The role of Y84 on domain 1 and Y87 on domain 2 of Paragonimus westermani taurocyamine kinase: Insights on the substrate binding mechanism of a trematode phosphagen kinase

Experimental Parasitology 135 (2013) 695–700

Contents lists available at ScienceDirect

Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr

The role of Y84 on domain 1 and Y87 on domain 2 of Paragonimus westermani taurocyamine kinase: Insights on the substrate binding mechanism of a trematode phosphagen kinase Blanca R. Jarilla a,b, Shinji Tokuhiro a, Mitsuru Nagataki a, Kouji Uda c, Tomohiko Suzuki c, Luz P. Acosta b, Takeshi Agatsuma a,⇑ a

Department of Environmental Health Sciences, Kochi University, Kochi 783-8505, Japan Department of Immunology, Research Institute for Tropical Medicine, Muntinlupa 1781, Philippines c Laboratory of Biochemistry, Faculty of Science, Kochi University, Kochi 780-8520, Japan b

h i g h l i g h t s

g r a p h i c a l a b s t r a c t

 Paragonimus westermani

taurocyamine kinase has unique substrate binding mechanism.  Y84 on D1 and Y87 on D2 of P. westermani TK do not control substrate specificity.  Residues Y84 and Y87 have significant role in enhancement of taurocyamine binding.  A59 on D1 and A62 on D2 on the GS region of are also important in substrate binding.

a r t i c l e

i n f o

Article history: Received 23 August 2013 Received in revised form 18 October 2013 Accepted 23 October 2013 Available online 30 October 2013 Keywords: Phosphagen kinase Taurocyamine kinase Paragonimus westermani Trematode Site-directed mutagenesis

a b s t r a c t The two-domain taurocyamine kinase (TK) from Paragonimus westermani was suggested to have a unique substrate binding mechanism. We performed site-directed mutagenesis on each domain of this TK and compared the kinetic parameters KmTc and Vmax with that of the wild-type to determine putative amino acids involved in substrate recognition and binding. Replacement of Y84 on domain 1 and Y87 on domain 2 with R resulted in the loss of activity for the substrate taurocyamine. Y84E mutant has a dramatic decrease in affinity and activity for taurocyamine while Y87E has completely lost catalytic activity. Substituting H and I on the said positions also resulted in significant changes in activity. Mutation of the residues A59 on the GS region of domain 1 also caused significant decrease in affinity and activity while mutation on the equivalent position on domain 2 resulted in complete loss of activity. Ó 2013 Elsevier Inc. All rights reserved.

1. Introduction Paragonimiasis is a food-borne trematode infection that affects 22 million people in at least 20 countries (WHO, 2002) Abbreviations: PK, phosphagen kinase; TK, taurocyamine kinase; AK, arginine kinase; CK, creatine kinase; GK, glycocyamine kinase; LK, lombricine kinase. ⇑ Corresponding author. Fax: +81 88 880 2535. E-mail address: [email protected] (T. Agatsuma). 0014-4894/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.exppara.2013.10.008

with 293 million more at risk of infection (Keiser and Utzinger, 2007). At present, paragonimiasis is among the neglected infections but the re-emergence of this disease is predicted due to the globalization of the food supply, movement of people, and changing culinary habits (Blair et al., 2007; Dorny et al., 2009). Pulmonary paragonimiasis in East, Southeast, and South Asia is commonly caused by Paragonimus westermani (Blair et al., 2007). Humans are infected by ingesting metacercariae present in raw fresh- or brackish-water crabs or crayfish or by eating

696

B.R. Jarilla et al. / Experimental Parasitology 135 (2013) 695–700

raw meat of paratenic hosts such as omnivorous mammals (Miyazake and Habe, 1976). Due to the similarities in pulmonary manifestations, misdiagnoses of paragonimiasis with tuberculosis have been reported (WHO, 2002) necessitating the development of a more sensitive and specific diagnostic tool. The recently identified two-domain taurocyamine kinase from P. westermani (Jarilla et al., 2009), an enzyme not found in the mammalian host, has a potential in the development of new diagnostic tools for the detection of paragonimus infection. Furthermore, this TK may also be a novel drug target (Jarilla and Agatsuma, 2010) though its precise physiological role in P. westermani has yet to be elucidated. Taurocyamine kinase (TK) is a member of a highly conserved family of phosphotransferases that plays a significant role in the maintenance of energy homeostasis in cells having high and variable rates of ATP turnover. These enzymes, also known as phosphagen kinases, catalyze the reversible transfer of a phosphate between ATP and naturally occurring guanidino compounds (Ellington, 2001). In addition to TK, the seven other PKs identified thus far are as follows: creatine kinase (CK), arginine kinase (AK), hypotaurocyamine kinase (HTK), glycocyamine kinase (GK), thalessemine kinase (ThK), opheline kinase (OK), and lombricine kinase (LK) (Robin, 1974; Thoai, 1968; Morrison, 1973). CK is the only PK in vertebrates while AK is widely distributed among invertebrates, being present in deuterostomes, protostomes, basal metazoans, some protozoans (Uda et al., 2006). HTK is distributed only in sipunculid worms (Uda et al., 2005a) while GK, LK, OK, and ThK are found in annelids or annelid-allied worms (Robin, 1974; Thoai, 1968). At present TKs were also reported from annelids such as the lugworm Arenicola brasiliensis (Uda et al., 2005b) and the giant tube worm Riftia pachpytila (Uda et al., 2005c), from the trematodes Schistosoma japonicum (Tokuhiro et al., 2013), and Schistosoma mansoni (Awama et al., 2008), and also from the protozoa Phytophthora infestans (Uda et al., 2013). Compared to AKs and CKs, the structure and substrate binding mechanism in TKs are not yet well elucidated. Currently, only preliminary X-ray analysis and structure determination was done for S. mansoni TK (Awama et al., 2008). Investigation on amino acid residues responsible for substrate binding has also been done for mitochondrial TK isoform from A. brasiliensis (Tanaka et al., 2011). Mitochondrial and cytoplasmic TK isoforms from annelids show considerable activity for other guanidine substrates such as lombricine and glycocyamine suggesting flexibility in substrate recognition (Uda et al., 2005b,c). In contrast, the two-domain TKs from the lung fluke P. westermani (Jarilla et al., 2009) and the blood fluke S. japonicum (Tokuhiro et al., 2013) exhibited strong affinity and significant activity only for the substrate taurocyamine. These trematode TKs may have evolved from a molluscan AK gene (Jarilla et al., 2013) while annelid TKs were suggested to evolve from a CKrelated gene (Tanaka et al., 2007). It was also suggested that trematode TKs might have unique substrate binding mechanism due to the unique number of deletions on the guanidine specificity (GS) region (Jarilla et al., 2009). The GS region, located on the N-terminal domain, is proposed to have a significant role in substrate recognition and the number of deletions on this region is inversely correlated with the size of the phosphagen substrate used (Suzuki et al., 1997). Also proposed to be significant in substrate recognition is the amino acid at position 95 close to the GS region (Edmiston et al., 2001; Uda et al., 2009). Amino acid residue at this position is highly conserved for each PK; annelid cytoplasmic and mitochondrial TKs have histidine and lysine residues, respectively, at the said position (Uda et al., 2009). However, for P. westermani TK, the residue at the equivalent position (positions 84 and 87 in P. westermani TK domains 1 and 2, respectively) is tyrosine which is conserved among arginine kinases from various species (Jarilla et al., 2009; Jarilla et al., 2013).

Here we report the results of preliminary study on the putative amino acids involved in substrate binding in P. westermani TK. We investigated the role of tyrosine at positions 84 of domain 1 and 87 of domain 2 of the two-domain P. westermani TK. Through site-directed mutagenesis, we replaced Y84 and Y87 with residues H, I, R found in other PKs and with E. Changing of the tyrosine residue at the said positions caused a significant decrease in the activity for taurocyamine. We further examined putative amino acid residues on the GS region of each domain that could be involved in substrate binding.

2. Materials and methods 2.1. Site-directed mutagenesis of P. westermani TK D1 and D2 The pMAL-c2 plasmids inserted with PwTKD1 and D2 (Jarilla et al., 2009) were used as templates for PCR site-directed mutagenesis. Primers used for construction of mutants for each domain are listed on Table 1. The mutations were introduced using the KOD+ DNA polymerase (TOYOBO, Tokyo, Japan) under the following thermal cycling conditions: initial denaturation at 94 °C for 2 min, followed by 35 cycles of 94 °C for 15 s, annealing at 60 °C for 30 s and extension at 68 °C for 9 min and a final extension at 72 °C for 5 min. The PCR products were digested with DpnI and the target DNA was purified using the QIA quick purification column (Qiagen, USA). Before self-ligation and cloning, blunting and kination of the mutated cDNA was done at 37 °C for 1 h using the T4 polynucleotide kinase (Takara, Kyoto, Japan). The intented mutations were confirmed by sequencing using the Big Dye Terminators v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA). After the mutation has been confirmed, the maltose binding protein (MBP)-phosphagen kinase fusion protein was expressed in Escherichia coli TB1 cells by induction with 1 mM isopropyl thio-b-D-Galactoside at 25 °C for 24 h. The cells were resuspended in 5 TE Buffer, sonicated, and the soluble protein was extracted. Recombinant TK was purified by affinity chromatography using

Table 1 Primers used for the site-directed mutagenesis of P. westermani TK. Mutant

Primer name

Sequence (50 –30 )

Domain 1 Y84E

PwTKD1_Y84E_For

GAACACAAAGTTCGAGGTCCG

Y84R

PwTKD1_Y84R_For

CGTCACAAAGTTCGAGGTCCG

Y84H

PwKpkD1Y84H_F

CATCACAAAGTTCGAGGTCCG

Y84I

PwKpkD1Y84I_F

ATTCACAAAGTTCGAGGTCCG ATCTTTAATCAACGGATCAAA

G58R

PwKpkD1Y84H_Ra PwPKD1_G58R_For

A59G

PwPKD1_G58R_Rev PwKpkD1A59G_For

I60V

PwKpkD1A59G_Rev PwKpkD1I60V_For PwKpkD1I60V_Rev

GGTATCCTGCCACGTGCGTGC ACCAGGATTGTTTGCATTGTT GTCCTGCCACGTGCGTGCGAT AGCACCAGGATTGTTTGCATT

Domain 2 Y87E

PwTKD1_Y87E_For

GAACACGACGTGAAAGACCCT

Y87R

PwTKD1_Y87R_For

CGCCACGACGTGAAAGACCCT

Y87H

PwKpkD2Y87H_F

CACCACGACGTGAAAGACCCT

Y87I

PwKpkD2Y87I_F

ATCCACGACGTGAAAGACCCT ATCACAAATCACAGCATCCAA

R61L

#PwKpkD2Y87H_R PwPKD2_R61L_For

A62G

PwPKD2_R61L_Rev PwKpkD2A62G_For

I63V

PwKpkD2A62G_Rev PwKpkD1I63V_For PwKpkD1I63V_Rev

a

CGTGCTATCCTGCCACGTGCG AGGATTGTTTGCATTGTTATT

CTGGCAATTTGTCCTCGAACT TGGATTGTATGCACAGTTTCG GGAATTTGTCCTCGAACTGGA CCGTGGATTGTATGCACAGTT GTTTGTCCTCGAACTGGAGAA TGCCCGTGGATTGTATGCACA

Reverse primer for Y84E, R, H, and I; #reverse primer for Y87E, R, H, and I.

B.R. Jarilla et al. / Experimental Parasitology 135 (2013) 695–700

697

Fig. 1. Alignment of guanidine specificity (GS) region of P. westermani TK and selected phosphagen kinases. The GS region is shown in red box and the amino acid proposed to be significant in substrate recognition is in blue box. Mutated amino acids in P. westermani TK are highlighted in green. Highlighted in blue are mutated amino acids in A. brasiliensis MiTK (Tanaka et al., 2011). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

amylose resin (New England Biolabs, MA, USA). SDS–PAGE was used to determine the purity of the expressed protein. The purified enzymes were placed on ice until enzyme activity assay within 12 h.

method in Microsoft Excel or by fitting data directly according to the method of Cleland (1967), using the software written by Dr. R. Viola (Enzyme kinetics Programs, v. 2.0). Protein concentration was estimated from the absorbance at 280 nm (0.77 AU at 280 nm in a 1 cm cuvette corresponds to 1 mg protein/ml).

2.2. Enzyme assay Measurement of enzyme activity was done using the NADHlinked spectrophotometric assay at 25 °C (Morrison and James, 1965) and determined for the forward reaction or phosphagen synthesis (Fujimoto et al., 2005). The reaction mixture (total 1.0 ml) contained 65 mM Tris–HCl, pH 8; 37.5 mM KCl; 12.5 mM Mg-acetate; 1.25 mM phosphoenolpyruvate made up in 100 mM imidazole/HCl, pH 7; 0.25 mM NADH made up in Tris–HCl, pH 8; 0.05 ml of pyruvate kinase/lactate dehydrogenase mixture (2 U each) made up in 100 mM imidazole/HCl, pH 7; 5 mM ATP made up in 100 mM imidazole/HCl, pH 7; and 0.05 ml of recombinant enzyme. The reaction was started by adding 0.05 ml of an appropriate concentration of guanidine substrate (12 mM–100 mM) made up in 100 mM Tris–HCl, pH 8. The initial velocity values were obtained by varying the concentration of guanidine substrate under the fixed concentrations of the ATP. The calculations for the kinetic constants were based on Michaelis–Menten kinetics; a Lineweaver–Burk plot was made and fitted by the least-squares

Table 2 Comparison of kinetic parameters of P. westermani TK wild-type and mutant. KmTc (mM)

Vmax (lmol/min mg protein)

Vmax/km

Domain 1 WT Y84E Y84R Y84H Y84I G58R A59G I60V

0.75 ± 0.07 9.13 ± 0.28 NA 1.76 ± 0.05 1.91 ± 0.29 1.02 ± 0.03 3.54 ± 0.41 1.33 ± 0.33

40.31 ± 2.51 2.35 ± 0.07 NA 29.25 ± 6.93 20.07 ± 5.17 57.66 ± 3.57 17.06 ± 3.52 54.30 ± 22.21

53.75 0.26 NA 16.62 10.51 56.53 4.82 40.82

Domain 2 WT Y87E Y87R Y87H Y87I R61L A62G I63V

0.51 ± 0.04 NA NA NA NA 0.51 ± 0.17 NA 1.19 ± 0.14

21.43 ± 1.75 NA NA NA NA 16.17 ± 2.53 NA 14.10 ± 2.51

42.02 NA NA NA NA 31.71 NA 11.85

NA, no significant activity detected.

3. Results and discussion 3.1. Enzymatic properties of Y84 mutants of domain 1 and Y87 mutants on domain 2 of P. westermani TK All of the four recombinant enzymes of domain 1 Y84 mutants were expressed as soluble proteins. However, Y84H, Y84I, and Y84E mutants showed sufficient activity while for Y84R mutant there was no significant activity detected. The three active Y84 mutants showed activity towards the substrate taurocyamine but did not show any activity for arginine, creatine, and glycocyamine (data not shown). Comparison of kinetic parameters between wild-type and mutants are shown on Table 2 and Fig. 2. Y84E mutant showed a 12-fold increase in KmTc (9.13 mM) compared to the wild-type (0.75 mM) indicating a dramatic decrease in the affinity for taurocyamine of Y84E mutant. This increase in KmTc was accompanied by a decrease in Vmax (6% of the wild-type) and consequently a significant decrease in catalytic efficiency (Vmax/ KmTc) was also observed (0.49% of the wild-type). Similarly, for A. brasiliensis MiTK, K95E mutant exhibited a very low affinity for taurocyamine (15-fold of the wild-type) as well as a decrease in Vmax. It was suggested that the negatively charge side chain of glutamic acid repulse the SO 3 group of taurocyamine (Tanaka et al., 2011). Unlike A. brasiliensis MiTK, which exhibited an increase affinity for taurocyamine for K95H and K95I mutants, both Y84H and Y84I mutants of P. westermani TK D1 showed a decrease in affinity for taurocyamine as indicated by the 2-fold increase in KmTc. Vmax values also decreased, 75% and 50% of the wild-type for Y84H and Y84I, respectively. Though not as dramatic as the Y84E mutant, catalytic efficiency for both mutants also decreased (Vmax/km is 31% and 20% of the wild-type for Y84H and Y87I, respectively). The less drastic change in kinetic parameters for Y84H mutant could be attributed to the circumstance that the residue histidine is conserved among cytoplasmic TKs found in annelids that Y84H mutant still retained activity for taurocyamine. As for the Y84I mutant, replacement of tyrosine with isoleucine that is conserved in GKs was not enough to change the substrate specificity from taurocyamine to glycocyamine.

698

B.R. Jarilla et al. / Experimental Parasitology 135 (2013) 695–700

detected. Abolishment of activity was also observed when the amino acid at the equivalent position (R96) of Danio rerio was replaced with other residues (Uda et al., 2009). 3.2. Insights on the role of Y84 of domain 1 and Y87 of domain 2 of P. westermani TK Amino acid at position 95 in CK, which is equivalent to Y84 of domain 1 and Y87 of domain 2 in P. westermani TK, is close to the GS region, but not involved directly in substrate binding and reaction catalysis (Edmiston et al., 2001). This residue was suggested to be involved in the recognition of specific phosphagen substrates (Edmiston et al., 2001; Uda and Suzuki, 2004). In addition, it may also have a key role in organizing the hydrogen-bond network which offers an appropriate active center for catalysis (Uda et al., 2009). This residue was found to be strictly conserved among phosphagen kinases. However, the corresponding amino acid for this position appears to be variable in TKs identified thus far (boxed in blue in Fig. 1). Annelid cytoplasmic TKs have histidine while MiTKs have lysine at position 95 (Tanaka et al., 2011). The recently identified TKs from the protozoa have tryptophan at the equivalent position (Uda et al., 2013). On the other hand, two-domain TKs from trematodes have tyrosine similar to AKs (Jarilla et al., 2013). It is interesting that P. westermani TK, similar to S. japonicum TK (Tokuhiro et al., 2013) do not have activity for arginine regardless of the conserved tyrosine (Jarilla et al., 2009). Replacement of tyrosine at positions 84 and 87 of domains 1 and 2, respectively, of P. westermani TK with other amino acids has resulted in the reduction or abolishment of enzymatic activity but it did not cause a change in substrate specificity. These suggest that tyrosine plays a significant role in enhancing binding of taurocyamine but it may not be the key residue in distinguishing phosphagen substrates in trematode TKs. This is in contrast with Eisenia LK in which substrate specificity is strongly controlled by the residue lysine at position 95 (Tanaka and Suzuki, 2004). 3.3. Mutagenesis of amino acids on the GS region of domains 1 and 2 of P. westermani TK

Fig. 2. Comparison of kinetic parameters of P. westermani TK Y84 and Y87 mutants. (a) KmTc; (b) Vmax; and (c) Vmax/km.

It appears that changing of tyrosine to arginine at position 84 of P. westermani TK D1 (Y84R) resulted in the abolishment of catalytic activity since enzyme activity for this mutant was not detected. In addition, though arginine is the residue conserved for CKs, CK activity was not detected for this mutant. Likewise, Eisenia LK K95R mutant also did not show any activity for CK (Tanaka and Suzuki, 2004). Changing of the amino acid residue tyrosine at position 87 proves to be more deleterious for the second domain of P. westermani TK since Y87E, H, I, and R mutants lost enzymatic activity for taurocyamine. Activity for other guanidine substrates was also not

X-ray crystal structures of substrate-free as well as transition state forms of both AKs and CKs showed that these enzymes can be divided into two structural domains, a smaller amino-terminal (N-terminal) domain and a carboxyl-terminal (C-terminal) domain (Zhou et al., 1998; Lahiri et al., 2002; Gattis et al., 2004). During substrate binding, a flexible loop from each domain folds over the substrates at the active site resulting to large conformational changes (Zhou et al., 1998) which appear to be necessary in aligning the two substrates for catalysis, configuring the active site only when productive phosphoryl transfer is possible, and excluding water from the active site to avoid wasteful ATP hydrolysis (Zhou et al., 2000). These conformational changes are elicited by the combination of Mg2++ ADP or ATP which are substrates common to all PKs (Forstner et al., 1998). The GS region (box in red Fig. 1) is the substrate specificity loop (residue 61–68) included in the N-terminal domain which moves substantially closer to the phosphagen substrate-binding site (Yousef et al., 2003). The residues S69, G70, and V71 were shown to interact with arginine in Limulus AK (Zhou et al., 1998) while I69 and V71 in CK were identified as key residues in the active center pocket (Lahiri et al., 2002; Novak et al., 2004). This loop has been proposed as a potential candidate for the phosphagen substrate recognition site (Suzuki et al., 1997). There is a proportional relationship between the size of the deletion on the GS region and the mass of the phosphagen substrate utilized. GK which uses the smallest substrate has no deletion while CK has one. LK, AK,

B.R. Jarilla et al. / Experimental Parasitology 135 (2013) 695–700

699

2009). To examine the putative amino acids involved in substrate binding on the GS region of P. westermani TK, we have done the following site-directed mutagenesis for domain 1 (residues highlighted in green in Fig. 1): G58R, A59G, and I60V. For the corresponding positions on domain 2 the following mutations were made: R61L, A62G, and I63V. The said amino acids are mostly conserved among trematode TKs. Comparison of kinetic parameters are shown on Table 2 and Fig. 3. For domain 1, changing of glycine to arginine at position 58 (G58R mutant) only caused a slight decrease in the affinity for taurocyamine (1.02 mM). Interestingly a small increase in Vmax was observed (57.66 lmol/min mg protein), however, Vmax/km value was comparable to that of the wild-type (56.53). For domain 2, all three kinetic parameters for R61L mutant were comparable to that of the wild-type. The same was also observed for Eisenia LK G63D mutant (Tanaka and Suzuki, 2004). In AKs, the conserved amino acid at the equivalent position, aspartic acid, was suggested to be important in stabilizing structure and mediating synergism in substrate binding (Liu et al., 2011). Significant changes in the kinetic parameters were observed for A59G mutant of domain 1. Affinity for the substrate was dramatically decreased as indicated by the 5-fold increase in KmTc. There was also more than 50% decrease in Vmax and consequently catalytic efficiency also dramatically decreased to almost only 9% that of the wild-type. The effect of changing the residue alanine to glycine was more pronounced for the second domain since no significant enzyme activity was observed for A62G mutant. For I60V mutant, only a slight decrease in affinity for the substrate was observed (1.33 mM), Vmax also increased (54.30 lmol/min mg protein) and Vmax/km value decreased (40.82). However, more substantial change in activity was observed for I63V mutant of domain 2, since there was a 2-fold increase in KmTc and also 2-fold decrease in Vmax and consequently the catalytic efficiency was reduced to only 26% that of the wild-type enzyme. In A. brasiliensis MiTK, valine residue at the equivalent position was suggested to be associated in the recognition of phosphagen substrates since mutation of this residue shifted the affinity from taurocyamine to glycocyamine (Tanaka et al., 2011). This was not the case for P. westermani TK, however, since there was no shift in substrate utilization observed. It appears that the residues A59 and A62 in the GS region of domains 1 and 2, respectively, have a key role in substrate binding since mutation of these residues dramatically decreased the activity of P. westermani TK. Isoleucine at positions 60 of domain 1 and position 63 of domain 2 might also has a role in the substrate binding mechanism. On the other hand, the residues G58 and R61 seem to have negligible role in the binding of taurocyamine. 4. Conclusion Fig. 3. Comparison of kinetic parameters of P. westermani TK with mutations on amino acids on the GS region. (a) KmTc; (b) Vmax; and (c) Vmax/km.

and annelid and protozoa TKs, which recognize relatively large substrates, have five amino acid deletions (Suzuki et al., 1997; Uda et al., 2005b). P. westermani TK and other identified trematode TKs have a unique six deletions on this region suggesting that trematode TKs have unique substrate binding mechanisms from other TKs (Jarilla et al., 2009). It is also possible that trematode TKs may interact with a larger guanidine substrate that is yet to be identified (Uda et al., 2013). As mentioned above, P. westermani TK did not show activity for arginine regardless of the conserved Y84 and Y87. This may be partly attributed to the differences in amino acids on the GS region proposed to be significant for binding of arginine (Jarilla et al.,

Two-domain TKs in P. westermani and other trematodes are quite unique from annelid TKs evident not only in evolutionary origin but also in substrate binding mechanisms presented in this work. We showed that Y84 and Y87 residues in P. westermani TK do not control substrate specificity but has significant role in enhancement of the binding of taurocyamine. Residues A59 and A62 on the GS region of each domain are also important in substrate binding. Acknowledgments The authors would like to thank all the staff of the Department of Environmental Health Sciences in Kochi Medical School and the Department of Immunology at the RITM for their encouragement and help. B.R.J. is very grateful to the JSPS-Ronpaku Program.

700

B.R. Jarilla et al. / Experimental Parasitology 135 (2013) 695–700

References Awama, A.M., Paracuellos, P., Laurent, S., Dissous, C., Marcillat, O., Gouet, P., 2008. Crystallization and X-ray analysis of the Schistosoma mansoni guanidine kinase. Acta Crystallogr., Sect. F: Struct. Biol. Cryst. Commun. F64, 854–857. Blair, D., Agatsuma, T., Wang, W., 2007. Paragonimiasis. In: Murrel, K.D., Fried, B. (Eds.), Food-Borne Parasitic Zoonoses: Fish and Plant-Borne Parasites. Springer Science, New York, pp. 117–150. Dorny, P., Praet, N., Deckers, N., Gabriel, S., 2009. Emerging food-borne parasites. Vet. Parasitol. 163, 196–206. Edmiston, P.L., Schavolt, K.L., Kersteen, E.A., Moore, N.R., Borders Jr., C.L., 2001. Creatine kinase: a role for arginine-95 in creatine binding and active site organization. Biochim. Biophys. Acta 1546, 291–298. Ellington, W.R., 2001. Evolution and physiological roles of phosphagen systems. Annu. Rev. Physiol. 63, 289–325. Forstner, M., Kriechbaum, M., Laggner, P., Wallimann, T., 1998. Structural changes of creatine kinase upon substrate binding. Biophys. J. 75, 1016–1023. Fujimoto, N., Tanaka, K., Suzuki, T., 2005. Amino acid residues 62 and 193 play the key role in regulating the synergism of substrate binding in oyster arginine kinase. FEBS Lett. 579, 1688–1692. Gattis, J.L., Ruben, E., Fenley, M.O., Ellington, W.R., Chapman, M.S., 2004. The active site cysteine of arginine kinase: structural and functional analysis of partially active mutants. Biochemistry 43, 8680–8689. Jarilla, B.R., Tokuhiro, S., Nagataki, M., Hung, S., Uda, K., Suzuki, T., Agatsuma, T., 2009. Molecular characterization and kinetic properties of a novel two-domain taurocyamine kinase from the lung fluke Paragonimus westermani. FEBS Lett. 583 (13), 2218–2224. Jarilla, B.R., Agatsuma, T., 2010. Phosphagen kinases of parasites: unexplored chemotherapeutic targets. Korean J. Parasitol. 48 (4), 281–284. Jarilla, B.R., Tokuhiro, S., Nagataki, M., Uda, K., Suzuki, T., Acosta, L.P., Agatsuma, T., 2013. Gene structure of the two-domain taurocyamine kinase from Paragonimus westermani: evidence for a distinct lineage of trematode phosphagen kinases. FEBS Lett. 587 (14), 2278–2283. Keiser, J., Utzinger, J., 2007. Food-borne trematodiasis: current chemotherapy and advances with artemisinins and synthetic trioxolanes. Trends Parasitol. 23 (11), 555–562. Lahiri, S.D., Wang, P., Babbitt, P.C., McLeish, M.J., Kenyon, G.L., Allen, K.N., 2002. The 2.1 Å structure of Torpedo californica creatine kinase complexed with the ADPMg2+-NO3—creatine transition-state analogue complex. Biochemistry 41, 13861–13867. Liu, N., Wang, J.S., Wang, W.D., Pan, J.C., 2011. The interaction between residues 62 and 193 play a key role in activity and structural stability of arginine kinase. Int. J. Biol. Macromol. 49, 402–408. Miyazake, I., Habe, S., 1976. A newly recognized mode of human infection with the lung fluke, Paragonimus westermani (Kerbert 1878). J. Parasitol. 62, 646– 648. Morrison, J.F., 1973. Arginine kinase and other invertebrate guanidine kinases. In: Boyer, P.C. (Ed.), The Enzymes. Academic Press, New York, pp. 457–486. Morrison, J.F., James, E., 1965. The mechanism of the reaction catalyzed by adenosine triphosphate-creatine phosphor-transferase. Biochem. J. 97, 37–52. Novak, W.R., Wang, P.F., McLeish, M.J., Kenyon, G.L., Babbitt, P.C., 2004. Isoleucine 69 and valine 325 form a specificity pocket in human muscle creatine kinase. Biochemistry 43, 13766–71374.

Robin, Y., 1974. Phosphagens and molecular evolution in worms. Biosystems 6, 49– 56. Suzuki, T., Kawasaki, Y., Furukohri, T., Ellington, W.R., 1997. Evolution of phosphagen kinase. VI. Isolation, characterization and cDNA-derived amino acid sequence of lombricine kinase from the earthworm Eisenia foetida, and identification of a possible candidate for the guanidine substrate recognition site. Biochim. Biophys. Acta 1348, 152–159. Tanaka, K., Suzuki, T., 2004. Role of amino-acid residue 95 in substrate specificity of phosphagen kinases. FEBS Lett. 573, 78–82. Tanaka, K., Uda, K., Shimada, M., Takahashi, K., Gamou, S., Ellington, W.R., Suzuki, T., 2007. Evolution of cytoplasmic and mitochondrial phosphagen kinases unique to annelid groups. J. Mol. Evol. 65, 616–625. Tanaka, K., Matsumoto, T., Suzuki, T., 2011. Identification of amino acid residues responsible for taurocyamine binding in mitochondrial taurocyamine kinase from Arenicola brasiliensis. Biochim. Biophys. Acta 1814, 1219–1225. Thoai, V.N., 1968. Homologous phosphagen phosphokinases. In: van Thoai, N., Roche, J. (Eds.), Homologous Enzymes and Biochemical Evolution. Gordon and Breach, NY, pp. 199–229. Tokuhiro, S., Uda, K., Yano, H., Nagataki, M., Jarilla, B.R., Suzuki, T., Agatsuma, T., 2013. Phosphagen kinase in Schistosoma japonicum: characterization of its enzymatic properties and determination of its gene structure. Mol. Biochem. Parasitol. 188 (2), 91–98. Uda, K., Suzuki, T., 2004. Role of the amino acid residues on the GS region of Stichopus arginine kinase and Danio creatine kinase. Protein J. 23 (1), 53–64. Uda, K., Fujimoto, N., Akiyama, Y., Mizuta, K., Tanaka, K., Ellington, W.R., Suzuki, T., 2006. Evolution of the arginine kinase gene family. Comp. Biochem. Physiol. D: Genomics Proteomics 1, 209–218. Uda, K., Hoshijima, M., Suzuki, T., 2013. A novel taurocyamine kinase found in the protist Phytophthora infestans. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 165, 42–48. Uda, K., Iwai, A., Suzuki, T., 2005a. Hypotaurocyamine kinase evolved from a gene for arginine kinase. FEBS Lett. 579, 6756–6762. Uda, K., Kuwasaki, A., Shima, K., Matsumoto, T., Suzuki, T., 2009. The role of Arg-96 in Danio rerio creatine kinase in substrate recognition and active center configuration. Int. J. Biol. Macromol. 44, 413–418. Uda, K., Saishoji, N., Ichinari, S., Ellington, W.R., Suzuki, T., 2005b. Origin and properties of cytoplasmic and mitochondrial isoforms of taurocyamine kinase. FEBS J. 272, 3521–3530. Uda, K., Tanaka, K., Bailly, X., Zal, F., Suzuki, T., 2005c. Phosphagen kinase of the giant tubeworm Riftia pachyptila: cloning and expression of cytoplasmic and mitochondrial isoforms of taurocyamine kinase. Int. J. Biol. Macromol. 37, 54– 60. World Health Organization, 2002. Report: Joint WHO/FAO Workshop on Foodborne Trematode Infections in Asia, Hanoi, Vietnam. . Yousef, M., Clark, S.A., Pruett, P.K., Somasundaram, T., Ellington, W.R., Chapman, M.S., 2003. Induced fit in guanidine kinases – comparison of substrate-free and transition state analog structures of arginine kinase. Protein Sci. 12, 103–111. Zhou, G., Ellington, W.R., Chapman, M.S., 2000. Induced fit in arginine kinase. Biophys. J. 78, 1541–1550. Zhou, G., Somasundaram, T., Blanc, E., Parthasarathy, G., Ellington, W.R., Chapman, M.S., 1998. Transition state structure of arginine kinase: implications for catalysis of bimolecular reactions. PNAS 95, 8449–8454.