1 treatment processes were the same as those in the ALP staining assay. After culturing for 14 days, the cells were washed with PBS, fixed in 4% paraformaldehyde, and stained for collagen secretion in 0.1 wt % sirius red (Sigma) in saturated picric acid for 18 h. The unbound stain was washed with 0.1 M acetic acid before images were taken. In the quantitative analysis, the stain on the specimens was eluted in 500 mL of destain solution (0.2 M NaOH/ methanol 1:1) and the optical density at 540 nm was measured on a spectrophotometer (Bio-tek, Germany). 2.7. Cell viability assay The cell culture and Wnt3a and Dkk1 treatment processes were the same as those in the Western blot assay. After culturing for 3 and 7 days, the cell vitality was assessed by the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay. At the prescribed time points, the samples were rinsed thrice by PBS and transferred to new 24 well culture plates. The MTT solution was added and the samples were incubated at 37 C to allow formazen formation, which was dissolved with dimethyl sulfoxide. The optical density was measured at 490 nm on the spectrophotometer. 2.8. Cell apoptosis analysis The cell culture and Wnt3a and Dkk1 treatment procedures were the same as those in the Western blot assay. To determine cell apoptosis, an apoptosis detection kit (BD Pharmingen) was used. After culturing for 3 days, the cells were trypsinized, washed with PBS, and resuspended in binding buffer at 1 106 cells/mL. 500 mL of the cell suspension was added to a flow tube and then 5 mL annexin V-FITC and 10 mL propidium iodide were added to each tube. After incubation in dark at room temperature for 10 min, fluorescence was measured immediately on a flow cytometer (FACSVantage SE, BD Biosciences). 2.9. Statistical analysis All data were expressed as means standard deviations from at least three independent experiments. The data were analyzed by one way ANOVA combined with Student-Newman-Keuls post hoc test or Student’s t-test using SPSS 17.0 software (SPSS, USA). A p value of < 0.05 was considered to be significant.
3. Results 3.1. SEM characterization of the MNTs The morphology of the fabricated samples is examined by SEM (Fig. 1). At a low magnification, the smooth surface is relatively flat having parallel grooves, and R-5 and R-20 display a rougher
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
7995
Fig. 1. SEM pictures showing the morphology of the samples.
micropitted morphology. The high-magnification pictures reveal that nanotubes of about 30 and 100 nm are distributed evenly on R5 and R-20, while there is no obvious nanoscale cue on the smooth surface. 3.2. Expressions of Wnt/b-catenin pathway modulators on the MNTs The expressions of Wnt/b-catenin pathway modulators are assessed by real time PCR (Fig. 2). After culturing for 7 days, the Wnt3a expression is significantly increased by the MNTs, while that of Wnt5a is not. The Axin2 expression shows no discernible difference among the samples. With regard to the Wnt receptors, the expression of LRP5 displays no significant difference among the surfaces, but that of LRP6 is enhanced by the MNTs at day 3. The expressions of Wnt/b-catenin pathway inhibitors including sFRP1, sFRP2, Dkk1, and Dkk2 are down-regulated by the MNTs.
MNTs are 2 folds higher than those on the smooth surface, but those on R-5 and R-20 show no obvious difference. 3.4. Effect of exogenous Dkk1 or Wnt3a on b-catenin signaling activity In the presence and absence of exogenous Dkk1 for cells on the MNTs and exogenous Wnt3a for cells on the smooth surface for 7 days, the nuclear b-catenin levels are assessed by Western blot to determine the activation of b-catenin signaling (Fig. 4). The exogenous Wnt3a induces one-fold increase in the nuclear b-catenin amount on the smooth surface. In comparison, the exogenous Dkk1 dramatically decreases the nuclear b-catenin amounts on the MNTs to a level similar to that on the smooth surface in the absence of Wnt3a. 3.5. Effect of exogenous Dkk1 or Wnt3a on osteogenesis-related gene expressions
3.3. b-Catenin signaling activation on the MNTs The nuclear amount of b-catenin which is the marker for the bcatenin signaling activation is examined by Western blot after incubation for 7 days (Fig. 3). The nuclear b-catenin levels on the
In the absence and presence of exogenous Dkk1 for cells on the MNTs and exogenous Wnt3a for cells on the smooth surface for 7 days, the osteogenesis-related gene expressions are monitored by real time PCR (Fig. 5). The ALP and BMP mRNA expressions are
7996
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
Fig. 2. Wnt pathway gene expressions by MG63 cells after incubation of 3 and 7 days of culture on the samples (a p < 0.05 compared to smooth surface, b p < 0.05 compared to R-5).
obviously enhanced by the MNTs, especially R-20, and the Runx2 and ColI expressions are also slightly promoted by the MNTs. The exogenous Wnt3a significantly increases the expressions of osteogenesis-related genes on the smooth surface to levels comparable to those on the MNTs in the absence of Dkk1. Dkk1 significantly ablates the enhanced osteogenesis-related gene expressions by the MNTs to be similar to or even slightly lower than those on the smooth surface.
3.7. Collagen secretion Cell collagen secretion in the absence and presence of exogenous Dkk1 or Wnt3a is quantified by Sirius Red staining (Fig. 7). The MNTs lead to obviously more collagen secretion than the smooth surface. Exogenous Wnt3a dramatically promotes collagen secretion by one fold on the smooth surface. On the other hand, the elevated collagen secretion by the MNTs is greatly attenuated by the exogenous Dkk1 and this effect is more evident on R-20.
3.6. ALP staining 3.8. Cell viability The cell ALP product in the presence and absence of exogenous Wnt3a or Dkk1 is stained (Fig. 6). The MNTs induce significantly higher ALP amounts than the smooth surface. Wnt3a significantly increases the cell ALP product on the smooth surface and Dkk1 largely attenuates the enhanced cell ALP product by the MNTs.
In the presence and absence of exogenous Wnt3a or Dkk1, the cell viability on the samples during the first 7 days of incubation is assessed (Fig. 8). The MNTs induce no obvious difference in the cell viability compared to the smooth surface. The exogenous Wnt3a shows no effect on the cell vitality on the smooth surface, while the
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
7997
apoptosis compared to the smooth surface. The exogenous Wnt3a or Dkk1 do not influence cell apoptosis on the smooth surface or the MNTs. 4. Discussion
Fig. 3. Western blot and semi-quantitative analysis of b-catenin signaling activation in MG63 cells on the samples after incubation for 7 days. atubulin is used as a control for equal loading. a p < 0.05 compared to each untreated group.
exogenous Dkk1 produces differential effects on the cell vitality in terms of different nanotubular diameters. Reduced cell viability is observed from R-5 in response to Dkk1, while the cell viability on R-20 is not affected by Dkk1. 3.9. Cell apoptosis analysis The proportion of apoptotic cells on each surface is measured by flow cytometer in the absence and presence of exogenous Wnt3a or Dkk1 for 3 days (Fig. 9). The MNTs do not lead to obvious cell
Fig. 4. Western blot and semi-quantitative analysis of nuclear b-catenin levels in the MG63 cells cultured on the samples for 7 days. The cells on the MNTs are treated with exogenous Dkk1 and those on the smooth surface are treated with exogenous Wnt3a. atubulin is used as a control for equal loading. a p < 0.05 compared to each untreated group.
The proper implant surface topographies such as the MNTs have been found to deliver enhanced osteogenic properties [5,6,22], but the biological mechanisms responsible for these findings are still not well understood. In this study, we find that the MNTs enhance MG63 cell differentiation in terms of up-regulating the osteogenesis-related gene expressions and enhancing the ALP and collagen product. These effects are related to the enhancement in the Wnt3a expression as well as inhibition in the expressions of Wnt/b-catenin pathway inhibitors including sFRP1, sFRP2, Dkk1 and Dkk2 and consequent b-catenin signaling activation. On the smooth surface, the exogenous Wnt3a significantly enhances bcatenin signaling and cell differentiation. The exogenous Dkk1 obviously attenuates enhanced b-catenin signaling and cell differentiation by the MNTs. Hence, the topography of the biomaterials can enhance the expressions of Wnt protein and its receptor while simultaneously inhibiting the Wnt pathway inhibitor expressions to activate the Wnt/b-catenin pathway and promote osteoblast differentiation (Fig. 10). The MNTs significantly enhance MG63 cell differentiation in terms of the higher mRNA expressions of Runx2, ALP, BMP and ColI as well as the more ALP and collagen product. Runx2 is a transcription factor essential to osteoblast differentiation [23]. The ALP regulate phosphate metabolism via hydrolyzation of phosphate esters and is an early marker for osteoblast differentiation [24]. BMP that belongs to the TGF-b superfamily is essential to osteogenic differentiation and bone formation [25]. ColI is the main ECM protein in bones [26] and one of the most widely recognized biochemical markers in osteoblast differentiation. Up-regulation of the expressions of these genes demonstrates the promoting effects of the MNTs on osteoblast differentiation. This is further corroborated by the larger amounts of ALP and collagen product on the MNTs. The present results are in line with our previous observation that the MNTs significantly promote primary osteoblast differentiation [6]. The Wnt/b-catenin pathway is an important regulator of bone formation through action on cells of the osteoblast lineage and essentially each step of the osteogenic process can be affected by this pathway [8]. The Wnt/b-catenin pathway is stimulated by Wnt proteins, which binding to the Frizzled (FZD) receptor and the coreceptor LRP5/6 leads to activation of Dishevelled and thus inhibition of a complex comprising Axin, glycogen synthase kinase 3b (GSK3b), and adenomatous polyposis coli. Consequently, GSK3b is unable to phosphorylate b-catenin and instead, b-catenin accumulates in the cytoplasm, translocates into the nucleus to react with the transcription factor T cell factor (TCF), and to activate target genes [18]. There is a number of endogenous Wnt antagonists including the Dkk family and sFRPs. Dkk1 and Dkk2 bind to LRP5/6 and prevent the formation of the WnteFZDeLRP complex to inhibit the canonical Wnt signaling pathway [19,20]. sFRPs possess a cysteine-rich domain similar to FZD and they act either by binding directly to the Wnt proteins or forming dimers with FZD to form non-functional complexes thereby inhibiting the Wnt/b-catenin pathway [21]. We study whether the expressions of these Wnt/b-catenin pathway modulators are influenced by the MNTs. The Wnt receptor LRP6 that is required for bone formation [27] is up-regulated by the MNTs. Interestingly, the expression of the Wnt/ b-catenin pathway activator Wnt3a is enhanced by the MNTs, while that of the non-canonical Wnt pathway activator Wnt5a is not affected. On the contrary, the mRNA levels of the Wnt antagonists
7998
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
Fig. 5. Real time PCR analysis of Runx2, ALP, BMP and Col1 expressions in MG63 cells after 7 days of incubation on the samples. The cells on the MNTs were treated with exogenous Dkk1 and those on the smooth surface were treated with exogenous Wnt3a. a p < 0.05 compared to each untreated group.
Fig. 6. ALP staining of the MG63 cells after culturing for 7 days in the osteogenic differentiation medium. The cells on the MNTs are treated with exogenous Dkk1 and those on the smooth surface are treated with exogenous Wnt3a.
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
7999
Fig. 7. Optical images and colorimetric quantification of collagen secretion by MG63 cells cultured in osteogenic medium for 14 days. The cells on the MNTs are treated with exogenous Dkk1 and those on the smooth surface are treated with exogenous Wnt3a. a p < 0.05 compared to each untreated group.
sFRP1, sFRP2, Dkk1 and Dkk2 are all depressed. The Western blot assay results verify the activation of b-catenin signaling. Hence, the MNTs promote osteoblast differentiation by, at least partly, the dual effects of enhancing the expressions of the Wnt protein and receptor and inhibiting the Wnt inhibitor expressions to activate bcatenin signaling. These results are consistent with the previous findings of higher LRP5 expression and decreased Dkk1 expression in MC3T3 cells cultured on silicon incorporated porous TiO2 coating [15]. However, on microstructured titanium surfaces, reduced Wnt3a expression, increased non-canonical Wnt pathway ligand Wnt5a, and increased Dkk2 secretion by osteoblasts have been reported [2,28e30]. The contradiction appears to arise from the difference in sample topography. Compared to the microstructured titanium surfaces, the MNTs in our study have nanostructured cues and the nanocues have been shown to significantly induce b-catenin signaling [31,32]. The biomaterials not only affect cell functions directly through cells/biomaterials interaction, but also modulate the cell microenvironment by influencing the cell secreting profiles to affect the cell behavior indirectly [17]. Our present results indicate that the MNTs
Fig. 8. MTT assay for MG63 cell viability after culturing for 3 and 7 days on different samples. The cells on the MNTs are treated with exogenous Dkk1 and those on the smooth surface are treated with exogenous Wnt3a. a p < 0.05 compared to each untreated group.
8000
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
Fig. 9. Analysis of MG63 cell apoptosis on the samples in the presence and absence of Dkk1 for cells on the MNTs and Wnt3a for cells on the smooth surface. The lower left quadrant contains viable cells, the upper left quadrant contains PI-positive cells, and the two right quadrants contain annexin-V positive cells. The apoptotic cells are located in the two right quadrants.
Fig. 10. Schematic diagram showing the details of the Wnt/b-catenin that mediates the effect of the topography on osteoblast differentiation. The topographical cue up-regulates the Wnt3a expression and inhibits the Dkk1/2 and sFRP1/2 expressions, which in turn activates the cell Wnt/b-catenin signaling in the autocrine/paracrine modes to promote cell differentiation.
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
may modulate the Wnt modulators in the microenvironment around the cell consequently leading to activation of the Wnt/bcatenin pathway through the autocrine/paracrine modes. Actually, it has been demonstrated that the Wnt autocrine/paracrine loop mediates the effect of BMP-2 in pre-osteoblastic cells [10]. For verification, we study whether the exogenous Wnt3a can enhance cell differentiation on the smooth surface. Wnt3a increases the b-catenin signaling activity on the smooth surface to a level slightly higher than those on the MNTs. Consequently, osteoblast differentiation is also significantly enhanced by Wnt3a. At the same time, we study whether the Wnt inhibitor Dkk1 influences the enhancing effect of the MNTs on osteoblast differentiation. As expected, Dkk1 attenuates the enhanced b-catenin signaling activity on the MNTs, and this is in line with the widely reported effect of Dkk1 [33]. Furthermore, the enhanced expressions of the osteogenesis-related genes, ALP product, and collagen secretion by the MNTs are significantly reduced by Dkk1. The data definitely confirm our hypothesis demonstrating that the osteoblast differentiation promoting effect of the MNTs is mediated by the cell secreted Wnt modulators in terms of enhancing Wnt protein secretion and inhibiting product of Wnt/b-catenin pathway inhibitors (Fig. 10). Since the Wnt/b-catenin pathway is reported to have regulating effects on cell viability and cell apoptosis [34e36], we investigate the effects of the MNTs on them and the role of the Wnt/b-catenin pathway in these events. The MNTs do not obviously alter the cell viability. We monitor the changes in the cell viability after manipulating the b-catenin signaling activity by exogenous Wnt3a or Dkk1. The exogenous Wnt3a does not affect the cell viability on the smooth surface and Dkk1 does not produce any obvious difference in the cell viability on R20 but surprisingly, it causes significant decrease in the cell vitality on R-5. Olivares-Navarrete et al. have found that Dkk1 has no effect on the MG63 cell number on microstructured surface [30]. Dkk1 shows a surface dependent effect on osteoblast viability and only has effects on nanotubes of a smaller tube size. Park et al. have reported that nanotubes with increasing tube size induce higher rates of cell apoptosis [37]. However, our results show that on all the samples, the cell apoptosis rates are small and no significantly difference is observed from the MNTs and smooth surface. These results are consistent with by our recent report that nanotubes support mesenchymal stem cell proliferation and osteogenic differentiation without inducing obvious cell death [5]. It is suggested that the different serum concentrations in the cell culture in the different studies may account for the inconsistent results (2% used by Park et al and 10% by us) [5,37]. In our studies, the 10% serum used in the cell culture leads to abundant proteins adsorbed onto the nanotubes thereby supporting cell functions without cell apoptosis [5]. Wnt3a or Dkk1 show no influence in cell apoptosis on the smooth surface or the MNTs and the small cell apoptosis rate reflects the good cytocompatibility of the MNTs. In this study, we attempt to gain deeper insight into the molecular mechanism associated with the biological effects of the implant surface topography by uncovering the role of Wnt/b-catenin pathway in this process. This is expected to enrich our knowledge about biomaterials modification or biofunctionalization in order to accomplish better clinical performance. For example, Wnt3a may be loaded onto the implant surface and released to enhance osteoblast differentiation. In addition, lithium (Li) ions have been reported to activate the Wnt/b-catenin by inhibiting GSK-3b and enhance osteoblast differentiation [38,39]. They have been incorporated into scaffolds to improve the biological performance [40]. The nanotubes are particularly ideal with respect to loading and delivering inorganic bioactive elements since they are stable and function at low doses thereby generating long-lasting
8001
activity [41]. Hence, Li doped nanotubular structures with controlled Li release behavior may render better biological effects. 5. Conclusion The MNTs enhance MG63 cell differentiation and the mechanism is related to the enhanced expressions of Wnt3a and Wnt receptor LRP6, inhibited expressions of Wnt/bcatenin pathway inhibitors, and consequent b-catenin signaling activation. The exogenous Wnt3a can significantly enhance b-catenin signaling activation and cell differentiation on the smooth surface, and the exogenous Dkk1 attenuates the enhancement of them by the MNTs. The results verify that the topography of the biomaterials can regulate cell secretion of the Wnt modulators to activate the Wnt/ b-catenin pathway in autocrine/paracrine modes thereby promoting osteoblast differentiation. Acknowledgments This work was supported by National Natural Science Foundation of China Nos. 81070862 and 31170915 and Hong Kong Research Grants Council (RGC) General Research Funds (GRF) No. CityU 112510. L. Z. Zhao also thanks the grants from The Fourth Military Medical University. References [1] Schwartz Z, Lohmann CH, Sisk M, Cochran DL, Sylvia VL, Simpson J, et al. Local factor production by MG63 osteoblast-like cells in response to surface roughness and 1,25-(OH)2D3 is mediated via protein kinase C- and protein kinase A-dependent pathways. Biomaterials 2001;22:731e41. [2] Olivares-Navarrete R, Hyzy SL, Park JH, Dunn GR, Haithcock DA, Wasilewski CE, et al. Mediation of osteogenic differentiation of human mesenchymal stem cells on titanium surfaces by a Wnt-integrin feedback loop. Biomaterials 2011;32:6399e411. [3] Wang L, Zhao G, Olivares-Navarrete R, Bell BF, Wieland M, Cochran DL, et al. Integrin b1 silencing in osteoblasts alters substrate-dependent responses to 1,25-dihydroxy vitamin D3. Biomaterials 2006;27:3716e25. [4] Mendonca G, Mendonca DB, Aragao FJ, Cooper LF. Advancing dental implant surface technologyefrom micron- to nanotopography. Biomaterials 2008;29: 3822e35. [5] Zhao L, Liu L, Wu Z, Zhang Y, Chu PK. Effects of micropitted/nanotubular titania topographies on bone mesenchymal stem cell osteogenic differentiation. Biomaterials 2012;33:2629e41. [6] Zhao L, Mei S, Chu PK, Zhang Y, Wu Z. The influence of hierarchical hybrid micro/nano-textured titanium surface with titania nanotubes on osteoblast functions. Biomaterials 2010;31:5072e82. [7] Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, et al. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem 2005;280:33132e40. [8] Liu F, Kohlmeier S, Wang CY. Wnt signaling and skeletal development. Cell Signal 2008;20:999e1009. [9] Tamura M, Nemoto E, Sato MM, Nakashima A, Shimauchi H. Role of the Wnt signaling pathway in bone and tooth. Front Biosci (Elite Ed) 2010;2:1405e13. [10] Rawadi G, Vayssiere B, Dunn F, Baron R, Roman-Roman S. BMP-2 controls alkaline phosphatase expression and osteoblast mineralization by a Wnt autocrine loop. J Bone Miner Res 2003;18:1842e53. [11] Sunters A, Armstrong VJ, Zaman G, Kypta RM, Kawano Y, Lanyon LE, et al. Mechano-transduction in osteoblastic cells involves strain-regulated estrogen receptor alpha-mediated control of insulin-like growth factor (IGF) I receptor sensitivity to ambient IGF, leading to phosphatidylinositol 3-kinase/AKTdependent Wnt/LRP5 receptor-independent activation of beta-catenin signaling. J Biol Chem 2010;285:8743e58. [12] Galli C, Macaluso GM, Piemontese M, Passeri G. Titanium topography controls FoxO/beta-catenin signaling. J Dent Res 2011;90:360e4. [13] Galli C, Passeri G, Ravanetti F, Elezi E, Pedrazzoni M, Macaluso GM. Rough surface topography enhances the activation of Wnt/b-catenin signaling in mesenchymal cells. J Biomed Mater Res A 2010;95:682e90. [14] Vlacic-Zischke J, Hamlet SM, Friis T, Tonetti MS, Ivanovski S. The influence of surface microroughness and hydrophilicity of titanium on the up-regulation of TGFb/BMP signalling in osteoblasts. Biomaterials 2011;32:665e71. [15] Wang Q, Hu H, Qiao Y, Zhang Z, Sun J. Enhanced performance of osteoblasts by silicon incorporated porous TiO2 coating. J Mater Sci Technol 2012;28:109e17. [16] Galli C, Piemontese M, Lumetti S, Ravanetti F, Macaluso GM, Passeri G. Actin cytoskeleton controls activation of Wnt/b-catenin signaling in mesenchymal
8002
[17]
[18] [19]
[20]
[21] [22] [23] [24] [25] [26] [27] [28]
[29]
[30]
W. Wang et al. / Biomaterials 33 (2012) 7993e8002 cells on implant surfaces with different topographies. Acta Biomater 2012;8: 2963e8. Schwartz Z, Olivares-Navarrete R, Wieland M, Cochran DL, Boyan BD. Mechanisms regulating increased production of osteoprotegerin by osteoblasts cultured on microstructured titanium surfaces. Biomaterials 2009;30:3390e6. Miller JR. The Wnts. Genome Biol 2002;3. REVIEWS3001. Li X, Liu P, Liu W, Maye P, Zhang J, Zhang Y, et al. Dkk2 has a role in terminal osteoblast differentiation and mineralized matrix formation. Nat Genet 2005; 37:945e52. van der Horst G, van der Werf SM, Farih-Sips H, van Bezooijen RL, Lowik CW, Karperien M. Downregulation of Wnt signaling by increased expression of Dickkopf-1 and -2 is a prerequisite for late-stage osteoblast differentiation of KS483 cells. J Bone Miner Res 2005;20:1867e77. Kawano Y, Kypta R. Secreted antagonists of the wnt signalling pathway. J Cell Sci 2003;116:2627e34. Wennerberg A, Albrektsson T. Effects of titanium surface topography on bone integration: a systematic review. Clin Oral Implants Res 2009;20:172e84. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747e54. Whyte MP. Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocr Rev 1994;15:439e61. Hoffmann A, Gross G. BMP signaling pathways in cartilage and bone formation. Crit Rev Eukaryot Gene Expr 2001;11:23e45. Viguet-Carrin S, Garnero P, Delmas PD. The role of collagen in bone strength. Osteoporos Int 2006;17:319e36. Bodine PV, Komm BS. Wnt signaling and osteoblastogenesis. Rev Endocr Metab Disord 2006;7:33e9. Olivares-Navarrete R, Hyzy SL, Hutton DL, Dunn GR, Appert C, Boyan BD, et al. Role of non-canonical Wnt signaling in osteoblast maturation on microstructured titanium surfaces. Acta Biomater 2011;7:2740e50. Chakravorty N, Ivanovski S, Prasadam I, Crawford R, Oloyede A, Xiao Y. The microRNA expression signature on modified titanium implant surfaces influences genetic mechanisms leading to osteogenic differentiation. Acta Biomater 2012;8:3516e23. Olivares-Navarrete R, Hyzy S, Wieland M, Boyan BD, Schwartz Z. The roles of Wnt signaling modulators Dickkopf-1 (Dkk1) and Dickkopf-2 (Dkk2) and cell
[31]
[32]
[33]
[34] [35]
[36] [37] [38]
[39]
[40]
[41]
maturation state in osteogenesis on microstructured titanium surfaces. Biomaterials 2010;31:2015e24. Schernthaner M, Reisinger B, Wolinski H, Kohlwein SD, Trantina-Yates A, Fahrner M, et al. Nanopatterned polymer substrates promote endothelial proliferation by initiation of b-catenin transcriptional signaling. Acta Biomater 2012;8:2953e62. Yu W, Zhang Y, Xu L, Sun S, Jiang X, Zhang F. Microarray-based bioinformatics analysis of osteoblasts on TiO2 nanotube layers. Colloids Surf B Biointerfaces 2012;93:135e42. Liu N, Shi S, Deng M, Tang L, Zhang G, Ding B, et al. High levels of b-catenin signaling reduce osteogenic differentiation of stem cells in inflammatory microenvironments through inhibition of the noncanonical Wnt pathway. J Bone Miner Res 2011;26:2082e95. Bodine PV. Wnt signaling control of bone cell apoptosis. Cell Res 2008;18: 248e53. Xia JJ, Pei LB, Zhuang JP, Ji Y, Xu GP, Zhang ZP, et al. Celecoxib inhibits bcatenin-dependent survival of the human osteosarcoma MG-63 cell line. J Int Med Res 2010;38:1294e304. Bonewald LF, Johnson ML. Osteocytes, mechanosensing and Wnt signaling. Bone 2008;42:606e15. Park J, Bauer S, von der Mark K, Schmuki P. Nanosize and vitality: TiO2 nanotube diameter directs cell fate. Nano Lett 2007;7:1686e91. O’Brien WT, Harper AD, Jove F, Woodgett JR, Maretto S, Piccolo S, et al. Glycogen synthase kinase-3b haploinsufficiency mimics the behavioral and molecular effects of lithium. J Neurosci 2004;24:6791e8. Galli C, Piemontese M, Lumetti S, Manfredi E, Macaluso GM, Passeri G. GSK3binhibitor lithium chloride enhances activation of Wnt canonical signaling and osteoblast differentiation on hydrophilic titanium surfaces. Clin Oral Implants Res doi:10.1111/j.1600-0501.2012.02488.x, in press. Han P, Wu C, Chang J, Xiao Y. The cementogenic differentiation of periodontal ligament cells via the activation of Wnt/b-catenin signalling pathway by Liþ ions released from bioactive scaffolds. Biomaterials 2012; 33:6370e9. Zhao L, Wang H, Huo K, Cui L, Zhang W, Ni H, et al. Antibacterial nanostructured titania coating incorporated with silver nanoparticles. Biomaterials 2011;32:5706e16.
Contents lists available at SciVerse ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
The role of the Wnt/b-catenin pathway in the effect of implant topography on MG63 differentiation Wei Wang a,1, Lingzhou Zhao b,1, Qianli Ma a,1, Qintao Wang b, Paul K. Chu c, *, Yumei Zhang a, * a
Department of Prosthetic Dentistry, School of Stomatology, The Fourth Military Medical University, No. 145 West Changle Road, Xi’an 710032, China Department of Periodontology and Oral Medicine, School of Stomatology, The Fourth Military Medical University, No. 145 West Changle Road, Xi’an 710032, China c Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 11 July 2012 Accepted 29 July 2012 Available online 11 August 2012
Wnt/b-catenin signaling plays a key role in bone formation. To assess the role of this signaling cascade in the response of osteoblasts to the implant topography, human MG63 osteoblasts are cultured on micropitted/nanotubular surface topographies (MNTs) and the transcriptional expressions of Wnt/bcatenin pathway receptors, activators, and inhibitors are measured. b-catenin signaling and cell differentiation are studied in the absence and presence of exogenous Dickkopf 1 (Dkk1) on the MNTs and exogenous Wnt3a on a smooth surface. The expressions of the Wnt/b-catenin pathway receptor lowdensity lipoprotein receptor-related protein 6 and pathway ligand Wnt3a are up-regulated by the MNTs whereas those of the pathway inhibitors including Dkk1/2 and secreted frizzled-related protein 1/ 2 are down-regulated by the MNTs, indicating regulation of the Wnt/b-catenin pathway modulators to activate the pathway. Consequently, the b-catenin signaling activity is enhanced by the MNTs as well as cell differentiation in terms of osteogenesis-related gene expressions and alkaline phosphatase and collagen products. On the smooth surface, exogenous Wnt3a stimulates b-catenin signaling and cell differentiation while exogenous Dkk1 attenuates the enhancement by the MNTs. The results explicitly demonstrate that the implant topography regulates the product of the Wnt/b-catenin pathway modulators from the cells and in turn activates the cell Wnt/b-catenin pathway promoting osteoblast differentiation. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: Wnt bcatenin MG63 Differentiation Micro/nano-textured topography
1. Introduction The surface topography of a biomedical implant plays an important role in regulating protein adsorption and cell focal adhesion assembly, which change the intracellular signaling pathways and consequently influence the cell phenotype and overall biological response to the implant [1e3]. Various types of topographies on the micro- and nanoscale have been developed to target better osseointegration [4]. Since the natural bone extracellular matrix (ECM) is composed of nano- to microscale functional blocks, a hierarchical micro/nano-textured topography (MNT) is expected to yield better biological effects. The MNTs combining nanotubes and micropitted topography exhibit more pronounced effects on osteoblast maturation as well as mesenchymal stem cell osteogenic differentiation [5,6]. Nonetheless, the molecular mechanism by
* Corresponding authors. E-mail addresses: [email protected] (P.K. Chu), [email protected] (Y. Zhang). 1 Co-first authors. 0142-9612/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.biomaterials.2012.07.064
which the topographical cue affects the functions of cells and tissues is still not well understood and this has hampered optimization of biomaterials topography. The Wnt/b-catenin pathway which plays an essential role in bone mass and bone cell functions [7e9] is involved in the responses of cells to various stimulants including bone morphogenetic protein (BMP) [10], strain [11], oxygen-related stress [12], and implant surface properties [13]. It has also been shown that the Wnt/b-catenin pathway mediates the biological effects of the implant surface topography [14e16], although how the topographical cues affect the Wnt/b-catenin pathway is not well known. In addition to the direct influence on cell functions through cells/ biomaterials interactions, biomaterials also modulate the cell secretion profiles to indirectly affect cell behaviors via autocrine/ paracrine modes [17]. b-catenin cytosol accumulation and nucleus translocation, the key event of the canonical Wnt pathway activation, are comprehensively modulated by Wnt proteins and a large number of antagonists secreted by cells. The canonical Wnt pathway is initiated by Wnt proteins [18]. Furthermore, there is a large number of antagonists in the Wnt/b-catenin pathway, including the Dickkopf (Dkk) family and secreted frizzled-related
7994
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
protein (sFRP) [19e21]. Hence, the surface topography may influence the osteoblast functionalities by regulating the Wnt/b-catenin pathway modulators secreted from the cells that in turn modulate the cell Wnt/b-catenin pathway. To test the hypothesis, human MG63 osteoblasts are cultured on the MNTs combining the nanotube and micropitted topography and the transcriptional expressions of the Wnt/b-catenin pathway receptors, activators, and inhibitors are measured in this work. The b-catenin signaling and cell differentiation are studied in the presence and absence of exogenous Dkk1 for cells on the MNTs and exogenous Wnt3a for cells on a smooth surface. This study aims at advancing our understanding of the biological effects of implant topographies and providing insight into how implant osseointegration can be systematically enhanced.
2.4. Western blot assay The MG63 cells cultured on the MNTs at a density of 2 104 cells/well were treated with 100 ng/mL of human rhWnt3a, and those on the smooth surface were treated with the Wnt inhibitor human rhDkk1. The culture medium containing either Wnt3a or Dkk1 was changed every 48 h for a total period of 7 days. For total cellular proteins, the cells were lysed in the RIPA buffer (150 mM NaCl, 1% deoxycholate, 50 mM Tris (PH 7.4), 5 mM EDTA, 1% TritonX-100, 1 mM NaF, and 1 mM Na3VO4). Alternatively, the cytosolic and nuclear fractions were prepared using the Nuclear and Cytoplasmatic Extraction Kit (Millipore, Billerica, MA, USA). Equal amounts of extracts were separated by 10% SDS-PAGE and transferred to the polyvinylidene fluoride membrane (Bio-Rad). Blots were blocked for 1 h in 5% bovine serum albumin (BSA, Gibco), followed by incubation with the primary antibodies overnight at 4 C and then the horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody for 1 h at room temperature. Blots were analyzed using Western-Light Chemiluminescent Detection System (Peiqing, China). The monoclonal antibody against b-catenin was purchased from Cell Signaling Technology and monoclonal antibody against aetubulin was acquired from Abcam.
2. Materials and methods
2.5. ALP staining
2.1. Specimen preparation
The Wnt3a and Dkk1 treatment processes were the same as above. The cells were seeded on the substrates at a density of 2 104 cells/well and cultured in the osteogenic medium. The osteogenic medium was supplemented with 10 mM bglycerophosphate (Sigma), 50 mg/mL ascorbic acid (Sigma), and 107 M dexamethasone (Sigma). After culturing for 7 days, the cells were washed with phosphate buffered saline (PBS) and fixed, and ALP staining was performed with the BCIP/NBT alkaline phosphatase color development kit (Beyotime) for 15 min. The stain was washed with PBS thrice and then images were acquired.
Pure titanium (99.9%, 10 10 1 mm3, Northwest Institute for Nonferrous Metal Research, China) was used as the substrate. After polishing with SiC sandpaper from 400 to 1500 grits and ultrasonic cleaning, the samples were treated with 0.5 wt % hydrofluoric acid for 30 min, rinsed with distilled water, and dried. The samples were anodized in an electrolyte containing 0.5 wt % hydrofluoric acid and 1 M phosphoric acid for 1 h with a DC power supply and a platinum cathode at 5 and 20 V to fabricate the MNTs (R-5 and R-20). The polished smooth surface (S) was used as the control. The morphology of the samples was inspected by field-emission scanning electron microscopy (FE-SEM, S-4800, Hitachi, Japan). The samples were sterilized by cobalt 60 before cell plating.
2.2. Cell culture Human MG63 osteoblasts obtained from ATCC company were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin and incubated in a humidified atmosphere of 5% CO2 at 37 C. Only early passage cells were used in the experiments.
2.3. Quantitative real time PCR The MG63 cells were seeded on the samples at a density of 2 104/well and cultured for 3 and 7 days to evaluate the gene expressions of the Wnt3a, Wnt5a, Axin2, low-density lipoprotein receptor-related protein 5 (LRP5), LRP6, sFRP1/2, Dkk1 and Dkk2. The MG63 cells cultured on the MNTs at a density of 2 104 cell/ well were treated with 100 ng/mL of human recombinant (rh) Wnt3a (R&D System), and those on the smooth surface were treated with the Wnt inhibitor human rhDkk1 (R&D System). After total incubation for 7 days, the expressions of runt-related transcription factor 2 (Runx2), alkaline phosphatase (ALP), BMP, and collagen type I (ColI) were determined. The total RNA was isolated using the Trizol reagent (Invitrogen). 1 mg of total RNA was converted to cDNA using the the PrimeScriptÔ RT reagent kit (TaKaRa). The real-time PCR reactions were performed using SYBR Premix ExÔ Taq II (TaKaRa) on the CFX96Ô PCR System (Bio-rad). b-actin was used as a housekeeping gene and the primers are listed in Table 1.
Table 1 Primers used in real time PCR. Gene
Forward primer sequence (50 e30 )
Reverse primer sequence (50 e30 )
Axin2 Wnt3a Wnt5a LRP5 LRP6 sFRP1 sFRP2 Dkk1 Dkk2 Runx2 ALP BMP ColI b-actin
GGAGAAATGCGTGGATACC GTCCCGTCCCTCCCTTTC TCTCAGCCCAAGCAACAAGG TGGATTTGAACTCGGACTC GCAGAGGAGAACTATGAAAGC ATCAGCCAGTCTCAGATGCC AAGGAAAAGCCCACCCGAATC CCAGACCATTGACAACTACC TGACTTGGGATGGCAGAATC CACTGGCGCTGCAACAAGA CCTTGTAGCCAGGCCCATTG CAACACCGTGCTCAGCTTCC TCCACATACCTTTATTCCAGGAATC TGGCACCCAGCACAATGAA
GCTGCTTGGAGACAATGC ACCTCTCTTCCTACCTTTCCC GCCAGCATCACATCACAACAC GGGAAGAGATGGAAGTAGC GTTGGAGGCAGTCAGAGG AAATCGCCGTCTCTCTCAGG ACAACAACCAACCAGACCCAAG CAGGCGAGACAGATTTGC CAGAAATGACGAGCACAGC CATTCCGGAGCTCAGCAGAATAA GGACCATTCCCACGTCTTCAC TTCCCACTCATTTCTGAAAGTTCC CCCGGGTTTAGAGACAACTTC CTAAGTCATAGTCCGCCTAGAAGCA
2.6. Collagen secretion The cell culture and Wnt3a and Dkk1 treatment processes were the same as those in the ALP staining assay. After culturing for 14 days, the cells were washed with PBS, fixed in 4% paraformaldehyde, and stained for collagen secretion in 0.1 wt % sirius red (Sigma) in saturated picric acid for 18 h. The unbound stain was washed with 0.1 M acetic acid before images were taken. In the quantitative analysis, the stain on the specimens was eluted in 500 mL of destain solution (0.2 M NaOH/ methanol 1:1) and the optical density at 540 nm was measured on a spectrophotometer (Bio-tek, Germany). 2.7. Cell viability assay The cell culture and Wnt3a and Dkk1 treatment processes were the same as those in the Western blot assay. After culturing for 3 and 7 days, the cell vitality was assessed by the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay. At the prescribed time points, the samples were rinsed thrice by PBS and transferred to new 24 well culture plates. The MTT solution was added and the samples were incubated at 37 C to allow formazen formation, which was dissolved with dimethyl sulfoxide. The optical density was measured at 490 nm on the spectrophotometer. 2.8. Cell apoptosis analysis The cell culture and Wnt3a and Dkk1 treatment procedures were the same as those in the Western blot assay. To determine cell apoptosis, an apoptosis detection kit (BD Pharmingen) was used. After culturing for 3 days, the cells were trypsinized, washed with PBS, and resuspended in binding buffer at 1 106 cells/mL. 500 mL of the cell suspension was added to a flow tube and then 5 mL annexin V-FITC and 10 mL propidium iodide were added to each tube. After incubation in dark at room temperature for 10 min, fluorescence was measured immediately on a flow cytometer (FACSVantage SE, BD Biosciences). 2.9. Statistical analysis All data were expressed as means standard deviations from at least three independent experiments. The data were analyzed by one way ANOVA combined with Student-Newman-Keuls post hoc test or Student’s t-test using SPSS 17.0 software (SPSS, USA). A p value of < 0.05 was considered to be significant.
3. Results 3.1. SEM characterization of the MNTs The morphology of the fabricated samples is examined by SEM (Fig. 1). At a low magnification, the smooth surface is relatively flat having parallel grooves, and R-5 and R-20 display a rougher
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
7995
Fig. 1. SEM pictures showing the morphology of the samples.
micropitted morphology. The high-magnification pictures reveal that nanotubes of about 30 and 100 nm are distributed evenly on R5 and R-20, while there is no obvious nanoscale cue on the smooth surface. 3.2. Expressions of Wnt/b-catenin pathway modulators on the MNTs The expressions of Wnt/b-catenin pathway modulators are assessed by real time PCR (Fig. 2). After culturing for 7 days, the Wnt3a expression is significantly increased by the MNTs, while that of Wnt5a is not. The Axin2 expression shows no discernible difference among the samples. With regard to the Wnt receptors, the expression of LRP5 displays no significant difference among the surfaces, but that of LRP6 is enhanced by the MNTs at day 3. The expressions of Wnt/b-catenin pathway inhibitors including sFRP1, sFRP2, Dkk1, and Dkk2 are down-regulated by the MNTs.
MNTs are 2 folds higher than those on the smooth surface, but those on R-5 and R-20 show no obvious difference. 3.4. Effect of exogenous Dkk1 or Wnt3a on b-catenin signaling activity In the presence and absence of exogenous Dkk1 for cells on the MNTs and exogenous Wnt3a for cells on the smooth surface for 7 days, the nuclear b-catenin levels are assessed by Western blot to determine the activation of b-catenin signaling (Fig. 4). The exogenous Wnt3a induces one-fold increase in the nuclear b-catenin amount on the smooth surface. In comparison, the exogenous Dkk1 dramatically decreases the nuclear b-catenin amounts on the MNTs to a level similar to that on the smooth surface in the absence of Wnt3a. 3.5. Effect of exogenous Dkk1 or Wnt3a on osteogenesis-related gene expressions
3.3. b-Catenin signaling activation on the MNTs The nuclear amount of b-catenin which is the marker for the bcatenin signaling activation is examined by Western blot after incubation for 7 days (Fig. 3). The nuclear b-catenin levels on the
In the absence and presence of exogenous Dkk1 for cells on the MNTs and exogenous Wnt3a for cells on the smooth surface for 7 days, the osteogenesis-related gene expressions are monitored by real time PCR (Fig. 5). The ALP and BMP mRNA expressions are
7996
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
Fig. 2. Wnt pathway gene expressions by MG63 cells after incubation of 3 and 7 days of culture on the samples (a p < 0.05 compared to smooth surface, b p < 0.05 compared to R-5).
obviously enhanced by the MNTs, especially R-20, and the Runx2 and ColI expressions are also slightly promoted by the MNTs. The exogenous Wnt3a significantly increases the expressions of osteogenesis-related genes on the smooth surface to levels comparable to those on the MNTs in the absence of Dkk1. Dkk1 significantly ablates the enhanced osteogenesis-related gene expressions by the MNTs to be similar to or even slightly lower than those on the smooth surface.
3.7. Collagen secretion Cell collagen secretion in the absence and presence of exogenous Dkk1 or Wnt3a is quantified by Sirius Red staining (Fig. 7). The MNTs lead to obviously more collagen secretion than the smooth surface. Exogenous Wnt3a dramatically promotes collagen secretion by one fold on the smooth surface. On the other hand, the elevated collagen secretion by the MNTs is greatly attenuated by the exogenous Dkk1 and this effect is more evident on R-20.
3.6. ALP staining 3.8. Cell viability The cell ALP product in the presence and absence of exogenous Wnt3a or Dkk1 is stained (Fig. 6). The MNTs induce significantly higher ALP amounts than the smooth surface. Wnt3a significantly increases the cell ALP product on the smooth surface and Dkk1 largely attenuates the enhanced cell ALP product by the MNTs.
In the presence and absence of exogenous Wnt3a or Dkk1, the cell viability on the samples during the first 7 days of incubation is assessed (Fig. 8). The MNTs induce no obvious difference in the cell viability compared to the smooth surface. The exogenous Wnt3a shows no effect on the cell vitality on the smooth surface, while the
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
7997
apoptosis compared to the smooth surface. The exogenous Wnt3a or Dkk1 do not influence cell apoptosis on the smooth surface or the MNTs. 4. Discussion
Fig. 3. Western blot and semi-quantitative analysis of b-catenin signaling activation in MG63 cells on the samples after incubation for 7 days. atubulin is used as a control for equal loading. a p < 0.05 compared to each untreated group.
exogenous Dkk1 produces differential effects on the cell vitality in terms of different nanotubular diameters. Reduced cell viability is observed from R-5 in response to Dkk1, while the cell viability on R-20 is not affected by Dkk1. 3.9. Cell apoptosis analysis The proportion of apoptotic cells on each surface is measured by flow cytometer in the absence and presence of exogenous Wnt3a or Dkk1 for 3 days (Fig. 9). The MNTs do not lead to obvious cell
Fig. 4. Western blot and semi-quantitative analysis of nuclear b-catenin levels in the MG63 cells cultured on the samples for 7 days. The cells on the MNTs are treated with exogenous Dkk1 and those on the smooth surface are treated with exogenous Wnt3a. atubulin is used as a control for equal loading. a p < 0.05 compared to each untreated group.
The proper implant surface topographies such as the MNTs have been found to deliver enhanced osteogenic properties [5,6,22], but the biological mechanisms responsible for these findings are still not well understood. In this study, we find that the MNTs enhance MG63 cell differentiation in terms of up-regulating the osteogenesis-related gene expressions and enhancing the ALP and collagen product. These effects are related to the enhancement in the Wnt3a expression as well as inhibition in the expressions of Wnt/b-catenin pathway inhibitors including sFRP1, sFRP2, Dkk1 and Dkk2 and consequent b-catenin signaling activation. On the smooth surface, the exogenous Wnt3a significantly enhances bcatenin signaling and cell differentiation. The exogenous Dkk1 obviously attenuates enhanced b-catenin signaling and cell differentiation by the MNTs. Hence, the topography of the biomaterials can enhance the expressions of Wnt protein and its receptor while simultaneously inhibiting the Wnt pathway inhibitor expressions to activate the Wnt/b-catenin pathway and promote osteoblast differentiation (Fig. 10). The MNTs significantly enhance MG63 cell differentiation in terms of the higher mRNA expressions of Runx2, ALP, BMP and ColI as well as the more ALP and collagen product. Runx2 is a transcription factor essential to osteoblast differentiation [23]. The ALP regulate phosphate metabolism via hydrolyzation of phosphate esters and is an early marker for osteoblast differentiation [24]. BMP that belongs to the TGF-b superfamily is essential to osteogenic differentiation and bone formation [25]. ColI is the main ECM protein in bones [26] and one of the most widely recognized biochemical markers in osteoblast differentiation. Up-regulation of the expressions of these genes demonstrates the promoting effects of the MNTs on osteoblast differentiation. This is further corroborated by the larger amounts of ALP and collagen product on the MNTs. The present results are in line with our previous observation that the MNTs significantly promote primary osteoblast differentiation [6]. The Wnt/b-catenin pathway is an important regulator of bone formation through action on cells of the osteoblast lineage and essentially each step of the osteogenic process can be affected by this pathway [8]. The Wnt/b-catenin pathway is stimulated by Wnt proteins, which binding to the Frizzled (FZD) receptor and the coreceptor LRP5/6 leads to activation of Dishevelled and thus inhibition of a complex comprising Axin, glycogen synthase kinase 3b (GSK3b), and adenomatous polyposis coli. Consequently, GSK3b is unable to phosphorylate b-catenin and instead, b-catenin accumulates in the cytoplasm, translocates into the nucleus to react with the transcription factor T cell factor (TCF), and to activate target genes [18]. There is a number of endogenous Wnt antagonists including the Dkk family and sFRPs. Dkk1 and Dkk2 bind to LRP5/6 and prevent the formation of the WnteFZDeLRP complex to inhibit the canonical Wnt signaling pathway [19,20]. sFRPs possess a cysteine-rich domain similar to FZD and they act either by binding directly to the Wnt proteins or forming dimers with FZD to form non-functional complexes thereby inhibiting the Wnt/b-catenin pathway [21]. We study whether the expressions of these Wnt/b-catenin pathway modulators are influenced by the MNTs. The Wnt receptor LRP6 that is required for bone formation [27] is up-regulated by the MNTs. Interestingly, the expression of the Wnt/ b-catenin pathway activator Wnt3a is enhanced by the MNTs, while that of the non-canonical Wnt pathway activator Wnt5a is not affected. On the contrary, the mRNA levels of the Wnt antagonists
7998
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
Fig. 5. Real time PCR analysis of Runx2, ALP, BMP and Col1 expressions in MG63 cells after 7 days of incubation on the samples. The cells on the MNTs were treated with exogenous Dkk1 and those on the smooth surface were treated with exogenous Wnt3a. a p < 0.05 compared to each untreated group.
Fig. 6. ALP staining of the MG63 cells after culturing for 7 days in the osteogenic differentiation medium. The cells on the MNTs are treated with exogenous Dkk1 and those on the smooth surface are treated with exogenous Wnt3a.
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
7999
Fig. 7. Optical images and colorimetric quantification of collagen secretion by MG63 cells cultured in osteogenic medium for 14 days. The cells on the MNTs are treated with exogenous Dkk1 and those on the smooth surface are treated with exogenous Wnt3a. a p < 0.05 compared to each untreated group.
sFRP1, sFRP2, Dkk1 and Dkk2 are all depressed. The Western blot assay results verify the activation of b-catenin signaling. Hence, the MNTs promote osteoblast differentiation by, at least partly, the dual effects of enhancing the expressions of the Wnt protein and receptor and inhibiting the Wnt inhibitor expressions to activate bcatenin signaling. These results are consistent with the previous findings of higher LRP5 expression and decreased Dkk1 expression in MC3T3 cells cultured on silicon incorporated porous TiO2 coating [15]. However, on microstructured titanium surfaces, reduced Wnt3a expression, increased non-canonical Wnt pathway ligand Wnt5a, and increased Dkk2 secretion by osteoblasts have been reported [2,28e30]. The contradiction appears to arise from the difference in sample topography. Compared to the microstructured titanium surfaces, the MNTs in our study have nanostructured cues and the nanocues have been shown to significantly induce b-catenin signaling [31,32]. The biomaterials not only affect cell functions directly through cells/biomaterials interaction, but also modulate the cell microenvironment by influencing the cell secreting profiles to affect the cell behavior indirectly [17]. Our present results indicate that the MNTs
Fig. 8. MTT assay for MG63 cell viability after culturing for 3 and 7 days on different samples. The cells on the MNTs are treated with exogenous Dkk1 and those on the smooth surface are treated with exogenous Wnt3a. a p < 0.05 compared to each untreated group.
8000
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
Fig. 9. Analysis of MG63 cell apoptosis on the samples in the presence and absence of Dkk1 for cells on the MNTs and Wnt3a for cells on the smooth surface. The lower left quadrant contains viable cells, the upper left quadrant contains PI-positive cells, and the two right quadrants contain annexin-V positive cells. The apoptotic cells are located in the two right quadrants.
Fig. 10. Schematic diagram showing the details of the Wnt/b-catenin that mediates the effect of the topography on osteoblast differentiation. The topographical cue up-regulates the Wnt3a expression and inhibits the Dkk1/2 and sFRP1/2 expressions, which in turn activates the cell Wnt/b-catenin signaling in the autocrine/paracrine modes to promote cell differentiation.
W. Wang et al. / Biomaterials 33 (2012) 7993e8002
may modulate the Wnt modulators in the microenvironment around the cell consequently leading to activation of the Wnt/bcatenin pathway through the autocrine/paracrine modes. Actually, it has been demonstrated that the Wnt autocrine/paracrine loop mediates the effect of BMP-2 in pre-osteoblastic cells [10]. For verification, we study whether the exogenous Wnt3a can enhance cell differentiation on the smooth surface. Wnt3a increases the b-catenin signaling activity on the smooth surface to a level slightly higher than those on the MNTs. Consequently, osteoblast differentiation is also significantly enhanced by Wnt3a. At the same time, we study whether the Wnt inhibitor Dkk1 influences the enhancing effect of the MNTs on osteoblast differentiation. As expected, Dkk1 attenuates the enhanced b-catenin signaling activity on the MNTs, and this is in line with the widely reported effect of Dkk1 [33]. Furthermore, the enhanced expressions of the osteogenesis-related genes, ALP product, and collagen secretion by the MNTs are significantly reduced by Dkk1. The data definitely confirm our hypothesis demonstrating that the osteoblast differentiation promoting effect of the MNTs is mediated by the cell secreted Wnt modulators in terms of enhancing Wnt protein secretion and inhibiting product of Wnt/b-catenin pathway inhibitors (Fig. 10). Since the Wnt/b-catenin pathway is reported to have regulating effects on cell viability and cell apoptosis [34e36], we investigate the effects of the MNTs on them and the role of the Wnt/b-catenin pathway in these events. The MNTs do not obviously alter the cell viability. We monitor the changes in the cell viability after manipulating the b-catenin signaling activity by exogenous Wnt3a or Dkk1. The exogenous Wnt3a does not affect the cell viability on the smooth surface and Dkk1 does not produce any obvious difference in the cell viability on R20 but surprisingly, it causes significant decrease in the cell vitality on R-5. Olivares-Navarrete et al. have found that Dkk1 has no effect on the MG63 cell number on microstructured surface [30]. Dkk1 shows a surface dependent effect on osteoblast viability and only has effects on nanotubes of a smaller tube size. Park et al. have reported that nanotubes with increasing tube size induce higher rates of cell apoptosis [37]. However, our results show that on all the samples, the cell apoptosis rates are small and no significantly difference is observed from the MNTs and smooth surface. These results are consistent with by our recent report that nanotubes support mesenchymal stem cell proliferation and osteogenic differentiation without inducing obvious cell death [5]. It is suggested that the different serum concentrations in the cell culture in the different studies may account for the inconsistent results (2% used by Park et al and 10% by us) [5,37]. In our studies, the 10% serum used in the cell culture leads to abundant proteins adsorbed onto the nanotubes thereby supporting cell functions without cell apoptosis [5]. Wnt3a or Dkk1 show no influence in cell apoptosis on the smooth surface or the MNTs and the small cell apoptosis rate reflects the good cytocompatibility of the MNTs. In this study, we attempt to gain deeper insight into the molecular mechanism associated with the biological effects of the implant surface topography by uncovering the role of Wnt/b-catenin pathway in this process. This is expected to enrich our knowledge about biomaterials modification or biofunctionalization in order to accomplish better clinical performance. For example, Wnt3a may be loaded onto the implant surface and released to enhance osteoblast differentiation. In addition, lithium (Li) ions have been reported to activate the Wnt/b-catenin by inhibiting GSK-3b and enhance osteoblast differentiation [38,39]. They have been incorporated into scaffolds to improve the biological performance [40]. The nanotubes are particularly ideal with respect to loading and delivering inorganic bioactive elements since they are stable and function at low doses thereby generating long-lasting
8001
activity [41]. Hence, Li doped nanotubular structures with controlled Li release behavior may render better biological effects. 5. Conclusion The MNTs enhance MG63 cell differentiation and the mechanism is related to the enhanced expressions of Wnt3a and Wnt receptor LRP6, inhibited expressions of Wnt/bcatenin pathway inhibitors, and consequent b-catenin signaling activation. The exogenous Wnt3a can significantly enhance b-catenin signaling activation and cell differentiation on the smooth surface, and the exogenous Dkk1 attenuates the enhancement of them by the MNTs. The results verify that the topography of the biomaterials can regulate cell secretion of the Wnt modulators to activate the Wnt/ b-catenin pathway in autocrine/paracrine modes thereby promoting osteoblast differentiation. Acknowledgments This work was supported by National Natural Science Foundation of China Nos. 81070862 and 31170915 and Hong Kong Research Grants Council (RGC) General Research Funds (GRF) No. CityU 112510. L. Z. Zhao also thanks the grants from The Fourth Military Medical University. References [1] Schwartz Z, Lohmann CH, Sisk M, Cochran DL, Sylvia VL, Simpson J, et al. Local factor production by MG63 osteoblast-like cells in response to surface roughness and 1,25-(OH)2D3 is mediated via protein kinase C- and protein kinase A-dependent pathways. Biomaterials 2001;22:731e41. [2] Olivares-Navarrete R, Hyzy SL, Park JH, Dunn GR, Haithcock DA, Wasilewski CE, et al. Mediation of osteogenic differentiation of human mesenchymal stem cells on titanium surfaces by a Wnt-integrin feedback loop. Biomaterials 2011;32:6399e411. [3] Wang L, Zhao G, Olivares-Navarrete R, Bell BF, Wieland M, Cochran DL, et al. Integrin b1 silencing in osteoblasts alters substrate-dependent responses to 1,25-dihydroxy vitamin D3. Biomaterials 2006;27:3716e25. [4] Mendonca G, Mendonca DB, Aragao FJ, Cooper LF. Advancing dental implant surface technologyefrom micron- to nanotopography. Biomaterials 2008;29: 3822e35. [5] Zhao L, Liu L, Wu Z, Zhang Y, Chu PK. Effects of micropitted/nanotubular titania topographies on bone mesenchymal stem cell osteogenic differentiation. Biomaterials 2012;33:2629e41. [6] Zhao L, Mei S, Chu PK, Zhang Y, Wu Z. The influence of hierarchical hybrid micro/nano-textured titanium surface with titania nanotubes on osteoblast functions. Biomaterials 2010;31:5072e82. [7] Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, et al. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem 2005;280:33132e40. [8] Liu F, Kohlmeier S, Wang CY. Wnt signaling and skeletal development. Cell Signal 2008;20:999e1009. [9] Tamura M, Nemoto E, Sato MM, Nakashima A, Shimauchi H. Role of the Wnt signaling pathway in bone and tooth. Front Biosci (Elite Ed) 2010;2:1405e13. [10] Rawadi G, Vayssiere B, Dunn F, Baron R, Roman-Roman S. BMP-2 controls alkaline phosphatase expression and osteoblast mineralization by a Wnt autocrine loop. J Bone Miner Res 2003;18:1842e53. [11] Sunters A, Armstrong VJ, Zaman G, Kypta RM, Kawano Y, Lanyon LE, et al. Mechano-transduction in osteoblastic cells involves strain-regulated estrogen receptor alpha-mediated control of insulin-like growth factor (IGF) I receptor sensitivity to ambient IGF, leading to phosphatidylinositol 3-kinase/AKTdependent Wnt/LRP5 receptor-independent activation of beta-catenin signaling. J Biol Chem 2010;285:8743e58. [12] Galli C, Macaluso GM, Piemontese M, Passeri G. Titanium topography controls FoxO/beta-catenin signaling. J Dent Res 2011;90:360e4. [13] Galli C, Passeri G, Ravanetti F, Elezi E, Pedrazzoni M, Macaluso GM. Rough surface topography enhances the activation of Wnt/b-catenin signaling in mesenchymal cells. J Biomed Mater Res A 2010;95:682e90. [14] Vlacic-Zischke J, Hamlet SM, Friis T, Tonetti MS, Ivanovski S. The influence of surface microroughness and hydrophilicity of titanium on the up-regulation of TGFb/BMP signalling in osteoblasts. Biomaterials 2011;32:665e71. [15] Wang Q, Hu H, Qiao Y, Zhang Z, Sun J. Enhanced performance of osteoblasts by silicon incorporated porous TiO2 coating. J Mater Sci Technol 2012;28:109e17. [16] Galli C, Piemontese M, Lumetti S, Ravanetti F, Macaluso GM, Passeri G. Actin cytoskeleton controls activation of Wnt/b-catenin signaling in mesenchymal
8002
[17]
[18] [19]
[20]
[21] [22] [23] [24] [25] [26] [27] [28]
[29]
[30]
W. Wang et al. / Biomaterials 33 (2012) 7993e8002 cells on implant surfaces with different topographies. Acta Biomater 2012;8: 2963e8. Schwartz Z, Olivares-Navarrete R, Wieland M, Cochran DL, Boyan BD. Mechanisms regulating increased production of osteoprotegerin by osteoblasts cultured on microstructured titanium surfaces. Biomaterials 2009;30:3390e6. Miller JR. The Wnts. Genome Biol 2002;3. REVIEWS3001. Li X, Liu P, Liu W, Maye P, Zhang J, Zhang Y, et al. Dkk2 has a role in terminal osteoblast differentiation and mineralized matrix formation. Nat Genet 2005; 37:945e52. van der Horst G, van der Werf SM, Farih-Sips H, van Bezooijen RL, Lowik CW, Karperien M. Downregulation of Wnt signaling by increased expression of Dickkopf-1 and -2 is a prerequisite for late-stage osteoblast differentiation of KS483 cells. J Bone Miner Res 2005;20:1867e77. Kawano Y, Kypta R. Secreted antagonists of the wnt signalling pathway. J Cell Sci 2003;116:2627e34. Wennerberg A, Albrektsson T. Effects of titanium surface topography on bone integration: a systematic review. Clin Oral Implants Res 2009;20:172e84. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747e54. Whyte MP. Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocr Rev 1994;15:439e61. Hoffmann A, Gross G. BMP signaling pathways in cartilage and bone formation. Crit Rev Eukaryot Gene Expr 2001;11:23e45. Viguet-Carrin S, Garnero P, Delmas PD. The role of collagen in bone strength. Osteoporos Int 2006;17:319e36. Bodine PV, Komm BS. Wnt signaling and osteoblastogenesis. Rev Endocr Metab Disord 2006;7:33e9. Olivares-Navarrete R, Hyzy SL, Hutton DL, Dunn GR, Appert C, Boyan BD, et al. Role of non-canonical Wnt signaling in osteoblast maturation on microstructured titanium surfaces. Acta Biomater 2011;7:2740e50. Chakravorty N, Ivanovski S, Prasadam I, Crawford R, Oloyede A, Xiao Y. The microRNA expression signature on modified titanium implant surfaces influences genetic mechanisms leading to osteogenic differentiation. Acta Biomater 2012;8:3516e23. Olivares-Navarrete R, Hyzy S, Wieland M, Boyan BD, Schwartz Z. The roles of Wnt signaling modulators Dickkopf-1 (Dkk1) and Dickkopf-2 (Dkk2) and cell
[31]
[32]
[33]
[34] [35]
[36] [37] [38]
[39]
[40]
[41]
maturation state in osteogenesis on microstructured titanium surfaces. Biomaterials 2010;31:2015e24. Schernthaner M, Reisinger B, Wolinski H, Kohlwein SD, Trantina-Yates A, Fahrner M, et al. Nanopatterned polymer substrates promote endothelial proliferation by initiation of b-catenin transcriptional signaling. Acta Biomater 2012;8:2953e62. Yu W, Zhang Y, Xu L, Sun S, Jiang X, Zhang F. Microarray-based bioinformatics analysis of osteoblasts on TiO2 nanotube layers. Colloids Surf B Biointerfaces 2012;93:135e42. Liu N, Shi S, Deng M, Tang L, Zhang G, Ding B, et al. High levels of b-catenin signaling reduce osteogenic differentiation of stem cells in inflammatory microenvironments through inhibition of the noncanonical Wnt pathway. J Bone Miner Res 2011;26:2082e95. Bodine PV. Wnt signaling control of bone cell apoptosis. Cell Res 2008;18: 248e53. Xia JJ, Pei LB, Zhuang JP, Ji Y, Xu GP, Zhang ZP, et al. Celecoxib inhibits bcatenin-dependent survival of the human osteosarcoma MG-63 cell line. J Int Med Res 2010;38:1294e304. Bonewald LF, Johnson ML. Osteocytes, mechanosensing and Wnt signaling. Bone 2008;42:606e15. Park J, Bauer S, von der Mark K, Schmuki P. Nanosize and vitality: TiO2 nanotube diameter directs cell fate. Nano Lett 2007;7:1686e91. O’Brien WT, Harper AD, Jove F, Woodgett JR, Maretto S, Piccolo S, et al. Glycogen synthase kinase-3b haploinsufficiency mimics the behavioral and molecular effects of lithium. J Neurosci 2004;24:6791e8. Galli C, Piemontese M, Lumetti S, Manfredi E, Macaluso GM, Passeri G. GSK3binhibitor lithium chloride enhances activation of Wnt canonical signaling and osteoblast differentiation on hydrophilic titanium surfaces. Clin Oral Implants Res doi:10.1111/j.1600-0501.2012.02488.x, in press. Han P, Wu C, Chang J, Xiao Y. The cementogenic differentiation of periodontal ligament cells via the activation of Wnt/b-catenin signalling pathway by Liþ ions released from bioactive scaffolds. Biomaterials 2012; 33:6370e9. Zhao L, Wang H, Huo K, Cui L, Zhang W, Ni H, et al. Antibacterial nanostructured titania coating incorporated with silver nanoparticles. Biomaterials 2011;32:5706e16.