- Email: [email protected]
The Saccharomyces cerevisiae histone acetyltransferase gcn5 has a role in the photoreactivation and nucleotide excision repair of UV-induced cyclobutane pyrimidine dimers in the MFA2 gene1
doi:10.1006/jmbi.2001.5383 available online at http://www.idealibrary.com on
J. Mol. Biol. (2002) 316, 489±499
The Saccharomyces cerevisiae Histone Acetyltransferase Gcn5 has a Role in the Photoreactivation and Nucleotide Excision Repair of UV-Induced Cyclobutane Pyrimidine Dimers in the MFA2 Gene Yumin Teng{, Yachuan Yu{ and Raymond Waters* School of Biological Sciences University of Wales Swansea Singleton Park, Swansea SA2 8PP, UK
How DNA repair enzymes or complexes gain access to chromatin is still not understood. Here, we have studied the role of the S. cerevisiae histone acetyltransferase Gcn5 in photoreactivation (PR) and nucleotide excision repair (NER) at the level of the genome, the MFA2 and RPB2 genes, and at speci®c nucleotides within MFA2. The deletion of GCN5 markedly reduced the PR and NER of UV-induced cyclobutane pyrimidine dimers in MFA2 but much less so in RPB2, whereas no detectable defect was seen for repair of the genome overall. In gcn5, the MFA2 mRNA level is reduced by fourfold, while transcription from RPB2 is reduced only to 80 %. These changes in transcription correlate with the changes in NER and PR found in the gcn5 mutant. However, changes in MFA2 transcription cannot account for the decrease in NER in the non-transcribed strand and the control region of MFA2 where global genome repair (GGR) operates. We conclude that the histone acetyltransferase Gcn5 in¯uences PR and NER at MFA2 in both its transcribed and non-transcribed DNA, yet it has little effect on these processes for most of the yeast genome. As a result, we speculate that histone acetylation allows ef®cient access of the repair machinery to chromosomal DNA damages either indirectly via in¯uencing transcription or directly via modifying chromatin structure irrespective of transcription. # 2002 Elsevier Science Ltd.
*Corresponding author
Keywords: nucleotide excision repair; photoreactivation; histone acetylation
Introduction DNA is inevitably exposed to a variety of damaging agents generated from both endogenous and exogenous sources. In order to counteract the deleterious consequences of DNA damaging agents, organisms have developed a well-organized selfdefence system, DNA repair, to protect genome integrity.1 To tackle cyclobutane pyrimidine dimers (CPDs) and 6-4 photoproducts (6-4 PP), two main {These authors contributed equally to this work. Abbreviations used: CPD, cyclobutane pyrimidine dimers; 6-4pp, 6-4 photoproducts; NER, nucleotide excision repair; PR, photoreactivation; NTS, nontranscribed strand; HAT, histone acetyl transferase. E-mail address of the corresponding author: [email protected] 0022-2836/02/030489±11 $35.00/0
forms of UV-induced DNA damage, organisms employ nucleotide excision repair (NER) and photoreactivation (PR). Both these mechanisms have been studied extensively in the yeast Saccharomyces cerevisiae. PR is a unistep process in that photolyase (encoded by the S. cerevisiae PHR1 gene) binds to CPDs and directly reverses them by splitting the linkage between the adjacent pyrimidines with a light-initiated electron transfer reaction.2 ± 5 NER, on the other hand, is a highly versatile and sophisticated repair pathway in which over 30 proteins are involved. It entails damage recognition in the target DNA, sequential assembly of a number of repair protein complexes at the damage site, dual incision of the damagecontaining DNA strand, excision of a short DNA fragment surrounding the damage site, repair syn# 2002 Elsevier Science Ltd.
490 thesis and ligation of the newly synthesized DNA strand.6 ± 9 DNA repair in eukaryotes is in¯uenced by the packaging of DNA into nucleosomes and higherorder chromatin structures. This compacted state makes DNA templates less accessible to DNA-processing proteins and could lower the processivity of enzymes.10 Furthermore, DNA within positioned nucleosomes may well exhibit a restricted ability to be processed by repair enzymes compared to nucleosome-free regions. Indeed, nonhomogeneous repair of CPDs and 6-4 PP by NER and PR was observed in the yeast and mammalian genomes.11,12 Early studies using plasmid DNA or SV40 minichromosomes have shown that overall repair is less ef®cient in chromatin than in naked DNA,13,14 and photoreactivation is more ef®cient in non-nucleosomal and linker regions than in nucleosomal regions.15 Using reconstituted HISAT nucleosomes as model substrates, Schieferstein and Thoma16 found that the access of T4 endonuclease V and Escherichia coli photolyase to CPDs on the surface of reconstituted nucleosomes was inhibited dramatically, although these enzymes targeted naked DNA very ef®ciently. How NER operates in the context of chromatin structure still remains unclear. First, a direct link between nucleosome positioning and chromatin accessibility to repair enzymes has been observed. A high-resolution analysis of NER in yeast minichromosomes demonstrated a modulation of repair by nucleosomes in the non-transcribed strand of an active gene such that slow repair occurred within the ``internal protected region'' of the nucleosomes and fast repair occurred in the linker DNA.17 Similar results were reported in the case of the yeast genomic copy of the URA3 gene.18 Second, there is extensive evidence indicating chromatin remodeling and histone modi®cation during transcription.10,19 This, taken in conjunction with the observation that human NER enzymes require a space of at least 100 bp to ef®ciently excise DNA lesions,20 suggests that nucleosomes might be rearranged or disassembled prior to or during the NER process, a similar multiple-enzyme process to transcription.21,22 In recent years a large number of protein complexes capable of modifying chromatin structure have been identi®ed. These chromatin remodelers fall into two general classes: the ATP-dependent chromatin remodelling complex and the histone acetyltransferases (HATs).23,24 Reversible acetylation of core histones by HATs alleviates the transcriptionally repressive interaction between positively charged histone amino termini and negatively charged DNA and thus provides direct access of the transcription machinery. Multiple studies have provided a direct molecular link between histone acetylation and transcriptional activation.25 ± 27 In S. cerevisiae, Gcn5, one of the HATs, acts as a catalytic subunit in two nucleosomal HAT complexes (ADA and SAGA) that are speci®c for histones H3/H2B.28 Certain lysine resi-
Histone Acetylation and DNA Repair
dues in the tail domain of H3 and H4 are the substrates of the HAT of Gcn5.29 Gcn5 HAT activity is required for Gcn4-mediated transcriptional activation30 and for activation of the PHO8 promoter, as evidenced by the severe reduction in PHO8 transcription exhibited by gcn5 mutants that lack HAT activity yet form normal SAGA complexes.31 This transcription activation by Gcn5 is likely accompanied by chromatin remodelling since the chromatin remodelling at the PHO8 promoter requires SWI/SNF and SAGA at a step subsequent to activator binding.31 Gcn5 induces chromatin recon®guration at the HIS3 promoter in vivo32 and a defective Gcn5 protein can be suppressed by mutations in chromatin components.33 In our previous study of CPD repair at nucleotide resolution in the S. cerevisiae MFA2 gene,34,35 in a-mating type cells, where this gene is transcriptionally active, we observed fast repair in the transcribed region due to transcription-coupled repair (TCR), yet some damage sites are repaired faster than others in the TCR operating region. Where global genome repair (GGR) operates in the NTS of MFA2 and its upstream control region we also observed CPDs are repaired at different rates. The reasons for this repair heterogeneity in vivo are not completely understood. Apart from the transcriptional status, the sequence speci®city, the location of damage, protein binding and the chromatin structure may account for the heterogeneous repair rates observed. To clarify whether histone acetylation, functioning in chromatin remodelling prior to transcription, affects DNA repair, we have undertaken in vivo DNA repair studies with a S. cerevisiae strain carrying a deletion mutation at the GCN5 locus. Here, we describe experiments investigating the roles of Gcn5 in DNA repair by photoreactivation and NER at the level of total cellular DNA, at the level of the gene for the MFA2 and RPB2 loci, and at nucleotide resolution in the MFA2 control and coding sequences.
Results The role of Gcn5 in UV sensitivity The UV sensitivity of a mutant strain can be indicative of the role of a gene in a DNA repair pathway. First we examined the UV sensitivities of the wild-type, the gcn5 mutant and, for comparison, the global NER gene defective strain, rad16 (Figure 1). The gcn5 mutant exhibited a mild UV sensitivity compared with the wild-type strain. At UV doses giving 10 % survival, the rad16 mutant was about fourfold more sensitive than wild-type and 2.5-fold more sensitive than the gcn5 mutant. NER and Photoreactivation of CPDs from the total genome To determine whether deletion of GCN5 affects repair in overall genomic DNA, an analysis of CPD repair using a CPD speci®c antibody was
491
Histone Acetylation and DNA Repair
Figure 1. The UV sensitivity of the strains studied. (}) PSY316; (~) gcn5; (&) rad16.
undertaken. Equal amounts of DNA from unirradiated, or from UV-treated cells and sampled immediately or after certain repair times were incubated against a CPD speci®c antibody. The images were obtained by phosphorimaging and are shown in Figure 2. Quanti®cation was carried out with ImageQuant software (Molecular Dynamics, CA, USA). For NER, both PSY316 and gcn5 cells took 2.4 hours for the removal of 50 % of the CPDs from the whole genome after 75 J/m2 of UV, whereas after 150 J/m2 both strains took 3.9 hours. With respect to PR, it took 33(8) minutes to remove 50 % of CPDs from the whole genome after 150 J/m2 of UV, and, again both strains were equally ef®cient. There was no detectable NER during this period. The results indicate that the PR and NER of CPDs from the whole genome proceed at a rate that is indistinguishable between the GCN5 and gcn5 strains. Thus, neither the NER nor PR enzymatic activity is globally impaired due to the deletion of GCN5. NER and photoreactivation of CPDs at the level of the gene from MFA2 and RPB2 Next we examined the CPD incidence in the NTS of the MFA2 and the RPB2 genes following the strategy developed by Bohr.36 RPB2 was selected as a gene because its transcription was known not be markedly in¯uenced by Gcn537 and it had been used by other groups for DNA repair studies.38 Figure 3 shows typical autoradiographs detecting CPD repair by NER and PR at the gene level with the PSY316 and gcn5 a-mating type strains. The amount of probe bound to the membrane at the position of full length fragments was quanti®ed both in CPD enzyme-treated and mocktreated samples. The ratio of the band densities of samples with or without CPD enzyme treatment denotes the proportion of fragments free of CPDs.
Figure 2. A typical autoradiograph showing the removal of CPDs by NER or PR from genomic DNA. Monoclonal CPD antibodies were used as a probe for the presence of these damages in genomic DNA following exposure of the cells to UV and their subsequent incubation for NER and PR of CPDs at the times indicated (NER in hours; PR in minutes).
Therefore, the amount of CPD repair following various repair times can be calculated and the extents of repair in the NTS of MFA2 and RPB2 are presented in Figure 3. In wild-type cells, 58(4) % of CPDs in the MFA2 NTS were repaired by NER after three hours post UV. For the NTS of RPB2 gene at the same repair time, 22(2) % of the CPDs were removed. In gcn5 cells, the NER of CPDs in the NTS of MFA2 was severely impaired, only 6(3) % of CPDs were repaired after three hours. Whereas for the RPB2 gene at same repair time, 16(4) % of CPDs in the NTS were repaired. Hence the in¯uence of Gcn5 on NER is considerably greater at MFA2 compared to at RPB2. As shown in Figure 3, the photoreactivation of CPDs in the NTS of MFA2 and RPB2 followed the same trend as seen for NER: the in¯uence of Gcn5 on PR was greater at MFA2 than at RPB2. After 60 minutes of photoreactivation, 70(4) % of CPDs in the MFA2 NTS and 32(8) % in the RPB2 NTS were repaired in the wild-type PSY316 cells, while in the gcn5 cells, 30(6) % of CPDs in the NTS of MFA2 and 25(1) % of that in RPB2 were repaired. This paper focuses primarily on the repair of nontranscribed DNA, and because (a) we would be unable to distinguish whether or not changes in the repair of the TS of MFA2 are only due to reduced transcription in gcn5 versus the GCN5 strains shown and (b) the repair differences at RPB2 between gcn5 and GCN5 strains are small, the TS was not analysed at the level of the gene for either MFA2 or RPB2. With respect to MFA2 TS information would be accrued by the high resolution analysis presented next. The repair of CPDs by NER and PR at nucleotide resolution in the MFA2 gene The direct 30 end-labelling technique previously described34 enables us to compare the repair of
492
Histone Acetylation and DNA Repair
Figure 3. Examining NER and PR of CPDs in the NTS of MFA2 by Southern blotting. For the typical autoradiograph, the letter U indicates that the sample is an unirradiated control, and repair times (NER in hours; PR in minutes) are indicated by the ®gures above the bands. CPDs were speci®cally detected by the addition of T4 endonuclease V and repair over a three hour period for NER and 60 minutes for PR are shown graphically. The % repair plotted for NER and PR are the average of at least three experiments.
DNA damage at each individual base. Brie¯y, DNA is subjected to restriction enzyme digestion, generating a fragment of interest. The CPD sites within the fragment were then incised by a CPD speci®c endonuclease. By using an appropriate DNA probe with overhang modi®cation, fragments for different length as a result of CPD incision can be enriched using Dynabeads and a magnetic particle concentrator (MPC). Following incorporation of radioactivity to the 30 end using the overhang in the probe as a template, DNA fragments were eluted from Dynabeads and loaded onto a denaturing sequencing gel. Figure 4 depicts typical images of the gels. The top bands represent the whole restriction fragment free of CPDs, while the bands below indicate a CPD at a single nucleotide position which can be allocated in the genomic DNA sequence if compared to the sequence ladder by the side. The intensity of bands re¯ects the frequency of lesions at individual sites or in polypyrimidine tracts and they can be quanti®ed after phosphorimaging with ImageQuant software. Sitespeci®c damage was calculated as the fraction of signal at a lesion divided by the signal of the whole lane after appropriate subtraction of background. The results are reported in Figure 5 as the time (t50 %) for removing 50 % of the initial CPDs at each site. Here, rather than single CPD between adjacent pyrimidines, sometimes DNA lesions were treated as CPD clusters which appeared as a group of CPDs with close proximity on the gel and which showed a similar repair rate.
In wild-type PSY316 a-cells, as in other repaircompetent cells described in our previous publications,34,39 the NER rate of CPDs in the upstream promoter region of the strand which is transcribed became faster toward the transcription start point except for the TATA box region. The t50 % was 4.2(0.3) hours for one group of CPDs in the Mcm1 binding region, which is positioned at ÿ252 relative to the start point of the coding region. For CPDs at the ÿ46 to ÿ50 region (the transcription start point is at ÿ42), the t50 % was 2(0.2) hours. This enhanced CPD repair in the promoter region slowed down in the TATA box region, where the t50 % for some CPDs sites was around four hours. In the MFA2 transcribed region fastest repair was observed in the TS and the CPDs are repaired by 50 % in two hours. At the transcription termination region, 3.9(0.4) hours were needed to remove 50 % of the CPDs at 318. In gcn5 cells, repair of CPDs was severely impaired compared with the wild-type (Figure 5). In the non-transcribed region of the gcn5 MFA2 TS, i.e. in the upstream control region and downstream transcription termination region, repair presents a very slow or no repair trend. In the MFA2 TS transcribed region, 50 % of CPDs were removed between four and six hours: a two to threefold reduction in repair rate compared to that in wild-type cells. In PSY316 a-cells, most of the CPDs in the NTS were excised by 50 % in four hours. In the upstream control region an enhanced repair rate was observed. The t50 % for CPDs at ÿ95 was 2.2(0.3) hours. This enhanced repair was abol-
493
Histone Acetylation and DNA Repair
ished for CPDs located in the transcribed region. In gcn5 cells, CPDs remained unrepaired or were very slowly repaired in the NTS of the MFA2 transcription region and its upstream control region. The enhanced excision rate observed in the upstream control region of PSY316 did not occur in gcn5 cells. Some of the CPDs in the downstream region of MFA2 were repaired by 50 % in four to eight hours. Photoreactivation of CPDs along a given DNA sequence is very heterogeneous. Photolyase is the only enzyme involved in PR and its function can be modulated by local chromatin structure change in its target. With regard to the RsaI restriction fragment containing the MFA2 gene, the average t50 % was 23(4) minutes for the TS and 23(2) minutes for the NTS in wild-type PSY316 cells. It should be noted that the transcribed sequence of MFA2 covers only part of the RsaI fragment (328 bp out of 869 bp). Hence the observation here of a similar repair rate in the TS and NTS of the RsaI fragment does not contradict the ®nding that RNA polymerase II installation inhibits photolyase from accessing to the transcribed strand of active genes.40 Indeed, in the wild-type cells, photolyase preferentially repaired the non-transcribed strand of the MFA2 coding sequence with an average t50 % of 23(1) minutes over that of the transcribed strand with an average t50 % of 44(7) minutes In contrast, the activity of photolyase on the same RsaI fragment in the gcn5 mutant was severely reduced. The average t50 % increased to 85(2) minutes for the TS and 90(12) minutes for the NTS. The t50 % of CPDs in different regions within the RsaI fragment are summarized in Table 1, from which, the region-speci®c effect of Gcn5 can be seen. We have recently mapped nucleosome positions in the MFA2 gene41 where nucleosome ÿ1 is located at nucleotide positions ÿ207 to ÿ61, and nucleosomes 1 and 2 at positions ÿ59 to 88 and 122 to 254, respectively, while MFA2 is repressed in the a-mating type cells. The pattern change of MNase cutting indicates these positioned nucleosomes are disrupted when MFA2 is transcriptionally active. However we still observed a nucleosome-orientated PR pro®le in the transcribed region of the active MFA2 especially in the nontranscribed strand. In the NTS of MFA2, clusters of
CPDs located around 88 (t50 %: 18(9) minutes in PSY316; 60(3) in gcn5) and 118 (t50 %: 25(1) minutes in PSY316; 72(5) in gcn5) were repaired faster than those around positions 158 (t50 %: 52(10) minutes in PSY316; 74(10) in gcn5) and 193 (t50 %: 49(4) minutes in PSY316; 98(9) in gcn5). Further downstream at positions 255 (t50 %: 8(2) minutes in PSY316; 36(5) in gcn5) and 269 (t50 %: 7(2) minutes in PSY316; 10(0) minutes in gcn5), faster repair was observed again. Since these fast repair regions in a-cells match the positions of linker regions in a-cells, and the slow repair regions in a-cells locate at where the nucleosomal regions exist in a-cells, the nucleosomes we mapped in a-cells at MFA2 may still be attached to the NTS in a-cells in an unstable state which cannot be positioned by Micrococcal nuclease, yet they still modulate photoreactivation.
Gcn5 and transcription from MFA2, RPB2 and PHR1 DNA repair is intimately linked to transcription mediated by RNA polymerase II. We were concerned that the slower repair observed in the MFA2 gene in the gcn5 background was possibly due to down-regulation of MFA2 transcription or to that of the repair genes for NER or PR, although this was unlikely because we observed a local marked effect on repair at MFA2, only a slight effect at RPB2, and no detectable difference in NER or PR from the genome overall. We measured the levels of transcription from the MFA2, PHR1 and RPB2 genes in all strains as shown in Figure 6. The mRNA level of the ACT1 gene was used as a control to adjust for sample loading. In gcn5a cells, the mRNA level of MFA2 was reduced by fourfold compared to the wildtype strain, but transcription is still occurring. Transcription from RPB2 in gcn5 was only reduced to 80 % of its normal level. As the effects of the GCN5 mutation were similar with respect to the PR and NER operating at MFA2, i.e. both events were markedly reduced, we focused on transcription from PHR1 rather than on that from the large number of NER genes. The mRNA level for PHR1 was consistent in all strains tested. Thus the effects seen locally at MFA2 could
Table 1. Average time for repairing 50 % of induced CPDs (t50 %) by PR in different regions of the RsaI restriction fragment TS NTS
PSY316 gcn5 PSY316 gcn5
RsaI fragment overall
MFA2 transcribed region
MFA2 promoter
23 4 85 2 23 2 90 12
44 7 91 6 23 1 104 13
11 2 52 18 20 2 (13 3)a 33 3 (33 3)a
Any t50 % over 60 minutes is extrapolated from extended repair curves. a There are less putative CPD sites in the NTS than in the TS in the promoter of MFA2. In the NTS an intense persistent band indicates CPDs occur that are unrepaired, possibly due to MCM1 binding. This contributes to a slower repair of CPDs to NTS overall in this region compared to TS in the same region. Data in parentheses show average t50 % when this band has been excluded.
494
Histone Acetylation and DNA Repair
Figure 4 (legend opposite)
not be ascribed to a general down regulation of PHR1.
Discussion The acetylation of the core histone N-terminal tails is now recognized as a highly conserved mechanism for regulating chromatin functional states. Histone acetyltransferases and deacetylases can be targeted to promoters to activate or repress genes by altering protein-DNA interactions. DNA damage formation and repair is also tightly linked
to protein-DNA interactions in chromatin. This has been inferred from promoter regions interacting with regulatory proteins as well as for the inhibition of repair in nucleosomes.42 ± 44 The UV survival indicated that the gcn5 mutant exhibits a mild UV sensitivity compared with its isogenic wild-type strain, but that it is not as sensitive as the rad16 mutant. NER genes can be divided into two broad categories: those essential for NER of all of the genome (RAD1, RAD2, RAD3, RAD4, RAD10, RAD14, SSL1, SSL2, TFB1, TFB2 and TFB3), and those not absolutely required
Histone Acetylation and DNA Repair
495
Figure 4. Typical autoradiographs depicting UV-induced CPDs in the TS (a) and the NTS (b) of the MFA2 containing RsaI restriction fragment for the PSY316 and gcn5 a-mating type strains. Lane AG and lane CT are reference sequence ladder. The transcribed region of MFA2 is indicated. The Mcm1 binding site and the TATA box are indicated by open boxes in the control region for the TS. Numbers on the left denote the nucleotide position in relation to the MFA2 coding sequence start point. Lane U contains DNA from unirradiated cells; lane 0 has DNA from cells receiving 150 J/m2 UV and extracted immediately. For NER, lanes headed 1, 2, 3 and 4 contain DNA from cells that received UV but which were incubated afterwards in medium for these times (hours) before extraction; for PR, lanes headed 10, 20, 30 and 60 contain DNA from cells that received UV but which were incubated afterwards under photoreactivation light in PBS for these times (minutes) before extraction. For each PR experiment, two NER samples (30 and 60 minutes) were always taken as a control.
for NER (RAD7, RAD16, or RAD23). Mutants with a defective essential NER gene are hypersensitive to UV, whereas mutations in RAD7, RAD16 and RAD23 confer moderate sensitivity to UV light. The weak UV sensitivity of the gcn5 strain ruled
out a signi®cant role of Gcn5 in the repair of CPDs from the whole genome. Removal of CPDs by NER or PR from total genomic DNA was indistinguishable between wild-type and the gcn5 mutant. However, when
496
Figure 5. CPD repair is presented as the time (NER in hours; PR in minutes) taken for removing 50 % of the CPDs at the given site in MFA2. At each CPD detectable site, a single CPD or a group of CPDs with a similar repair rate are measured at the repair time indicated. The time for repair of 50 % of CPDs (t50 %) at a given site was calculated or extrapolated using Excel software (Microsoft). The t50 % for slow or no repaired CPD (t50 % 5 ten hours for NER, t50 % 5 120 minutes for PR) was shown at the same level on the graph. Filled diamond, CPDs in the PSY316 strain; open diamond, CPDs in the gcn5 strain. Dotted ellipses represent the positions of nucleosomes mapped in PSY316 a-cells.41 Statistical analysis of the standard deviation for % of repair at speci®c regions or sites are mentioned in the text.
examining events at the level of the MFA2 gene, our data indicated that both the PR and the NER of CPDs in the gcn5 mutant were substantially impaired. A similar approach was used to determine removal of CPDs from RPB2: this showed only a mild reduction in either NER or PR in the gcn5 mutant. Although Gcn5 does not govern transcription from RPB2, this result may be related to the fact that about 20 % of the yeast genome is under-acetylated in a gcn5 strain (Dr C. Petersen, personal communication), despite Gcn5 governing the transcription of only 5 % of the yeast genome. Thus repair may be in¯uenced at loci other than those whose transcription is governed by Gcn5. It is feasible that some underacetylation in the gcn5 mutant exists in the proximity of the RPB2 sequence to reduce repair slightly. When the investigation was extended to examine CPD repair at the level of the nucleotide, a detailed repair status at each CPD site was depicted. For both PR and NER at MFA2, a considerable reduction in the repair rate occurred for the upstream control region, the NTS and the TS of the transcribed region in gcn5 strain compared with wild-type cells. The transcription level of MFA2 in the gcn5 strain dropped to 25 % of the normal level. This may account for the decrease in TCR of the TS of the transcribed region. However, it could not account for the decrease in NER in the NTS and the control region of MFA2 where GGR oper-
Histone Acetylation and DNA Repair
Figure 6. The transcription of MFA2, PHR1 and RPB2 in PSY316 and gcn5 was detected by Northern blotting and quanti®ed using ACT1 mRNA levels as an internal standard. The numbers below the bands indicate the ratio of mRNA level between two strains examined for that gene.
ates. Here, it must be emphasised that the repair of the NTS regions of MFA2 does not differ markedly irrespective of whether the gene is transcriptionally active or inactive.34 Hence Gcn5 has a clear role in the NER of the non-transcribed control and coding regions of MFA2. The reduced photoreactivation in the gcn5 strain cannot be accounted for by the reduced transcription at MFA2. The transcription machinery inhibits photolyase from accessing damaged DNA40 and reduced transcription might be expected to result in a faster repair of CPDs by PR in the TS, rather a slower one as observed here. Gcn5 plays a role in controlling the expression of 5 % of the yeast genome,37 and only 20 % of the genome is under-acetylated in the mutant, thus the effect on DNA repair at MFA2 but not on much of the genome, is in keeping with a role limited to a smaller fraction of the DNA. It could be argued that Gcn5 may govern the inducibility of NER genes such as RAD2, and that the gcn5 mutation might give a general repair defect. However, this cannot be the case, as the NER genes that are induced (RAD2, RAD7, RAD16, RAD23) play substantial roles in NER for large portions of the genome. An effect via this route would not give the selective result with MFA2 versus most of the genome, and it would not have given a greater PR or NER defect at the MFA2 compared to the RPB2 gene. Furthermore, a consistent level of mRNA of PHR1 in the wild-type and gcn5 mutant cells was observed here. Hence it rules out the possibility that the defect of PR in MFA2 results from the down regulation of the photolyase. Thus we can conclude that Gcn5 in¯uences repair events at MFA2. These results cannot identify the exact role of Gcn5 in NER or PR. Our speculations are that Gcn5 functions prior to, or during the DNA repair process such that it might be recruited to the upstream damage area by some factor that can detect damage, and hence allow the access of the
497
Histone Acetylation and DNA Repair
repair machinery. This issue can be addressed through chromatin immunoprecipitations. It is also feasible that Gcn5 might be required to keep nucleosomes mobile at MFA2 while the repair process is occurring. This hypothesis is strengthened substantially by the resent results of Brand et al.,45 who show a molecular link between DNA damage recognition and chromatin modi®cation through hGcn5 containing TFTC (TBP-free TAFII complex). The gcn5 mutation leads to reduced repair rates in MFA2 and to a fourfold reduction of mRNA levels. Similarly, the repair in RPB2 is less affected and RNA levels are reduced by 20 %. One possibility is that the repair effect is a consequence of transcription or transcription-related chromatin remodelling in¯uencing the repair mechanisms. If so, Gcn5 would only be involved in PR and NER indirectly via it's effect on transcription. However, it is also possible that the deletion of Gcn5 disturbs the balance between histone acetylation and deacetylation at genes regulated by Gcn5 and it results in a local chromatin change that can directly affect DNA repair irrespective of transcription. The analysis of the changes in chromatin structure of MFA2 in relation to a change in the histone acetylation level due to the deletion of GCN5 and the investigation of the repair events in a-cells where MFA2 is repressed are being undertaken. This approach may clarify this issue. In summary, there is a role for the histone acetyltransferase Gcn5 in ef®cient PR and NER at the transcriptionally active MFA2 locus, and this occurs for sequences that are not transcribed. This study can be extended to other proteins or protein complexes with HAT activity such as NuA3, NuA4 or Elp3 to test their roles in DNA repair. Since histone acetylation is maintained at a certain level by the combined action of histone acetyltransferases and deacetylases, the role of the latter in DNA repair should also be examined. This will enable us to determine which of, or whether these enzymes play roles in the repair of speci®c regions of the yeast genome.
Materials and Methods Yeast strains PSY316 (MATa ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1), PSY316 gcn5 (MATa ade2-101 ura3-52 leu23,112 his3-200 lys2 trp1), BGY 103 rad16 (MATa rad16::URA3, trp1D, his3D200, lys2-801, ade2-1, gal). Photoreactivation Photoreactivation was conducted by 2 107 cells/ml in PBS being treated to photoreactivating light produced by a halogen bulb (1000 W). The samples were kept in suspension by stirring and placed in a bath, at 22-25 C, containing a 5 % (w/v) copper sulphate solution. The copper sulphate solution acted as a light ®lter, allowing only 300-450 nm wavelengths through. Control samples were always taken and kept in the dark for monitoring NER during the PR process.
UV treatment of yeast cells, in vivo NER, DNA isolation, and Southern blotting analysis These were undertaken as described by Reed et al.46 Immunological slot blot assay Equal amounts (5 mg) of DNA from each repair time point were applied to a GeneScreen Plus nylon-based membrane via a slot-blot transfer apparatus. DNA was denatured and ®xed on the membrane by adding NaOH to a ®nal concentration of 0.4 M to each DNA sample. The presence of CPDs in genomic DNA was examined by Western blotting with monoclonal CPD antibodies (AFFITECH AS, Oslo Norway). RNA isolation, Northern blot-analysis Yeast total RNA was extracted using a hot phenol method.47 RNA electrophoresis, Northern transfer of RNA to Gene screen plus membrane (DuPont de Nemours), and preparation of the membrane after transfer for probing were all undertaken as described in Gene screen plus hybridisation transfer membranes -transfer and detection protocols as supplied with Gene screen by DuPont de Nemours. Preparation of radioactive probes for Southern blot and Northern blot analysis Probes used here were all strand-speci®c probes detecting TS and NTS separately and synthesised by DNA polymerase using PCR product as a template. For a probe detecting the TS of the MFA2 containing RsaI fragment, primer A: 50 -biotin-ACGGACTTGATGCACG TGAAAAACCATTATTTAAA30 and primer B: 50 ACA CCATCTACTACATAATTAATTGATAGTTTCCT30 ; for a probe detecting the NTS, primer A: 50 -biotinACACCATCTACTACATAATTAATTGATAGTTTCCT30 and primer B: 50 ACGGACTTGATGCACGTGAA AAACCATTATTTAAA30 . For a probe detecting the TS of RPB2 containing Taq1 fragment, primer A: 50 -biotinGATAGCTTTTTTCCAATAATGGACCTGCCAAATCTA ATCT30 ; primer B: 50 GATAGCCCGTTTACCGATTA TGTTAAGATCAAAGAA30 . For a probe detecting NTS, primer A: 50 -biotin-GATAGCTTTTTTCCGTTTACCG ATTATGTTAAGATCAAAGAA30 ; primer B: 50 GATAG CCCAATAATGGACCTGCCAAATCTAATCT30 . For MFA2 RNA probe, primer A: 50 -biotin-CTATCA TCTTCATACAACAATAACTACCA30 and primer B: 50 CTAATGATGAGAGAATTGGAATAAATTAGT30 . For ACT1 RNA probe, primer A, 50 -biotin-GCCGG TTTTGCCGGTGACG30 ; primer B, 50 CCGGCAG ATTCCAAACCCAAAA30 . For PHR1 RNA probe, primer A, 50 -biotin-TGCATTGTTGCTCCTGGATTGATCA30 ; Primer B, 50 CCAGCGTTCCCCCCATCTCC30 . For RPB2 RNA probe, primer A: 50 -biotin-GATAGCTTTTTTCCGT TTACCGATTATGTTAAGATCAAAGAA30 ; primer B: 50 GATAGCCCAATAATGGACCTGCCAAATCTAATC T30 . Standard PCR reactions were carried out to synthesize the fragments of interest with primer A and primer B. 200 mg of Dynabeads were added to 10 ml of PCR product to bind to the biotin at the 50 end of the extended primer. The beads associated with the PCR product were collected using a magnet and resuspended in 20 ml of 0.1 M of NaOH to denature the dsDNA. The biotinylated strands associated with beads were separated from
498 the solution and served as the templates for probe synthesis by extending the primer B.
Histone Acetylation and DNA Repair
14.
The end-labelling procedure for detecting DNA damage and repair at the level of nucleotide This was undertaken as described in Teng et al.34 The determination of DNA damage and repair We quanti®ed the absolute signal for the full length DNA band and all detectable damaged bands. The total signal in a lane is obtained by summing the measurements over the entire lane, which is then used to normalize the amount of DNA used for each lane. It is important to note that many repair trends cannot be easily distinguished by visual examination of these gels. Up to 50 % variation can occur in loadings per lane. Thus repair is only quanti®able by analysis of total radioactivity versus that in given bands of a lane as estimated from the phosphorimage. All data are the average of at least three experiments.
15. 16.
17.
18.
19.
Acknowledgements We are grateful to S. Berger for the gift of the yeast strains. This work was supported by the MRC grant G9900118.
References 1. Friedberg, E. C., Walker, G. C. & Siede, W. (1995). DNA Repair and Mutagenesis, American Society of Microbiology Press, Washington DC. 2. Sancar, G. B. (1990). DNA photolyases: physical properties, action mechanism, and roles in dark repair. Mutat. Res. 236, 147-160. 3. Sancar, A. (1994). Structure and function of DNA photolyase. Biochemistry, 33, 2-9. 4. Sancar, A. (1996). No ``End of History'' for photolyases. Science, 272, 48-49. 5. Sancar, G. B. (2000). Enzymatic photoreactivation: 50 years and counting. Mutat. Res. 451, 25-37. 6. Sancar, A. (1996). DNA excision repair. Annu. Rev. Biochem. 65, 43-81. 7. Wood, R. D. (1996). DNA repair in eukaryotes. Annu. Rev. Biochem. 65, 135-167. 8. de Laat, W. L., Jaspers, N. G. & Hoeijmakers, J. H. (1999). Molecular mechanism of nucleotide excision repair. Genes Dev. 13, 768-785. 9. Batty, D. P. & Wood, R. D. (2000). Damage recognition in nucleotide excision repair of DNA. Gene, 241, 193-204. 10. Workman, J. L. & Kingston, R. E. (1998). Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu. Rev. Biochem. 67, 545579. 11. Meijer, M. & Smerdon, M. J. (1999). Accessing DNA damage in chromatin: insights from transcription. Bioessays, 21, 596-603. 12. Balajee, A. S. & Bohr, V. A. (2000). Genomic heterogeneity of nucleotide excision repair. Gene, 250, 15-30. 13. Wang, Z. G., Wu, X. H. & Friedberg, E. C. (1991). Nucleotide excision repair of DNA by human cell
20. 21. 22.
23. 24. 25.
26. 27. 28.
29.
30. 31.
extracts is suppressed in reconstituted nucleosomes. J. Biol. Chem. 266, 22472-22478. Sugasawa, K., Masutani, C. & Hanaoka, F. (1993). Cell-free repair of UV-damaged simian virus 40 chromosomes in human cell extracts. I. Development of a cell-free system detecting excision repair of UVirradiated SV40 chromosomes. J. Biol. Chem. 268, 9098-9104. Suter, B., Livingstone-Zatchej, M. & Thoma, F. (1997). Chromatin structure modulates DNA repair by photolyase in vivo. EMBO J. 16, 2150-2160. Schieferstein, U. & Thoma, F. (1998). Site-speci®c repair of cyclobutane pyrimidine dimers in a positioned nucleosome by photolyase and T4 endonuclease V in vitro. EMBO J. 17, 306-316. Wellinger, R. E. & Thoma, F. (1997). Nucleosome structure and positioning modulate nucleotide excision repair in the non-transcribed strand of an active gene. EMBO J. 16, 5046-5056. Tijsterman, M. & Brouwer, J. (1999). Rad26, the yeast homolog of the cockayne syndrome B gene product, counteracts inhibition of DNA repair due to RNA polymerase II transcription. J. Biol. Chem. 274, 1199-1202. Wu, J. & Grunstein, M. (2000). 25 years after the nucleosome model: chromatin modi®cations. Trends Bioch. 12, 619-623. Huang, J. C. & Sancar, A. (1994). Determination of minimum substrate size for human excinuclease. J. Biol. Chem. 269, 19034-19040. Moggs, J. G. & Almouzni, G. (1999). Chromatin rearrangements during nucleotide excision repair. Biochimie, 81, 45-52. Ura, K., Araki, M., Saeki, H., Masutani, C., Ito, T. & Iwai, S., et al. (2000). ATP-dependent chromatin remodeling facilitates nucleotide excision repair of UV-induced DNA lesions in synthetic dinucleosomes. EMBO J. 20, 2004-2014. Flaus, A. & Owen-Hughes, T. (2001). Mechanisms for ATP-dependent chromatin remodelling. Curr. Opin. Genet. Dev. 11, 148-154. Chen, H., Tini, M. & Evans, R. M. (2001). HATs on and beyond chromatin. Curr. Opin. Cell Biol. 13, 218224. Grant, P. A., Sterner, D. E., Duggan, L. J., Workman, J. L. & Berger, S. L. (1998). The SAGA unfolds: convergence of transcription regulators in chromatinmodifying complexes. Trends Cell Biol. 8, 193-197. Wade, P. A. & Wolffe, A. P. (1997). Histone acetyltransferases in control. Curr. Biol. 7, R82-R84. Wade, P. A., Pruss, D. & Wolffe, A. P. (1997). Histone acetylation: chromatin in action. Trends Biochem. Sci. 22, 128-132. Grant, P. A., Duggan, L., Cote, J., Roberts, S. M., Brownell, J. E., Candau, R. et al. (1997). Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex. Genes Dev. 11, 1640-1650. Wang, L., Liu, L. & Berger, S. L. (1998). Critical residues for histone acetylation by Gcn5, functioning in Ada and SAGA complexes, are also required for transcriptional function in vivo. Genes Dev. 12, 640653. Syntichaki, P., Topalidou, I. & Thireos, G. (2000). The Gcn5 bromodomain co-ordinates nucleosome remodelling. Nature, 404, 414-417. Gregory, P. D., Schmid, A., Zavari, M., Munsterkotter, M. & Horz, W. (1999). Chromatin
499
Histone Acetylation and DNA Repair
32.
33.
34.
35.
36.
37.
38.
39.
remodelling at the PHO8 promoter requires SWISNF and SAGA at a step subsequent to activator binding. EMBO J. 18, 6407-6414. Filetici, P., Aranda, C., Gonzalez, A. & Ballario, P. (1998). GCN5, a yeast transcriptional coactivator, induces chromatin recon®guration of HIS3 promoter in vivo. Biochem. Biophys. Res. Commun. 242, 84-87. Perez-Martin, J. & Johnson, A. D. (1998). Mutations in chromatin components suppress a defect of Gcn5 protein in Saccharomyces cerevisiae. Mol. Cell Biol. 18, 1049-1054. Teng, Y., Li, S., Waters, R. & Reed, S. H. (1997). Excision repair at the level of the nucleotide in the Saccharomyces cerevisiae MFA2 gene: mapping of where enhanced repair in the transcribed strand begins or ends and identi®cation of only a partial Rad16 requisite for repairing upstream control sequences. J. Mol. Biol. 267, 324-337. Teng, Y. & Waters, R. (2000). Excision repair at the level of the nucleotide in the upstream control region, the coding sequence and in the region where transcription terminates of the Saccharomyces cerevisiae MFA2 gene and the role of RAD26. Nucl. Acids Res. 28, 1114-1119. Bohr, V. A., Smith, C. A., Okumoto, D. S. & Hanawalt, P. C. (1985). DNA repair in an active gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more ef®cient than in the genome overall. Cell, 40, 359-369. Holstege, F. C. P., Jennings, E. G., Wyrick, J. J., Lee, T. I., Hengartner, C. J., Green, M. R. et al. (1998). Dissecting the regulatory circuitry of a eukaryotic genome. Cell, 95, 717-728. Jansen, L. E., den Dulk, H., Brouns, R. M., de Ruijter, M., Brandsma, J. A. & Brouwer, J. (2000). Spt4 modulates Rad26 requirement in transcriptioncoupled nucleotide excision repair. EMBO J. 19, 6498-6507. Teng, Y., Longhese, M., McDonough, G. & Waters, R. (1998). Mutants with changes in different
40.
41.
42.
43. 44. 45.
46.
47.
domains of yeast replication protein A exhibit differences in repairing the control region, the transcribed strand and the non-transcribed strand of the Saccharomyces cerevisiae MFA2 gene. J. Mol. Biol. 280, 355363. Livingstone-Zatchej, M., Meier, A., Suter, B. & Thoma, F. (1997). RNA polymerase II transcription inhibits DNA repair by photolyase in the transcribed strand of active yeast genes. Nucl. Acids Res. 25, 3795-3800. Teng, Y., Yu, S. & Waters, R. (2001). The mapping of nucleosomes and regulatory protein binding sites at the Saccharomyces cerevisiae MFA2 gene: a high resolution approach. Nucl. Acids Res. 29, e64. Thoma, F. (1999). Light and dark in chromatin repair: repair of UV-induced DNA lesions by photolyase and nucleotide excision repair. EMBO J. 18, 6585-6598. Tornaletti, S. & Pfeifer, G. P. (1996). UV damage and repair mechanisms in mammalian cells. Bioessays, 18, 221-228. Smerdon, M. J. & Conconi, A. (1999). Modulation of DNA damage and DNA repair in chromatin. Prog. Nucl. Acid Res. Mol. Biol. 62, 227-255. Brand, M., Moggs, J. G., Oulad-Abdelghani, M., Lejeune, F., Dilworth, F. J., Stevenin, J. et al. (2001). UV-damaged DNA-binding protein in the TFTC complex links DNA damage recognition to nucleosome acetylation. EMBO J. 20, 3187-3196. Reed, S. H., Boiteux, S. & Waters, R. (1996). UV-induced endonuclease III-sensitive sites at the mating type loci in Saccharomyces cerevisiae are repaired by nucleotide excision repair: RAD7 and RAD16 are not required for their removal from HML alpha. Mol. Gen. Genet. 250, 505-514. Schmitt, M. E., Brown, T. A. & Trumpower, B. L. (1990). A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucl. Acids Res. 18, 3091-3092.
Edited by J. Karn (Received 19 October 2001; received in revised form 18 December 2001; accepted 3 January 2002)
J. Mol. Biol. (2002) 316, 489±499
The Saccharomyces cerevisiae Histone Acetyltransferase Gcn5 has a Role in the Photoreactivation and Nucleotide Excision Repair of UV-Induced Cyclobutane Pyrimidine Dimers in the MFA2 Gene Yumin Teng{, Yachuan Yu{ and Raymond Waters* School of Biological Sciences University of Wales Swansea Singleton Park, Swansea SA2 8PP, UK
How DNA repair enzymes or complexes gain access to chromatin is still not understood. Here, we have studied the role of the S. cerevisiae histone acetyltransferase Gcn5 in photoreactivation (PR) and nucleotide excision repair (NER) at the level of the genome, the MFA2 and RPB2 genes, and at speci®c nucleotides within MFA2. The deletion of GCN5 markedly reduced the PR and NER of UV-induced cyclobutane pyrimidine dimers in MFA2 but much less so in RPB2, whereas no detectable defect was seen for repair of the genome overall. In gcn5, the MFA2 mRNA level is reduced by fourfold, while transcription from RPB2 is reduced only to 80 %. These changes in transcription correlate with the changes in NER and PR found in the gcn5 mutant. However, changes in MFA2 transcription cannot account for the decrease in NER in the non-transcribed strand and the control region of MFA2 where global genome repair (GGR) operates. We conclude that the histone acetyltransferase Gcn5 in¯uences PR and NER at MFA2 in both its transcribed and non-transcribed DNA, yet it has little effect on these processes for most of the yeast genome. As a result, we speculate that histone acetylation allows ef®cient access of the repair machinery to chromosomal DNA damages either indirectly via in¯uencing transcription or directly via modifying chromatin structure irrespective of transcription. # 2002 Elsevier Science Ltd.
*Corresponding author
Keywords: nucleotide excision repair; photoreactivation; histone acetylation
Introduction DNA is inevitably exposed to a variety of damaging agents generated from both endogenous and exogenous sources. In order to counteract the deleterious consequences of DNA damaging agents, organisms have developed a well-organized selfdefence system, DNA repair, to protect genome integrity.1 To tackle cyclobutane pyrimidine dimers (CPDs) and 6-4 photoproducts (6-4 PP), two main {These authors contributed equally to this work. Abbreviations used: CPD, cyclobutane pyrimidine dimers; 6-4pp, 6-4 photoproducts; NER, nucleotide excision repair; PR, photoreactivation; NTS, nontranscribed strand; HAT, histone acetyl transferase. E-mail address of the corresponding author: [email protected] 0022-2836/02/030489±11 $35.00/0
forms of UV-induced DNA damage, organisms employ nucleotide excision repair (NER) and photoreactivation (PR). Both these mechanisms have been studied extensively in the yeast Saccharomyces cerevisiae. PR is a unistep process in that photolyase (encoded by the S. cerevisiae PHR1 gene) binds to CPDs and directly reverses them by splitting the linkage between the adjacent pyrimidines with a light-initiated electron transfer reaction.2 ± 5 NER, on the other hand, is a highly versatile and sophisticated repair pathway in which over 30 proteins are involved. It entails damage recognition in the target DNA, sequential assembly of a number of repair protein complexes at the damage site, dual incision of the damagecontaining DNA strand, excision of a short DNA fragment surrounding the damage site, repair syn# 2002 Elsevier Science Ltd.
490 thesis and ligation of the newly synthesized DNA strand.6 ± 9 DNA repair in eukaryotes is in¯uenced by the packaging of DNA into nucleosomes and higherorder chromatin structures. This compacted state makes DNA templates less accessible to DNA-processing proteins and could lower the processivity of enzymes.10 Furthermore, DNA within positioned nucleosomes may well exhibit a restricted ability to be processed by repair enzymes compared to nucleosome-free regions. Indeed, nonhomogeneous repair of CPDs and 6-4 PP by NER and PR was observed in the yeast and mammalian genomes.11,12 Early studies using plasmid DNA or SV40 minichromosomes have shown that overall repair is less ef®cient in chromatin than in naked DNA,13,14 and photoreactivation is more ef®cient in non-nucleosomal and linker regions than in nucleosomal regions.15 Using reconstituted HISAT nucleosomes as model substrates, Schieferstein and Thoma16 found that the access of T4 endonuclease V and Escherichia coli photolyase to CPDs on the surface of reconstituted nucleosomes was inhibited dramatically, although these enzymes targeted naked DNA very ef®ciently. How NER operates in the context of chromatin structure still remains unclear. First, a direct link between nucleosome positioning and chromatin accessibility to repair enzymes has been observed. A high-resolution analysis of NER in yeast minichromosomes demonstrated a modulation of repair by nucleosomes in the non-transcribed strand of an active gene such that slow repair occurred within the ``internal protected region'' of the nucleosomes and fast repair occurred in the linker DNA.17 Similar results were reported in the case of the yeast genomic copy of the URA3 gene.18 Second, there is extensive evidence indicating chromatin remodeling and histone modi®cation during transcription.10,19 This, taken in conjunction with the observation that human NER enzymes require a space of at least 100 bp to ef®ciently excise DNA lesions,20 suggests that nucleosomes might be rearranged or disassembled prior to or during the NER process, a similar multiple-enzyme process to transcription.21,22 In recent years a large number of protein complexes capable of modifying chromatin structure have been identi®ed. These chromatin remodelers fall into two general classes: the ATP-dependent chromatin remodelling complex and the histone acetyltransferases (HATs).23,24 Reversible acetylation of core histones by HATs alleviates the transcriptionally repressive interaction between positively charged histone amino termini and negatively charged DNA and thus provides direct access of the transcription machinery. Multiple studies have provided a direct molecular link between histone acetylation and transcriptional activation.25 ± 27 In S. cerevisiae, Gcn5, one of the HATs, acts as a catalytic subunit in two nucleosomal HAT complexes (ADA and SAGA) that are speci®c for histones H3/H2B.28 Certain lysine resi-
Histone Acetylation and DNA Repair
dues in the tail domain of H3 and H4 are the substrates of the HAT of Gcn5.29 Gcn5 HAT activity is required for Gcn4-mediated transcriptional activation30 and for activation of the PHO8 promoter, as evidenced by the severe reduction in PHO8 transcription exhibited by gcn5 mutants that lack HAT activity yet form normal SAGA complexes.31 This transcription activation by Gcn5 is likely accompanied by chromatin remodelling since the chromatin remodelling at the PHO8 promoter requires SWI/SNF and SAGA at a step subsequent to activator binding.31 Gcn5 induces chromatin recon®guration at the HIS3 promoter in vivo32 and a defective Gcn5 protein can be suppressed by mutations in chromatin components.33 In our previous study of CPD repair at nucleotide resolution in the S. cerevisiae MFA2 gene,34,35 in a-mating type cells, where this gene is transcriptionally active, we observed fast repair in the transcribed region due to transcription-coupled repair (TCR), yet some damage sites are repaired faster than others in the TCR operating region. Where global genome repair (GGR) operates in the NTS of MFA2 and its upstream control region we also observed CPDs are repaired at different rates. The reasons for this repair heterogeneity in vivo are not completely understood. Apart from the transcriptional status, the sequence speci®city, the location of damage, protein binding and the chromatin structure may account for the heterogeneous repair rates observed. To clarify whether histone acetylation, functioning in chromatin remodelling prior to transcription, affects DNA repair, we have undertaken in vivo DNA repair studies with a S. cerevisiae strain carrying a deletion mutation at the GCN5 locus. Here, we describe experiments investigating the roles of Gcn5 in DNA repair by photoreactivation and NER at the level of total cellular DNA, at the level of the gene for the MFA2 and RPB2 loci, and at nucleotide resolution in the MFA2 control and coding sequences.
Results The role of Gcn5 in UV sensitivity The UV sensitivity of a mutant strain can be indicative of the role of a gene in a DNA repair pathway. First we examined the UV sensitivities of the wild-type, the gcn5 mutant and, for comparison, the global NER gene defective strain, rad16 (Figure 1). The gcn5 mutant exhibited a mild UV sensitivity compared with the wild-type strain. At UV doses giving 10 % survival, the rad16 mutant was about fourfold more sensitive than wild-type and 2.5-fold more sensitive than the gcn5 mutant. NER and Photoreactivation of CPDs from the total genome To determine whether deletion of GCN5 affects repair in overall genomic DNA, an analysis of CPD repair using a CPD speci®c antibody was
491
Histone Acetylation and DNA Repair
Figure 1. The UV sensitivity of the strains studied. (}) PSY316; (~) gcn5; (&) rad16.
undertaken. Equal amounts of DNA from unirradiated, or from UV-treated cells and sampled immediately or after certain repair times were incubated against a CPD speci®c antibody. The images were obtained by phosphorimaging and are shown in Figure 2. Quanti®cation was carried out with ImageQuant software (Molecular Dynamics, CA, USA). For NER, both PSY316 and gcn5 cells took 2.4 hours for the removal of 50 % of the CPDs from the whole genome after 75 J/m2 of UV, whereas after 150 J/m2 both strains took 3.9 hours. With respect to PR, it took 33(8) minutes to remove 50 % of CPDs from the whole genome after 150 J/m2 of UV, and, again both strains were equally ef®cient. There was no detectable NER during this period. The results indicate that the PR and NER of CPDs from the whole genome proceed at a rate that is indistinguishable between the GCN5 and gcn5 strains. Thus, neither the NER nor PR enzymatic activity is globally impaired due to the deletion of GCN5. NER and photoreactivation of CPDs at the level of the gene from MFA2 and RPB2 Next we examined the CPD incidence in the NTS of the MFA2 and the RPB2 genes following the strategy developed by Bohr.36 RPB2 was selected as a gene because its transcription was known not be markedly in¯uenced by Gcn537 and it had been used by other groups for DNA repair studies.38 Figure 3 shows typical autoradiographs detecting CPD repair by NER and PR at the gene level with the PSY316 and gcn5 a-mating type strains. The amount of probe bound to the membrane at the position of full length fragments was quanti®ed both in CPD enzyme-treated and mocktreated samples. The ratio of the band densities of samples with or without CPD enzyme treatment denotes the proportion of fragments free of CPDs.
Figure 2. A typical autoradiograph showing the removal of CPDs by NER or PR from genomic DNA. Monoclonal CPD antibodies were used as a probe for the presence of these damages in genomic DNA following exposure of the cells to UV and their subsequent incubation for NER and PR of CPDs at the times indicated (NER in hours; PR in minutes).
Therefore, the amount of CPD repair following various repair times can be calculated and the extents of repair in the NTS of MFA2 and RPB2 are presented in Figure 3. In wild-type cells, 58(4) % of CPDs in the MFA2 NTS were repaired by NER after three hours post UV. For the NTS of RPB2 gene at the same repair time, 22(2) % of the CPDs were removed. In gcn5 cells, the NER of CPDs in the NTS of MFA2 was severely impaired, only 6(3) % of CPDs were repaired after three hours. Whereas for the RPB2 gene at same repair time, 16(4) % of CPDs in the NTS were repaired. Hence the in¯uence of Gcn5 on NER is considerably greater at MFA2 compared to at RPB2. As shown in Figure 3, the photoreactivation of CPDs in the NTS of MFA2 and RPB2 followed the same trend as seen for NER: the in¯uence of Gcn5 on PR was greater at MFA2 than at RPB2. After 60 minutes of photoreactivation, 70(4) % of CPDs in the MFA2 NTS and 32(8) % in the RPB2 NTS were repaired in the wild-type PSY316 cells, while in the gcn5 cells, 30(6) % of CPDs in the NTS of MFA2 and 25(1) % of that in RPB2 were repaired. This paper focuses primarily on the repair of nontranscribed DNA, and because (a) we would be unable to distinguish whether or not changes in the repair of the TS of MFA2 are only due to reduced transcription in gcn5 versus the GCN5 strains shown and (b) the repair differences at RPB2 between gcn5 and GCN5 strains are small, the TS was not analysed at the level of the gene for either MFA2 or RPB2. With respect to MFA2 TS information would be accrued by the high resolution analysis presented next. The repair of CPDs by NER and PR at nucleotide resolution in the MFA2 gene The direct 30 end-labelling technique previously described34 enables us to compare the repair of
492
Histone Acetylation and DNA Repair
Figure 3. Examining NER and PR of CPDs in the NTS of MFA2 by Southern blotting. For the typical autoradiograph, the letter U indicates that the sample is an unirradiated control, and repair times (NER in hours; PR in minutes) are indicated by the ®gures above the bands. CPDs were speci®cally detected by the addition of T4 endonuclease V and repair over a three hour period for NER and 60 minutes for PR are shown graphically. The % repair plotted for NER and PR are the average of at least three experiments.
DNA damage at each individual base. Brie¯y, DNA is subjected to restriction enzyme digestion, generating a fragment of interest. The CPD sites within the fragment were then incised by a CPD speci®c endonuclease. By using an appropriate DNA probe with overhang modi®cation, fragments for different length as a result of CPD incision can be enriched using Dynabeads and a magnetic particle concentrator (MPC). Following incorporation of radioactivity to the 30 end using the overhang in the probe as a template, DNA fragments were eluted from Dynabeads and loaded onto a denaturing sequencing gel. Figure 4 depicts typical images of the gels. The top bands represent the whole restriction fragment free of CPDs, while the bands below indicate a CPD at a single nucleotide position which can be allocated in the genomic DNA sequence if compared to the sequence ladder by the side. The intensity of bands re¯ects the frequency of lesions at individual sites or in polypyrimidine tracts and they can be quanti®ed after phosphorimaging with ImageQuant software. Sitespeci®c damage was calculated as the fraction of signal at a lesion divided by the signal of the whole lane after appropriate subtraction of background. The results are reported in Figure 5 as the time (t50 %) for removing 50 % of the initial CPDs at each site. Here, rather than single CPD between adjacent pyrimidines, sometimes DNA lesions were treated as CPD clusters which appeared as a group of CPDs with close proximity on the gel and which showed a similar repair rate.
In wild-type PSY316 a-cells, as in other repaircompetent cells described in our previous publications,34,39 the NER rate of CPDs in the upstream promoter region of the strand which is transcribed became faster toward the transcription start point except for the TATA box region. The t50 % was 4.2(0.3) hours for one group of CPDs in the Mcm1 binding region, which is positioned at ÿ252 relative to the start point of the coding region. For CPDs at the ÿ46 to ÿ50 region (the transcription start point is at ÿ42), the t50 % was 2(0.2) hours. This enhanced CPD repair in the promoter region slowed down in the TATA box region, where the t50 % for some CPDs sites was around four hours. In the MFA2 transcribed region fastest repair was observed in the TS and the CPDs are repaired by 50 % in two hours. At the transcription termination region, 3.9(0.4) hours were needed to remove 50 % of the CPDs at 318. In gcn5 cells, repair of CPDs was severely impaired compared with the wild-type (Figure 5). In the non-transcribed region of the gcn5 MFA2 TS, i.e. in the upstream control region and downstream transcription termination region, repair presents a very slow or no repair trend. In the MFA2 TS transcribed region, 50 % of CPDs were removed between four and six hours: a two to threefold reduction in repair rate compared to that in wild-type cells. In PSY316 a-cells, most of the CPDs in the NTS were excised by 50 % in four hours. In the upstream control region an enhanced repair rate was observed. The t50 % for CPDs at ÿ95 was 2.2(0.3) hours. This enhanced repair was abol-
493
Histone Acetylation and DNA Repair
ished for CPDs located in the transcribed region. In gcn5 cells, CPDs remained unrepaired or were very slowly repaired in the NTS of the MFA2 transcription region and its upstream control region. The enhanced excision rate observed in the upstream control region of PSY316 did not occur in gcn5 cells. Some of the CPDs in the downstream region of MFA2 were repaired by 50 % in four to eight hours. Photoreactivation of CPDs along a given DNA sequence is very heterogeneous. Photolyase is the only enzyme involved in PR and its function can be modulated by local chromatin structure change in its target. With regard to the RsaI restriction fragment containing the MFA2 gene, the average t50 % was 23(4) minutes for the TS and 23(2) minutes for the NTS in wild-type PSY316 cells. It should be noted that the transcribed sequence of MFA2 covers only part of the RsaI fragment (328 bp out of 869 bp). Hence the observation here of a similar repair rate in the TS and NTS of the RsaI fragment does not contradict the ®nding that RNA polymerase II installation inhibits photolyase from accessing to the transcribed strand of active genes.40 Indeed, in the wild-type cells, photolyase preferentially repaired the non-transcribed strand of the MFA2 coding sequence with an average t50 % of 23(1) minutes over that of the transcribed strand with an average t50 % of 44(7) minutes In contrast, the activity of photolyase on the same RsaI fragment in the gcn5 mutant was severely reduced. The average t50 % increased to 85(2) minutes for the TS and 90(12) minutes for the NTS. The t50 % of CPDs in different regions within the RsaI fragment are summarized in Table 1, from which, the region-speci®c effect of Gcn5 can be seen. We have recently mapped nucleosome positions in the MFA2 gene41 where nucleosome ÿ1 is located at nucleotide positions ÿ207 to ÿ61, and nucleosomes 1 and 2 at positions ÿ59 to 88 and 122 to 254, respectively, while MFA2 is repressed in the a-mating type cells. The pattern change of MNase cutting indicates these positioned nucleosomes are disrupted when MFA2 is transcriptionally active. However we still observed a nucleosome-orientated PR pro®le in the transcribed region of the active MFA2 especially in the nontranscribed strand. In the NTS of MFA2, clusters of
CPDs located around 88 (t50 %: 18(9) minutes in PSY316; 60(3) in gcn5) and 118 (t50 %: 25(1) minutes in PSY316; 72(5) in gcn5) were repaired faster than those around positions 158 (t50 %: 52(10) minutes in PSY316; 74(10) in gcn5) and 193 (t50 %: 49(4) minutes in PSY316; 98(9) in gcn5). Further downstream at positions 255 (t50 %: 8(2) minutes in PSY316; 36(5) in gcn5) and 269 (t50 %: 7(2) minutes in PSY316; 10(0) minutes in gcn5), faster repair was observed again. Since these fast repair regions in a-cells match the positions of linker regions in a-cells, and the slow repair regions in a-cells locate at where the nucleosomal regions exist in a-cells, the nucleosomes we mapped in a-cells at MFA2 may still be attached to the NTS in a-cells in an unstable state which cannot be positioned by Micrococcal nuclease, yet they still modulate photoreactivation.
Gcn5 and transcription from MFA2, RPB2 and PHR1 DNA repair is intimately linked to transcription mediated by RNA polymerase II. We were concerned that the slower repair observed in the MFA2 gene in the gcn5 background was possibly due to down-regulation of MFA2 transcription or to that of the repair genes for NER or PR, although this was unlikely because we observed a local marked effect on repair at MFA2, only a slight effect at RPB2, and no detectable difference in NER or PR from the genome overall. We measured the levels of transcription from the MFA2, PHR1 and RPB2 genes in all strains as shown in Figure 6. The mRNA level of the ACT1 gene was used as a control to adjust for sample loading. In gcn5a cells, the mRNA level of MFA2 was reduced by fourfold compared to the wildtype strain, but transcription is still occurring. Transcription from RPB2 in gcn5 was only reduced to 80 % of its normal level. As the effects of the GCN5 mutation were similar with respect to the PR and NER operating at MFA2, i.e. both events were markedly reduced, we focused on transcription from PHR1 rather than on that from the large number of NER genes. The mRNA level for PHR1 was consistent in all strains tested. Thus the effects seen locally at MFA2 could
Table 1. Average time for repairing 50 % of induced CPDs (t50 %) by PR in different regions of the RsaI restriction fragment TS NTS
PSY316 gcn5 PSY316 gcn5
RsaI fragment overall
MFA2 transcribed region
MFA2 promoter
23 4 85 2 23 2 90 12
44 7 91 6 23 1 104 13
11 2 52 18 20 2 (13 3)a 33 3 (33 3)a
Any t50 % over 60 minutes is extrapolated from extended repair curves. a There are less putative CPD sites in the NTS than in the TS in the promoter of MFA2. In the NTS an intense persistent band indicates CPDs occur that are unrepaired, possibly due to MCM1 binding. This contributes to a slower repair of CPDs to NTS overall in this region compared to TS in the same region. Data in parentheses show average t50 % when this band has been excluded.
494
Histone Acetylation and DNA Repair
Figure 4 (legend opposite)
not be ascribed to a general down regulation of PHR1.
Discussion The acetylation of the core histone N-terminal tails is now recognized as a highly conserved mechanism for regulating chromatin functional states. Histone acetyltransferases and deacetylases can be targeted to promoters to activate or repress genes by altering protein-DNA interactions. DNA damage formation and repair is also tightly linked
to protein-DNA interactions in chromatin. This has been inferred from promoter regions interacting with regulatory proteins as well as for the inhibition of repair in nucleosomes.42 ± 44 The UV survival indicated that the gcn5 mutant exhibits a mild UV sensitivity compared with its isogenic wild-type strain, but that it is not as sensitive as the rad16 mutant. NER genes can be divided into two broad categories: those essential for NER of all of the genome (RAD1, RAD2, RAD3, RAD4, RAD10, RAD14, SSL1, SSL2, TFB1, TFB2 and TFB3), and those not absolutely required
Histone Acetylation and DNA Repair
495
Figure 4. Typical autoradiographs depicting UV-induced CPDs in the TS (a) and the NTS (b) of the MFA2 containing RsaI restriction fragment for the PSY316 and gcn5 a-mating type strains. Lane AG and lane CT are reference sequence ladder. The transcribed region of MFA2 is indicated. The Mcm1 binding site and the TATA box are indicated by open boxes in the control region for the TS. Numbers on the left denote the nucleotide position in relation to the MFA2 coding sequence start point. Lane U contains DNA from unirradiated cells; lane 0 has DNA from cells receiving 150 J/m2 UV and extracted immediately. For NER, lanes headed 1, 2, 3 and 4 contain DNA from cells that received UV but which were incubated afterwards in medium for these times (hours) before extraction; for PR, lanes headed 10, 20, 30 and 60 contain DNA from cells that received UV but which were incubated afterwards under photoreactivation light in PBS for these times (minutes) before extraction. For each PR experiment, two NER samples (30 and 60 minutes) were always taken as a control.
for NER (RAD7, RAD16, or RAD23). Mutants with a defective essential NER gene are hypersensitive to UV, whereas mutations in RAD7, RAD16 and RAD23 confer moderate sensitivity to UV light. The weak UV sensitivity of the gcn5 strain ruled
out a signi®cant role of Gcn5 in the repair of CPDs from the whole genome. Removal of CPDs by NER or PR from total genomic DNA was indistinguishable between wild-type and the gcn5 mutant. However, when
496
Figure 5. CPD repair is presented as the time (NER in hours; PR in minutes) taken for removing 50 % of the CPDs at the given site in MFA2. At each CPD detectable site, a single CPD or a group of CPDs with a similar repair rate are measured at the repair time indicated. The time for repair of 50 % of CPDs (t50 %) at a given site was calculated or extrapolated using Excel software (Microsoft). The t50 % for slow or no repaired CPD (t50 % 5 ten hours for NER, t50 % 5 120 minutes for PR) was shown at the same level on the graph. Filled diamond, CPDs in the PSY316 strain; open diamond, CPDs in the gcn5 strain. Dotted ellipses represent the positions of nucleosomes mapped in PSY316 a-cells.41 Statistical analysis of the standard deviation for % of repair at speci®c regions or sites are mentioned in the text.
examining events at the level of the MFA2 gene, our data indicated that both the PR and the NER of CPDs in the gcn5 mutant were substantially impaired. A similar approach was used to determine removal of CPDs from RPB2: this showed only a mild reduction in either NER or PR in the gcn5 mutant. Although Gcn5 does not govern transcription from RPB2, this result may be related to the fact that about 20 % of the yeast genome is under-acetylated in a gcn5 strain (Dr C. Petersen, personal communication), despite Gcn5 governing the transcription of only 5 % of the yeast genome. Thus repair may be in¯uenced at loci other than those whose transcription is governed by Gcn5. It is feasible that some underacetylation in the gcn5 mutant exists in the proximity of the RPB2 sequence to reduce repair slightly. When the investigation was extended to examine CPD repair at the level of the nucleotide, a detailed repair status at each CPD site was depicted. For both PR and NER at MFA2, a considerable reduction in the repair rate occurred for the upstream control region, the NTS and the TS of the transcribed region in gcn5 strain compared with wild-type cells. The transcription level of MFA2 in the gcn5 strain dropped to 25 % of the normal level. This may account for the decrease in TCR of the TS of the transcribed region. However, it could not account for the decrease in NER in the NTS and the control region of MFA2 where GGR oper-
Histone Acetylation and DNA Repair
Figure 6. The transcription of MFA2, PHR1 and RPB2 in PSY316 and gcn5 was detected by Northern blotting and quanti®ed using ACT1 mRNA levels as an internal standard. The numbers below the bands indicate the ratio of mRNA level between two strains examined for that gene.
ates. Here, it must be emphasised that the repair of the NTS regions of MFA2 does not differ markedly irrespective of whether the gene is transcriptionally active or inactive.34 Hence Gcn5 has a clear role in the NER of the non-transcribed control and coding regions of MFA2. The reduced photoreactivation in the gcn5 strain cannot be accounted for by the reduced transcription at MFA2. The transcription machinery inhibits photolyase from accessing damaged DNA40 and reduced transcription might be expected to result in a faster repair of CPDs by PR in the TS, rather a slower one as observed here. Gcn5 plays a role in controlling the expression of 5 % of the yeast genome,37 and only 20 % of the genome is under-acetylated in the mutant, thus the effect on DNA repair at MFA2 but not on much of the genome, is in keeping with a role limited to a smaller fraction of the DNA. It could be argued that Gcn5 may govern the inducibility of NER genes such as RAD2, and that the gcn5 mutation might give a general repair defect. However, this cannot be the case, as the NER genes that are induced (RAD2, RAD7, RAD16, RAD23) play substantial roles in NER for large portions of the genome. An effect via this route would not give the selective result with MFA2 versus most of the genome, and it would not have given a greater PR or NER defect at the MFA2 compared to the RPB2 gene. Furthermore, a consistent level of mRNA of PHR1 in the wild-type and gcn5 mutant cells was observed here. Hence it rules out the possibility that the defect of PR in MFA2 results from the down regulation of the photolyase. Thus we can conclude that Gcn5 in¯uences repair events at MFA2. These results cannot identify the exact role of Gcn5 in NER or PR. Our speculations are that Gcn5 functions prior to, or during the DNA repair process such that it might be recruited to the upstream damage area by some factor that can detect damage, and hence allow the access of the
497
Histone Acetylation and DNA Repair
repair machinery. This issue can be addressed through chromatin immunoprecipitations. It is also feasible that Gcn5 might be required to keep nucleosomes mobile at MFA2 while the repair process is occurring. This hypothesis is strengthened substantially by the resent results of Brand et al.,45 who show a molecular link between DNA damage recognition and chromatin modi®cation through hGcn5 containing TFTC (TBP-free TAFII complex). The gcn5 mutation leads to reduced repair rates in MFA2 and to a fourfold reduction of mRNA levels. Similarly, the repair in RPB2 is less affected and RNA levels are reduced by 20 %. One possibility is that the repair effect is a consequence of transcription or transcription-related chromatin remodelling in¯uencing the repair mechanisms. If so, Gcn5 would only be involved in PR and NER indirectly via it's effect on transcription. However, it is also possible that the deletion of Gcn5 disturbs the balance between histone acetylation and deacetylation at genes regulated by Gcn5 and it results in a local chromatin change that can directly affect DNA repair irrespective of transcription. The analysis of the changes in chromatin structure of MFA2 in relation to a change in the histone acetylation level due to the deletion of GCN5 and the investigation of the repair events in a-cells where MFA2 is repressed are being undertaken. This approach may clarify this issue. In summary, there is a role for the histone acetyltransferase Gcn5 in ef®cient PR and NER at the transcriptionally active MFA2 locus, and this occurs for sequences that are not transcribed. This study can be extended to other proteins or protein complexes with HAT activity such as NuA3, NuA4 or Elp3 to test their roles in DNA repair. Since histone acetylation is maintained at a certain level by the combined action of histone acetyltransferases and deacetylases, the role of the latter in DNA repair should also be examined. This will enable us to determine which of, or whether these enzymes play roles in the repair of speci®c regions of the yeast genome.
Materials and Methods Yeast strains PSY316 (MATa ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1), PSY316 gcn5 (MATa ade2-101 ura3-52 leu23,112 his3-200 lys2 trp1), BGY 103 rad16 (MATa rad16::URA3, trp1D, his3D200, lys2-801, ade2-1, gal). Photoreactivation Photoreactivation was conducted by 2 107 cells/ml in PBS being treated to photoreactivating light produced by a halogen bulb (1000 W). The samples were kept in suspension by stirring and placed in a bath, at 22-25 C, containing a 5 % (w/v) copper sulphate solution. The copper sulphate solution acted as a light ®lter, allowing only 300-450 nm wavelengths through. Control samples were always taken and kept in the dark for monitoring NER during the PR process.
UV treatment of yeast cells, in vivo NER, DNA isolation, and Southern blotting analysis These were undertaken as described by Reed et al.46 Immunological slot blot assay Equal amounts (5 mg) of DNA from each repair time point were applied to a GeneScreen Plus nylon-based membrane via a slot-blot transfer apparatus. DNA was denatured and ®xed on the membrane by adding NaOH to a ®nal concentration of 0.4 M to each DNA sample. The presence of CPDs in genomic DNA was examined by Western blotting with monoclonal CPD antibodies (AFFITECH AS, Oslo Norway). RNA isolation, Northern blot-analysis Yeast total RNA was extracted using a hot phenol method.47 RNA electrophoresis, Northern transfer of RNA to Gene screen plus membrane (DuPont de Nemours), and preparation of the membrane after transfer for probing were all undertaken as described in Gene screen plus hybridisation transfer membranes -transfer and detection protocols as supplied with Gene screen by DuPont de Nemours. Preparation of radioactive probes for Southern blot and Northern blot analysis Probes used here were all strand-speci®c probes detecting TS and NTS separately and synthesised by DNA polymerase using PCR product as a template. For a probe detecting the TS of the MFA2 containing RsaI fragment, primer A: 50 -biotin-ACGGACTTGATGCACG TGAAAAACCATTATTTAAA30 and primer B: 50 ACA CCATCTACTACATAATTAATTGATAGTTTCCT30 ; for a probe detecting the NTS, primer A: 50 -biotinACACCATCTACTACATAATTAATTGATAGTTTCCT30 and primer B: 50 ACGGACTTGATGCACGTGAA AAACCATTATTTAAA30 . For a probe detecting the TS of RPB2 containing Taq1 fragment, primer A: 50 -biotinGATAGCTTTTTTCCAATAATGGACCTGCCAAATCTA ATCT30 ; primer B: 50 GATAGCCCGTTTACCGATTA TGTTAAGATCAAAGAA30 . For a probe detecting NTS, primer A: 50 -biotin-GATAGCTTTTTTCCGTTTACCG ATTATGTTAAGATCAAAGAA30 ; primer B: 50 GATAG CCCAATAATGGACCTGCCAAATCTAATCT30 . For MFA2 RNA probe, primer A: 50 -biotin-CTATCA TCTTCATACAACAATAACTACCA30 and primer B: 50 CTAATGATGAGAGAATTGGAATAAATTAGT30 . For ACT1 RNA probe, primer A, 50 -biotin-GCCGG TTTTGCCGGTGACG30 ; primer B, 50 CCGGCAG ATTCCAAACCCAAAA30 . For PHR1 RNA probe, primer A, 50 -biotin-TGCATTGTTGCTCCTGGATTGATCA30 ; Primer B, 50 CCAGCGTTCCCCCCATCTCC30 . For RPB2 RNA probe, primer A: 50 -biotin-GATAGCTTTTTTCCGT TTACCGATTATGTTAAGATCAAAGAA30 ; primer B: 50 GATAGCCCAATAATGGACCTGCCAAATCTAATC T30 . Standard PCR reactions were carried out to synthesize the fragments of interest with primer A and primer B. 200 mg of Dynabeads were added to 10 ml of PCR product to bind to the biotin at the 50 end of the extended primer. The beads associated with the PCR product were collected using a magnet and resuspended in 20 ml of 0.1 M of NaOH to denature the dsDNA. The biotinylated strands associated with beads were separated from
498 the solution and served as the templates for probe synthesis by extending the primer B.
Histone Acetylation and DNA Repair
14.
The end-labelling procedure for detecting DNA damage and repair at the level of nucleotide This was undertaken as described in Teng et al.34 The determination of DNA damage and repair We quanti®ed the absolute signal for the full length DNA band and all detectable damaged bands. The total signal in a lane is obtained by summing the measurements over the entire lane, which is then used to normalize the amount of DNA used for each lane. It is important to note that many repair trends cannot be easily distinguished by visual examination of these gels. Up to 50 % variation can occur in loadings per lane. Thus repair is only quanti®able by analysis of total radioactivity versus that in given bands of a lane as estimated from the phosphorimage. All data are the average of at least three experiments.
15. 16.
17.
18.
19.
Acknowledgements We are grateful to S. Berger for the gift of the yeast strains. This work was supported by the MRC grant G9900118.
References 1. Friedberg, E. C., Walker, G. C. & Siede, W. (1995). DNA Repair and Mutagenesis, American Society of Microbiology Press, Washington DC. 2. Sancar, G. B. (1990). DNA photolyases: physical properties, action mechanism, and roles in dark repair. Mutat. Res. 236, 147-160. 3. Sancar, A. (1994). Structure and function of DNA photolyase. Biochemistry, 33, 2-9. 4. Sancar, A. (1996). No ``End of History'' for photolyases. Science, 272, 48-49. 5. Sancar, G. B. (2000). Enzymatic photoreactivation: 50 years and counting. Mutat. Res. 451, 25-37. 6. Sancar, A. (1996). DNA excision repair. Annu. Rev. Biochem. 65, 43-81. 7. Wood, R. D. (1996). DNA repair in eukaryotes. Annu. Rev. Biochem. 65, 135-167. 8. de Laat, W. L., Jaspers, N. G. & Hoeijmakers, J. H. (1999). Molecular mechanism of nucleotide excision repair. Genes Dev. 13, 768-785. 9. Batty, D. P. & Wood, R. D. (2000). Damage recognition in nucleotide excision repair of DNA. Gene, 241, 193-204. 10. Workman, J. L. & Kingston, R. E. (1998). Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu. Rev. Biochem. 67, 545579. 11. Meijer, M. & Smerdon, M. J. (1999). Accessing DNA damage in chromatin: insights from transcription. Bioessays, 21, 596-603. 12. Balajee, A. S. & Bohr, V. A. (2000). Genomic heterogeneity of nucleotide excision repair. Gene, 250, 15-30. 13. Wang, Z. G., Wu, X. H. & Friedberg, E. C. (1991). Nucleotide excision repair of DNA by human cell
20. 21. 22.
23. 24. 25.
26. 27. 28.
29.
30. 31.
extracts is suppressed in reconstituted nucleosomes. J. Biol. Chem. 266, 22472-22478. Sugasawa, K., Masutani, C. & Hanaoka, F. (1993). Cell-free repair of UV-damaged simian virus 40 chromosomes in human cell extracts. I. Development of a cell-free system detecting excision repair of UVirradiated SV40 chromosomes. J. Biol. Chem. 268, 9098-9104. Suter, B., Livingstone-Zatchej, M. & Thoma, F. (1997). Chromatin structure modulates DNA repair by photolyase in vivo. EMBO J. 16, 2150-2160. Schieferstein, U. & Thoma, F. (1998). Site-speci®c repair of cyclobutane pyrimidine dimers in a positioned nucleosome by photolyase and T4 endonuclease V in vitro. EMBO J. 17, 306-316. Wellinger, R. E. & Thoma, F. (1997). Nucleosome structure and positioning modulate nucleotide excision repair in the non-transcribed strand of an active gene. EMBO J. 16, 5046-5056. Tijsterman, M. & Brouwer, J. (1999). Rad26, the yeast homolog of the cockayne syndrome B gene product, counteracts inhibition of DNA repair due to RNA polymerase II transcription. J. Biol. Chem. 274, 1199-1202. Wu, J. & Grunstein, M. (2000). 25 years after the nucleosome model: chromatin modi®cations. Trends Bioch. 12, 619-623. Huang, J. C. & Sancar, A. (1994). Determination of minimum substrate size for human excinuclease. J. Biol. Chem. 269, 19034-19040. Moggs, J. G. & Almouzni, G. (1999). Chromatin rearrangements during nucleotide excision repair. Biochimie, 81, 45-52. Ura, K., Araki, M., Saeki, H., Masutani, C., Ito, T. & Iwai, S., et al. (2000). ATP-dependent chromatin remodeling facilitates nucleotide excision repair of UV-induced DNA lesions in synthetic dinucleosomes. EMBO J. 20, 2004-2014. Flaus, A. & Owen-Hughes, T. (2001). Mechanisms for ATP-dependent chromatin remodelling. Curr. Opin. Genet. Dev. 11, 148-154. Chen, H., Tini, M. & Evans, R. M. (2001). HATs on and beyond chromatin. Curr. Opin. Cell Biol. 13, 218224. Grant, P. A., Sterner, D. E., Duggan, L. J., Workman, J. L. & Berger, S. L. (1998). The SAGA unfolds: convergence of transcription regulators in chromatinmodifying complexes. Trends Cell Biol. 8, 193-197. Wade, P. A. & Wolffe, A. P. (1997). Histone acetyltransferases in control. Curr. Biol. 7, R82-R84. Wade, P. A., Pruss, D. & Wolffe, A. P. (1997). Histone acetylation: chromatin in action. Trends Biochem. Sci. 22, 128-132. Grant, P. A., Duggan, L., Cote, J., Roberts, S. M., Brownell, J. E., Candau, R. et al. (1997). Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex. Genes Dev. 11, 1640-1650. Wang, L., Liu, L. & Berger, S. L. (1998). Critical residues for histone acetylation by Gcn5, functioning in Ada and SAGA complexes, are also required for transcriptional function in vivo. Genes Dev. 12, 640653. Syntichaki, P., Topalidou, I. & Thireos, G. (2000). The Gcn5 bromodomain co-ordinates nucleosome remodelling. Nature, 404, 414-417. Gregory, P. D., Schmid, A., Zavari, M., Munsterkotter, M. & Horz, W. (1999). Chromatin
499
Histone Acetylation and DNA Repair
32.
33.
34.
35.
36.
37.
38.
39.
remodelling at the PHO8 promoter requires SWISNF and SAGA at a step subsequent to activator binding. EMBO J. 18, 6407-6414. Filetici, P., Aranda, C., Gonzalez, A. & Ballario, P. (1998). GCN5, a yeast transcriptional coactivator, induces chromatin recon®guration of HIS3 promoter in vivo. Biochem. Biophys. Res. Commun. 242, 84-87. Perez-Martin, J. & Johnson, A. D. (1998). Mutations in chromatin components suppress a defect of Gcn5 protein in Saccharomyces cerevisiae. Mol. Cell Biol. 18, 1049-1054. Teng, Y., Li, S., Waters, R. & Reed, S. H. (1997). Excision repair at the level of the nucleotide in the Saccharomyces cerevisiae MFA2 gene: mapping of where enhanced repair in the transcribed strand begins or ends and identi®cation of only a partial Rad16 requisite for repairing upstream control sequences. J. Mol. Biol. 267, 324-337. Teng, Y. & Waters, R. (2000). Excision repair at the level of the nucleotide in the upstream control region, the coding sequence and in the region where transcription terminates of the Saccharomyces cerevisiae MFA2 gene and the role of RAD26. Nucl. Acids Res. 28, 1114-1119. Bohr, V. A., Smith, C. A., Okumoto, D. S. & Hanawalt, P. C. (1985). DNA repair in an active gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more ef®cient than in the genome overall. Cell, 40, 359-369. Holstege, F. C. P., Jennings, E. G., Wyrick, J. J., Lee, T. I., Hengartner, C. J., Green, M. R. et al. (1998). Dissecting the regulatory circuitry of a eukaryotic genome. Cell, 95, 717-728. Jansen, L. E., den Dulk, H., Brouns, R. M., de Ruijter, M., Brandsma, J. A. & Brouwer, J. (2000). Spt4 modulates Rad26 requirement in transcriptioncoupled nucleotide excision repair. EMBO J. 19, 6498-6507. Teng, Y., Longhese, M., McDonough, G. & Waters, R. (1998). Mutants with changes in different
40.
41.
42.
43. 44. 45.
46.
47.
domains of yeast replication protein A exhibit differences in repairing the control region, the transcribed strand and the non-transcribed strand of the Saccharomyces cerevisiae MFA2 gene. J. Mol. Biol. 280, 355363. Livingstone-Zatchej, M., Meier, A., Suter, B. & Thoma, F. (1997). RNA polymerase II transcription inhibits DNA repair by photolyase in the transcribed strand of active yeast genes. Nucl. Acids Res. 25, 3795-3800. Teng, Y., Yu, S. & Waters, R. (2001). The mapping of nucleosomes and regulatory protein binding sites at the Saccharomyces cerevisiae MFA2 gene: a high resolution approach. Nucl. Acids Res. 29, e64. Thoma, F. (1999). Light and dark in chromatin repair: repair of UV-induced DNA lesions by photolyase and nucleotide excision repair. EMBO J. 18, 6585-6598. Tornaletti, S. & Pfeifer, G. P. (1996). UV damage and repair mechanisms in mammalian cells. Bioessays, 18, 221-228. Smerdon, M. J. & Conconi, A. (1999). Modulation of DNA damage and DNA repair in chromatin. Prog. Nucl. Acid Res. Mol. Biol. 62, 227-255. Brand, M., Moggs, J. G., Oulad-Abdelghani, M., Lejeune, F., Dilworth, F. J., Stevenin, J. et al. (2001). UV-damaged DNA-binding protein in the TFTC complex links DNA damage recognition to nucleosome acetylation. EMBO J. 20, 3187-3196. Reed, S. H., Boiteux, S. & Waters, R. (1996). UV-induced endonuclease III-sensitive sites at the mating type loci in Saccharomyces cerevisiae are repaired by nucleotide excision repair: RAD7 and RAD16 are not required for their removal from HML alpha. Mol. Gen. Genet. 250, 505-514. Schmitt, M. E., Brown, T. A. & Trumpower, B. L. (1990). A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucl. Acids Res. 18, 3091-3092.
Edited by J. Karn (Received 19 October 2001; received in revised form 18 December 2001; accepted 3 January 2002)