The Smads: transcriptional regulation and mouse models

Cytokine & Growth Factor Reviews 11 (2000) 37±48

www.elsevier.com/locate/cytogfr

The Smads: transcriptional regulation and mouse models M. Datto, X.-F. Wang* Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, NC 27710, USA

Abstract The ®eld of transforming growth factor-b (TGF-b) signaling sees periodic discoveries that revolutionize our thinking, redirect our experiments, and peak our excitement. One of the ®rst such discoveries was less than a decade ago: the molecular cloning of the type I and type II TGF-b receptors. This breakthrough de®ned a novel family of serine/threonine kinase receptors, which led to the description of an ever-expanding superfamily. The discovery of how these receptors are grouped on the cell surface, bind TGF-b and are activated by speci®c phosphorylation events further de®ned the uniqueness of this system in comparison to other families of growth factor receptors. Now, once again, the TGF-b ®eld has been revolutionized. This time, the discovery is the Smad family of proteins. Although one can hardly imagine TGF-b without the Smads, the cloning of the Smads and their implication in TGF-b signaling was only four years ago. Since that time, great advances have been made in our understanding of the Smads as transcription factors, which are activated by receptor mediated phosphorylation. In addition, animal models for a loss of Smad function have provided insight into the role of speci®c Smads in a variety of physiologic systems. The Smad ®eld has been growing exponentially. A comprehensive review of all aspects of the Smads, therefore, would be beyond the scope of a single review. Instead, this review highlights some of the general aspects of Smad function, and then focuses on the role of speci®c Smad family members in transcriptional regulation, animal physiology, and disease processes. # 2000 Elsevier Science Ltd. All rights reserved. Keywords: TGF-b; Smads; Transcription; Mouse models; In¯ammation; Bone metabolism; Tumorigenesis

1. Introduction The transforming growth factor-bs are polypeptide hormones consisting of three highly related family members (TGF-b 1±3) that have diverse e€ects on a variety of di€erent cell types to regulate many complex multicellular systems. One example of the complexity of TGF-b function is the role it plays in immune system regulation. TGF-b is a potent immune system regulatory factor that can enhance the function of monocytes and neutrophils, suppress the function of lymphocytes, and regulate the di€erentiation of several immune cell lineages (reviewed in Ref. [1]). The net immunosuppressive e€ects of TGF-b are, in part, due * Corresponding author. Tel.: +1-919-681-4861; fax: +1-919-6848922. E-mail address: [email protected] (X.F. Wang).

to its ability to suppress the proliferation of lymphocytes, regulate the expression of Ig a constant chain and MHC class I and II molecules, and antagonize the function or expression of several cytokines [1]. Immunosuppression is only one example of the diverse array of TGF-b's function. TGF-b is also involved in wound healing and tissue repair, through its regulation of extracellular matrix formation, cell migration and angiogenesis (reviewed in Ref. [2]). Not only does TGF-b regulate normal wound healing, but excessive activity of TGF-b may be responsible for the tissue damage seen in cirrhosis, glomerulonephritis, scarring and ®brosis (reviewed in Ref. [3]). Finally, TGF-b also has multiple complicated functions in the highly regulated process of embryogenesis and the disregulated growth seen in oncogenesis (reviewed in Refs. [4,5]). Many of these global e€ects of TGF-b stem from its ability to regulate cellular proliferation, di€erentiation

1359-6101/00/$ - see front matter # 2000 Elsevier Science Ltd. All rights reserved. PII: S 1 3 5 9 - 6 1 0 1 ( 9 9 ) 0 0 0 2 7 - 1

38

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

and gene expression. Perhaps the most studied aspect of TGF-b is its ability to reversibly inhibit the proliferation of many di€erent cell types, including cells of epithelial, endothelial, neuronal, hematopoietic, and lymphoid origins. Not only does TGF-b regulate proliferation, but it also induces the di€erentiation of bronchial epithelial cells, prechondrocytes and certain T-cell populations, and inhibits the di€erentiation of myoblasts, osteoblasts and adipocytes (reviewed in Ref. [6]). TGF-b is also involved in extracellular matrix regulation through its induction of many genes involved in ECM production and turnover, including ®bronectin, elastin, thrombospondin, type I, type II and type III, type VII, and type X collagens, plasminogen activator inhibitor and tissue inhibitor of metalothioproteinases (reviewed in Refs. [2,3]). Moreover, TGF-b can regulate the expression of a diverse set of genes with varied functions including, but not limited to, the cell cycle regulators, CDC25A, various G1 cylcins and Cdks, the cyclin dependent kinase inhibitors, p21 and p15, the cytokines PDGF, CTGF, and TGF-b1, and the transcription factors myc, JunB, cjun, and TIEG (reviewed in Refs. [1±9]). With the identi®cation and characterization of the Smads, the mechanisms through which TGF-b regulates these genes and processes are beginning to be understood. 2. Enter the Smads After the cloning of the TGF-b receptors, and their characterization as serine/threonine kinases (reviewed in Refs. [9,10]), research turned towards the identi®cation of cytoplasmic substrates. Clues to the identity of these long sought after molecules came from genetic studies in Drosophila [11,12] and C. elegans [13]. These studies identi®ed a conserved family of proteins that play a critical role in TGF-b superfamily signaling pathways downstream of the receptors. Mammalian homologues of these proteins, now referred to as Smads, were subsequently cloned based on sequence similarity to the drosophila and C. elegans genes [14± 19]. One member of the Smad family, originally termed DPC-4 and later renamed Smad4, was identi®ed independently as a tumor suppressor protein on chromosome 18q21 which is lost in pancreatic cancers [20]. Currently, eight mammalian Smads, Smad1±8, have been described. These Smads share a high degree of sequence similarity in two distinct domains. The Nterminal conserved domain is termed the MH1-domain and the C-terminal conserved domain is termed the MH2-domain. These two domains are separated by a less well-conserved proline rich linker sequence. The Smad family can be further divided into subgroups based on sequence homology. Smad2 and Smad3 are

the most highly related of the Smad family, sharing 92% sequence identity. Smad1, Smad5 and Smad8 fall into a second related subgroup, and Smad6 and Smad7 make up ®nal subgroup of Smads based on their lack of conserved C-terminal sequences. 3. A model for Smad activation Subsequent biochemical studies demonstrated that speci®c Smads are, indeed, phosphorylated in response to TGF-b superfamily members. In response to TGF-b stimulation, Smad2 and Smad3 are speci®cally phosphorylated on their carboxy terminus by the type I TGF-b receptor. This phosphorylation occurs on an SSVS motif at the very C-terminal end of Smad2 and Smad3. Smad1, Smad5, and Smad8 are phosphorylated on similar residues in response to Bone Morphogenic Protein (BMP) by the BMP type I receptor [15± 19,21±23] (reviewed in Refs. [24±26]). Phosphorylation of these Smads results in a conformational change that presumably allows the inhibitory N-terminal MH1 domain to fold away from the C-terminal MH2 domain. This results in their multimerization with Smad4 and correlates with their movement from the cytoplasm to the nucleus [21±27]. Smad4, therefore, serves as a common component of multiple Smad related signaling pathways, while other individual Smads are activated by phosphorylation in response to speci®c signals. Thus, the Smads can be broken down into functional subgroups. Smads1, 2, 3, 5, and 8 are receptor speci®c Smads, and Smad4 is a common Smad. Added to this mix of receptor speci®c and common Smads are Smad6 and Smad7, the inhibitory Smads [28,29]. These Smads are transcriptionally upregulated by TGF-b and block the phosphorylation of receptor speci®c Smads by acting as pseudo-substrates for the type I receptor. In addition, Smad6 can compete for binding to the common e€ector Smad4 to form inactive complexes [30]. These two e€ects of Smad6 and Smad7 establish a feedback loop to turn o€ TGF-b signaling. 4. Nuclear Smad3/Smad4 complexes and transcription Nuclear Smad complexes play an important role in regulating transcription. The ®rst indication of a nuclear function for the Smads came from studies showing that the MH1 domains of Smad1 and Smad4 possess transcriptional activity in the context of Gal4DNA-binding domain fusion proteins [17,21]. Moreover, expression of speci®c Smad combinations mimics the transcriptional e€ect of TGF-b on both the PAI-1 promoter and the reporter construct, p3TP-lux [17,19,21,22,31]. These studies formed the basis for

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

work that de®ned a sequence-speci®c DNA binding function for Smad3/Smad4 complexes. By studying a speci®c TGF-b responsive promoter construct, 3TPlux, our lab demonstrated that Smad3 and Smad4 form a complex that binds to a bipartite sequence in concatamerized TPA responsive elements [32]. Furthermore, Smad4 itself, when expressed as a recombinant GST-fusion protein, can directly interact with these sequences. These ®ndings were particularly surprising since Smad4 contains no similarity to previously described DNA binding motifs. The ability of GST-Smad fusion proteins to bind DNA formed the basis of an oligonucleotide library screen for Smad binding elements. This screen de®ned the strongest binding elements for both Smad3 and Smad4 as the palindromic sequence, GTCTAGAC. In this sequence, bases 2 and 7 are least important in Smad recognition, whereas the other positions are critical for Smad binding [33]. Not only can this palindromic sequence bind to Smad3 and Smad4, but it can also confer TGF-b responsiveness to a previously nonresponsive promoter in a Smad4 dependent manner. When taken together, these two studies ascribed a novel function to the Smads as DNA binding proteins that, by binding to promoters, are able to activate transcription. This work nicely complements studies in drosophila demonstrating that the Smad homologue, MAD, interacts with the vg promoter through speci®c GC-rich DNA binding sites [34]. GC-rich MAD binding sites have subsequently been described in a number of drosophila genes including Ubx and tinman [34±36]. Direct DNA binding of MAD to these GC sequences activates transcription. Interestingly, the MAD binding elements and Smad3/Smad4 complex binding elements have very di€erent sequences. The DNA binding properties of MAD may, therefore, more re¯ect those of the BMP receptor speci®c Smad, Smad1, which shares a higher degree of sequence similarity with MAD than do Smad3 or Smad4. Since these initial studies, a number of Smad3/Smad4 binding elements have been

39

characterized in the promoters of several TGF-b responsive genes. These include; plasminogin activator inhibitor [37±40], type I collagen [41], type VII collagen [42], c-jun [43], and junB [44]. In Table 1, the sequence of these Smad3/Smad4 binding elements is presented. 5. What about Smad2? Although Smad2 and Smad3 share a high degree of sequence similarity and are both phosphorylated in response to TGF-b, they do not share similar DNA binding activities. Although Smad2 does participate in DNA binding complexes, as summarized below, it does not cooperate with Smad4 to bind to the sequences described above. This di€erence is due to a small insert in the MH1 domain of Smad2, corresponding to exon3. If this insert is removed, Smad2 acquires the DNA binding and transactivation properties of Smad3 on Smad binding element-containing promoters. Thus, although Smad2 and Smad3 are similar, a minor change in the MH1 domain imparts upon Smad2 a high level of functional distinction [45]. Recently, a splice variant of Smad2 has been described which lacks exon3, Smad2deltaexon3. This form of Smad2 binds Smad3 DNA binding sites, and can activate transcription with Smad4 in a manner identical to Smad3 [46]. This raises the possibility of a high level of functional redundancy between Smad2deltaexon3 and Smad3 itself. The extent and importance of this redundancy is still under investigation. 6. Smad-interacting transcription factors In certain promoter contexts, Smad complex binding is required for transcriptional regulation. In others, Smad binding is dispensable. A possible explanation for this phenomenon ®rst came from studies of activin responses in the Xenopus embryo development system.

Table 1 Smad DNA binding elements Smad3/Smad4 binding elements Sequence

Promoter

Reference

GTCTAGAC AATGAGTCAGACACCTCTGGCTG AGACAAGGTTGT GAGAGTCTGGACACGTGGGGAGTCAGCCG CCTAGACAGACAAAACCTAGACAATCACGTGGCTGG GGCAGACAGACAGACACAGCC TTTCTCAGACAGTCTGTCTGCC CCCAGGAGGCCCACCAGACAGATGGCTGAATCACAGGAGTGCCGGCGGGACCCATGGCCT

Oligonuleotide Screen Collagenase Promoter ÿ732 PAI-1 promoter ÿ688 PAI-1 promoter ÿ586 PAI-1 promoter +58 c-jun gene ÿ2788 JunB promoter ÿ504 Collagen VII promoter

[33] [32] [37,38] [39] [40] [43] [44] [42]

40

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

Activin, a TGF-b ligand superfamily member, activates transcription of the Mix.2 gene. This is associated with the binding of a complex containing the winged-helix transcription factor, FAST1, to the Mix.2 promoter. Subsequent studies of FAST1, revealed that in response to activin stimulation, FAST1, Smad2 and Smad4 interact in a ternary complex with DNA. In this complex, FAST1 makes DNA sequence speci®c interactions, while Smad4 stabilizes the FAST1/Smad2DNA association and activates transcription [47±49]. Smads, therefore, can a€ect transcription both by directly binding to DNA sequences in a promoter, and/or by indirectly binding to promoters through associated transcription factors. Studies of the mammalian homologue of FAST1 on the goosecoid and Mix.2 promoters have yielded similar results [50±53]. The function of the Smad2/Smad4/FAST1 transcriptional activation complex, in this context, however, can be inhibited by Smad3, which binds to adjacent DNA sequences and competes for binding of Smad2 to FAST1 [51,52]. This again highlights the functional distinctions between Smad2 and Smad3, and implies an antagonistic relationship between the two. In a similar fashion, Smad3 and Smad4 interact with multiple members of the AP1 transcription factor complex. Speci®cally, both Smad3 and Smad4 bind directly to JunB, c-Jun, and JunD [54,55]. These interactions occur between a conserved C-terminal region of the Jun family members and the Smads [54]. Smad3 can also bind uniquely to c-fos [55]. The interaction between c-Jun and Smad3 is stimulated by expression of activated TGF-b receptor. Furthermore, when overexpressed, Smad3, Smad4, c-fos and c-Jun can cooperatively activate transcription of concatamerized AP1 DNA binding elements [54]. Taken together, these ®ndings provide a possible explanation for the longstanding observation that TGF-b can activate transcription from consensus AP1 binding elements. Smad3 can interact with many other transcription factors including the steroid hormone receptors for vitamin D (VDR) [56] and glucocorticoids [57], the ATF/CREB family member, ATF-2 [58], the zinc ®nger proto-oncogene Evi-1 [59], and the transcription factor SIP1 [60]. With some of these transcription factors, such as the VDR, Smad3 functions as a co-activator [56]. Vitamin D stimulates complex formation between the VDR and Smad3 in the presence of the VDR co-activator, SRC-1. Functionally, Smad3 overexpression augments transcriptional activation of vitamin D responsive elements by the VDR. This e€ect is not dependent on the presence of Smad3 DNA binding elements [56]. Taken with the fact that vitamin D causes an increase in TGFb ligand and receptor expression [61], these ®ndings suggest that VDR and TGF-b may cooperate to activate gene expression. In some cases, such as al-

kaline phosphatase expression by human bone marrow stromal cells, this is true [62]. However, TGF-b and vitamin D functionally antagonize each other on the expression of other genes, including osteopontin and osteocalcin [63]. Thus, although Smad3 can behave as a co-activator for the VDR in certain contexts, the relationship of the biochemical interaction between the VDR and Smad3 to the functional interaction between VDR and TGF-b signaling remains unclear. Not only can the Smads bind to other transcription factors, they can also interact with the transcriptional co-activator and histone acetylase, p300. p300 binds to Smad1, Smad2 and Smad3, but not Smad4, through speci®c interactions between the Cterminal MH2 domain of the Smads and the carboxy half of p300 [64±67]. TGF-b stimulates the interaction between Smad3 and p300 in a Smad3phosphorylation dependent fashion [66]. Disrupting this interaction with the viral oncoprotein E1A, which binds to p300, blocks both Smad3/Smad4 overexpression-mediated and TGF-b-mediated transcriptional activation of the PAI-1 and 3TP-lux promoters. [64±66]. Similarly, E1A blocks FAST1dependent activation of activin responsive elements by TGF-b [67]. The p300 binding activity of E1A is required for these e€ects, ®rmly establishing the required role for p300 in Smad-dependent transcriptional regulation [64±67]. The interactions between the Smads and p300 may dictate promoter speci®city and mediate signal integration. For example, the c-Jun promoter contains both a Smad3/Smad4 and an AP1 DNA binding element. Each of these elements is required for activation by TGF-b [43]. Since AP1 complexes and Smad3/Smad4 complexes both bind to p300, having adjacent DNA binding sites for these transcription factors in a single promoter may strongly recruit p300 to activate transcription. This complex would also be stabilized by the directed protein-protein interaction between several Fos and Jun family members and the Smads. Multiple interactions between multiple proteins, each making required DNA contacts, may allow for a higher level of promoter speci®city than is provided by a single responsive element alone. These types of interactions also provide a mechanism for signal integration. LIF (leukemia inhibitory factor) and the TGF-b superfamily member, BMP2, cooperate to increase expression from the glial ®brillary acidic protein (GFAP) promoter in astrocyte di€erentiation. In this context, LIF signals to the transcription factor STAT3, and BMP signals to Smad1. Both STAT3 and Smad1 interact with p300 to cooperatively stimulate transcription [68]. Many transcription factors will likely form larger complexes with the Smads in this fashion to integrate signals to speci®c promoters.

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

7. Smad-interacting transcriptional repressors Not only do Smads bind to transcriptional co-activators, they also interact with transcriptional repressors. Recent studies have shown that Smad2, Smad3 and Smad4 can interact with the nuclear oncoproteins, SnoN and Ski [69±71]. These Smad/SnoN and Smad/ Ski complexes can form on consensus Smad binding elements to repress transcription. This repression likely occurs through the recruitment of histone deacetylases or through the nuclear transcriptional corepressor, NCoR. These types of interactions may act to globally modify chromatin structure and subsequently limit promoter availability [69±71]. An inhibitory in¯uence of Ski on Smad mediated transcription is further supported by the ®nding that Ski overexpression blocks TGF-b induced growth inhibition, myc repression, and JunB induction [69±71]. In addition to its interaction with Ski and SnoN, Smad2/Smad4 complexes can also recruit histone deacetylase to promoters through association with the homeodomain protein, TGIF [72]. An apparent paradox develops when a single transcription factor can bind to both p300, which acetylates histones to open promoters, and histone

41

deacetylase, which does the opposite. Several models have been proposed to resolve this paradox. In the case of SnoN, an attractive hypothesis is that SnoN turns o€ promoters after they have been activated for some time by TGF-b [69]. Indeed, SnoN levels drop quickly after TGF-b treatment, and subsequently rise back to baseline within two hours. This could provide a two-hour window of promoter activity before repression (through SnoN association) sets in. Alternatively, the relative levels of p300 and histone deacetylase may determine whether Smads have a positive or negative e€ect on transcription [72]. The promoter context in which the Smads bind may also in¯uence whether they interact with p300 or histone deacetylase. In this scenario, Smad interaction with certain promoters would primarily act to inhibit gene expression. Indeed, TGFb decreases the transcription of many genes, and the targeting of histone deacetylase to speci®c promoters would be a convenient way of achieving this repression. The role of Smad complexes in transcription are multiple and complex (Fig. 1). With so many potential interacting proteins and binding sequences, one begins to wonder what actually happens to Smad2, Smad3, and Smad4 when cells are stimulated by TGF-b. Do they activate transcription by binding p300, or repress transcription by binding histone deacetylase? Which promoters actually get loaded with Smad complexes in vivo? Are the functions of Smad3 with any of these transcription factors, especially the VDR, independent of its function with TGF-b? Is there enough Smad3 to bind all of these promoters and interact with all of these proteins, or does competition for Smad3 contribute to cross talk between pathways? Of course, the answer to these and many more questions is forthcoming with continued research and new discoveries.

8. Mouse models for Smad function

Fig. 1. Schematic representation of transcriptional regulation by Smad2, Smad3 and Smad4. In response to TGF-b binding, the type II TGF-b receptor phosphorylates the type I TGF-b receptor. This causes the activation of the type I receptor serine/threonine kinase. Both Smad2 and Smad3 are phosphorylated by the activated type I receptor. They subsequently form multimers with Smad4, translocate to the nucleus. In the nucleus, the Smad complexes can have several fates. Smad3/Smad4 complexes can directly bind to DNA through sequence speci®c interactions with Smad binding elements. Smad complexes can also associate with promoters through interactions with the transcription factors listed. Once on a promoter, Smad complexes can bind to both transcriptional activators and repressors.

To more precisely de®ne the functions for which the Smads are required, several groups have generated mice that harbor targeted disruptions of speci®c Smads [73±80]. Mice that harbor two mutated alleles for the Smads involved in TGF-b signaling (Smad2, Smad3 and Smad4) have been described. The Smad3 null mice are the only ones of these that survive through embryogenesis and into adulthood [73±75]. Smad4 null mice die at embryonic day 7.5 secondary to a failure to gastrulate. This defect can be rescued by aggregation of Smad4 null ES cells with tetraploid wild type morulae, indicating an important role for Smad4 in visceral endoderm di€erentiation. This defect in di€erentiation results in the subsequent failure of epiblast gastrulation. In the tetrapoid aggregated

42

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

embryos, however, a second defect arises from a failure of anterior patterning [76]. Smad2 null mice, like Smad4 null mice, die during development. However, several groups have generated Smad2 null mice and the embryonic phenotypes di€er signi®cantly. Two independent groups have reported that Smad2 null embryos fail to form an organized egg cyclinder, and subsequently lack extraembryonic structures. These mice also fail to induce messodermal di€erentiation [77,78]. A third group reports that their Smad2 targeted mice forms relatively normal extraembryonic membranes and mesodermal structures, but entirely lacks tissues of the embryonic germ layers [79]. The targeting vectors used to generate these mice are di€erent and this may account for the di€erent phenotypes observed. In any interpretation, however, Smad2 and Smad4 play critical, non-redundant roles in early embryonic development [76±79]. The early embryonic lethality of these mice makes investigating the functions of these molecules in the adult animal impossible and on a cellular level dicult. Smad3 targeted mice, however, survive to adulthood and display an array interesting phenotypes. 9. A requirement for Smad3 in TGF-b b signaling Three groups have independently targeted Smad3, and each has obtained mice with subtly di€erent phenotypes. The targeting strategies used by these groups are as follows. Brie¯y, Smad3 was disrupted by either: (i) replacement of the ®rst exon, containing the initiator methionine, with a neomycin expression cassette [73], (ii) replacement of exon8 with a neomycin cassette, thereby eliminating the carboxy terminal TGF-b phosphorylation sequence [74], or (iii) replacement of exon2 with a neomycin cassette that also expresses bgal under the control of the Smad3 promoter [75]. With all of these strategies, no functional full length Smad3 is produced. In addition, the protein fragment that could be produced in the exon8-replacement strategy cannot activate transcription in a ligand-dependent or independent manner. In a similar fashion, the Nterminal fragment of Smad3 that could be produced in the exon2-targeted mice has no dominant negative functions in the Xenopus embryo development system. The most striking initial ®nding in the Smad3 null mice is their viability. TGF-b plays many essential roles in development. These are highlighted by the lethal nature of the TGF-b ligand and receptor null mice (reviewed in Ref. [81]). Within 20 h of birth, homozygous TGF-b3 null mice die with phenotypic features including delayed pulmonary development and defective palatogenesis [82]. TGF-b2 null mice also exhibit perinatal mortality and a wide range of developmental defects including cardiac, lung, cranio-

facial, limb, spinal column, eye, inner ear and urogenital defects [83]. Like the ligand null mice, receptor null mice also have a lethal phenotype. The homozygous type II TGF-b receptor mutant mice die at 10.5 days gestation with defects in yolk sac hematopoiesis and vasculogenesis [84]. The Smad3 null mice, however, display none of these developmental defects. The apparent dispensability of Smad3 in development may have several explanations. Smad2, or the Smad3-like, Smad2deltaexon3 splice variant, may partially or completely compensate for the loss of function of Smad3 in development. In this scenario, Smad3 functions in development, but its absence is not missed. Alternatively, the functions of TGF-b in development may be truly independent of Smad3. Although Smad3 may not be required for normal development, a loss of Smad3 dramatically impairs certain cellular aspects of TGF-b signaling. Studies of Smad3 null embryonic ®broblasts have demonstrated a loss of TGF-b induced growth inhibition in these cells [73]. This requirement for Smad3 in growth inhibition is also seen in Smad3 null keratinocytes, Smad3 null astrocytes, and Smad3 null primary splenocytes stimulated with an antibody directed against the CD3 component of the T-cell receptor complex [73,74,85,86]. Studies of primary keratinocytes have provided mechanistic insights into the required role of Smad3 in growth inhibition. In keratinocytes, TGF-b causes a down regulation of c-myc expression. This e€ect of TGF-b is lost in Smad3 null keratinocytes [87]. Although the speci®c pathways between Smad3 and cmyc expression are still under investigation, this ®nding provides a solid molecular link between Smad3 and growth regulation. Other possible growth regulating targets of Smad3 are the cyclin dependent kinase inhibitors p21, and p15. TGF-b increases p21 and p15 expression by activating transcription through critical Sp1 binding sites in the p21 and p15 promoters [88,89]. A role for Smads in this response is inferred from the ®nding that co-overexpression of Smad3 and Smad4, in certain cell types, activates both the p21 promoter and transactivation by Sp1 [90]. However, none of the primary cells studied to date show a signi®cant increase in these CdkI's on TGF-b treatment. Studying the requirement of Smad3 in these e€ects, therefore, has not yet been possible. Thus, although progress has been made in describing a required role for Smad3 in growth regulation, the molecular mechanisms behind this e€ect are still largely unknown. An interesting comparison can be made between Smad3 and Smad4 null cells. A required role for Smad4 in TGF-b mediated growth inhibition has been demonstrated in colon carcinoma cells. In these studies, a targeted disruption of Smad4 eliminates the cell's growth inhibitory response to TGF-b [91]. In

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

other cellular contexts, however, Smad4 is dispensable for TGF-b's growth inhibitory e€ect [92]. For example, in a speci®c Smad4-null pancreatic cancer cell line, TGF-b mediated growth inhibitory and transcriptional responses are intact. Cellular responses to TGF-b in this cell line rely not on Smad4, but instead, on an intact ras pathway. These ®ndings raise the possibility that cell type or cell context may be critical in dictating the pathways that are used by TGF-b to exert its cellular e€ects. In addition to having critical roles in cell growth regulation, Smad3 is also a required regulator of the expression of a number of genes. Studies of Smad3 null ®broblasts have demonstrated that Smad3 is required for the TGF-b induced expression of the reporter construct 3TP-lux, c-jun, and PAI-1 [43,73]. Since so many important aspects of TGF-b signaling on a cellular level are aberrant, it becomes surprising that the mice survive through embryogenesis and into adulthood. 10. Smad3 and the immune system One of the most well studied physiological properties of TGF-b is its ability to inhibit immune responses (reviewed in Ref. [1]). These immunosuppressive e€ects of TGF-b are best inferred from the phenotype of the TGF-b1 null mice. TGF-b1 null mice exhibit a phenotype that can be largely attributed to an over-active immune system [93,94]. These mice succumb to a multi-tissue in¯ammatory disease, produce autoimmune antibodies and die in the ®rst several weeks of life. These phenotypes can be completely reversed by breeding to a SCIDS mouse strain to produce mice lacking functional B and T cells, or by chronic administration of the immunosuppressive drugs FK506 or rapamycin, which prevent B and T cell activation. These studies implicate the autoimmune disease that develops in the TGF-b1 null mice as the etiology of their lethality and almost all of their disease phenotypes (reviewed in Ref. [95]). Immune system dysfunction could be suspected in the Smad3 null mice based on the loss of TGF-b mediated growth inhibition of primary splenocytes. Growth inhibition of lymphocytes by TGF-b is one of its major immunosuppressive e€ects. In addition, the high level of Smad3 expression in the spleen and thymus also suggests a role for Smad3 in immune function [73]. Smad3 null mice do, in fact, exhibit a phenotype consistent with an overactive immune system [74]. These mice develop in¯ammation in the stomach, nasal mucosa, pancreas and intestinal mucosa, with in®ltration of T-cells and neutrophils [74,87]. This in¯ammation can eventually lead to rectal prolapse and subsequent wasting and death of older

43

mice. Although the precise etiology of this in¯ammatory disease is still under investigation, TGF-b has many properties which may be lost to contribute to this phenotype, from the loss of growth inhibition, which has been documented, to more subtle changes in T-cell populations. In contrast to this phenotype is the increased susceptibility of these mice to infection. Speci®cally, Smad3 null mice develop large bacterial subcutaneous and mucosal abscesses surrounding the mouth, head, neck and eyes [74,87]. These abscesses contain bacteria that would normally not cause disease in the mouse, Pasterella multocida and Providencia rettgeri. The occurrence of these abscesses is, in part, attributed to a loss of migration to TGF-b of the Smad3 null neutrophils [74]. However, these abscesses contain neutrophils, and it is not clear that TGF-b is a major chemoattractant for neutrophils to a site of an overwhelming bacterial infection. Thus, although decreased neutrophil migration is consistent with abscess formation, and neutrophil dysfunction is a prominent etiology of granulomatous diseases in humans, proof that a lack of neutrophil migration to TGF-b causes infection in these mice is still pending. Independent of the etiology, since a major phenotype of the Smad3 null mouse is one of immune compromise, Smad3 appears to play dual roles in immune regulation, both in immune cell growth suppression and in combating bacterial infections.

11. Smad3 and the skeletal system Since TGF-b plays multiple essential roles in bone development and Smad3 functionally and physically interacts with the vitamin D receptor, a careful evaluation of the bones of the Smad3 null mice was undertaken in our lab [87]. Smad3 null mice were found to have a decreased bone density. This is apparent in Xrays of forelimbs and tail vertebrae from adult mice. This low bone density is present in young mice as well as old, and does not appear to worsen with age. Further studies of calcium metabolism in these Smad3 null mice revealed low total bone calcium, with normal serum calcium and normal serum parathyroid levels. This is in contrast to mice lacking VDR. These mice, like the Smad3 null mice, have low bone density, but also have a decrease in serum calcium and an increase in serum parathyroid hormone [96,97]. Thus, although bone density is decreased in Smad3 null mice, this is not from a functional defect in calcium metabolism, or, therefore, from a defect in vitamin D mediated calcium homeostasis. To more rigorously test this hypothesis, interperitoneal injection of vitamin D and subsequent evaluation of serum calcium was per-

44

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

formed. These studies demonstrated a normal increase in calcium in response to vitamin D [87]. Although the experiments above do not rule out an important function of Smad3 in VDR signaling, the phenotype of low bone density may not be from a lack of vitamin D responses. Instead, this phenotype may be due to a loss of one or many of the e€ects of TGFb on bone formation, and metabolism. TGF-b is a potent stimulator of bone formation. This e€ect of TGF-b is seen when it is injected under the periosteum of either the mouse femur or calavarae [98,99]. TGF-b treatment in this manner leads to a proliferation of periosteal osteoblasts, calci®cation and subsequent formation of mature bone. In vitro, many e€ects of TGFb on osteoblasts, the cell type responsible for the formation of mature bone, have been described. TGF-b is a potent stimulator of osteoblast proliferation [100,101], and migration in culture [102]. TGF-b also increases osteoblast expression of type I collagen, the major collagen in bone, and osteoclastogenesis inhibitory factor, which can inhibit the function of osteoclasts and, therefore, inhibit bone resorbtion [103]. In contrast to its bone-promoting functions, TGF-b also inhibits the di€erentiation of osteoblasts to their mature calci®ed phenotype in culture [104]. These ®ndings, taken together, support a possible role for TGFb in bone repair or remodeling. TGF-b, which is released in large amounts in response to bone fracture, may cause proliferation of osteoblasts, and delay their maturation until a sucient population has been established to repair the fracture. During this time, osteoblasts could produce collagen and other proteins that would serve as the matrix for new bone formation. A better understanding of the Smad3 null mouse bone phenotype may provide insight into the precise function of Smad3 in this system to promote bone density and further our overall understanding of the role of TGF-b in the skeletal system. A second prominent skeletal system phenotype in the Smad3 null mice is a high penetrance of limb and joint abnormalities. At birth, approximately 30% of mice have an abnormal medial torquing of the wrist joints. This can e€ect either one or both joints in a single mouse. This phenotype has a high degree of similarity to the TGF-b RII dominant negative transgenic mice with expression in skeletal tissue [105]. In these transgenic mice, the defect is thought to be largely in chondrocyte di€erentiation. The speci®c aspects of TGF-b signaling that are disrupted in the Smad3 mice to give this phenotype, however, have yet to be determined. 12. Tumorigenesis in the Smad null mice The ®rst identi®ed mammalian Smad was cloned as

a tumor suppressor that is gene deleted in pancreatic carcinomas, DPC4 [20]. This gene later became known as Smad4. Since these initial ®ndings, the evidence for a role of Smads in tumorigenesis has grown. Smad4 is often mutated in sporadic pancreatic and colon carcinomas (reviewed in Ref. [106]). Germline mutations in a single copy of Smad4 have also been described in juvenile polyposis, a familial dominantly inherited cancer syndrome that predisposes to hamartomatous polyps and colon carcinomas [107]. Like Smad4, Smad2 is also mutated in colon carcinomas [14]. Mutations in Smad3, however, are not associated with human cancer. Although mouse and human tumorigenesis may likely have many di€erences, the generation of Smad2, Smad3 and Smad4 null mice present an ideal way to study further the role of these proteins in tumor formation and progression. In contrast to its role in human colon cancer, mutations in Smad3 predispose to mouse colon cancer. The Smad3 (exon2-targeted) homozygous mice have a 100% incidence of colorectal cancer in the sv 129 background, by 4 to 6 months of age [75]. These tumors invade through the colon wall to form distant lymphatic metastasis. In these mice, tumor cells have a higher rate of proliferation than adjacent tissue, and produce large amounts of mucin. The penetrance of this phenotype is somewhat less (30%) in the mixed 129/c57 bl6 background. Excitement for these ®ndings is tempered by the much lower incidence of colon cancer observed in the Smad3 exon8- and exon1-targeted mice [74,87]. Although the di€erences in these mice may be due to di€erent targeting strategies, no experimental evidence for this has been described. These di€erences, therefore, remain unexplained. In studying the tumor phenotype in the Smad3 mice, however, one must take into consideration the in¯ammatory disease in the colons of these mice. This chronic in¯ammation may predispose to colon carcinoma in a way similar to that seen in the human diseases, ulcerative colitis, and Chron's disease. Thus tumorigenesis may not arise from a direct loss of TGF-b mediated growth inhibition of colonic epithelial cells, but rather the indirect proliferative response and constant remodeling seen in severe bowel in¯ammation. If this is the case, environmental conditions that lead to greater bowel in¯ammation may cause a higher incidence of colon cancer. The tumor incidence in the Smad3 heterozygous mice should also be informative. If tumors form in Smad3 heterozygotes (which do not develop colon in¯ammation), and these tumors have a loss of Smad3 heterozygosity, this would provide strong evidence for the role of Smad3 in colon cancer. A second intestinal tumor phenotype has been described in mice that carry a single mutated copy of Smad4 and a single mutated copy of APC [108]. Like

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

Smad4, APC is a tumor suppressor protein. It exerts this e€ect by interfering with the b-catenin-TCF/LEF transcription factor complex. By binding to b-catenin, APC can target b-catenin for phosphorylation and subsequent degradation. The degradation of b-catenin blocks transcription of b-catenin-TCF/LEF target genes, such as myc and cyclin D. By blocking expression of these genes, APC inhibits cellular proliferation. Thus a loss of APC can lead to disregulated bcatenin-TCF/LEF transcriptional activation and cellular proliferation (reviewed in Ref. [109]). APC mutations alone are sucient to cause tumors, both in humans and in mice. In humans, APC is the single most mutated gene in colon cancer [109]. In mice a single mutant copy of APC leads to a high incidence of intestinal tumors with a loss of heterozygosity at the wild type allele [110]. In Smad4/APC mutant compound heterozygote mice, the intestinal polyps observed in the background of APC mutations developed into more malignant tumors which displayed extensive stromal cell proliferation, and submucosal invasion. Thus, Smad4 and APC mutations cooperate, leading to a much more aggressive tumor phenotype. Identifying the molecular basis for this functional interaction will likely provide insight into the roles of these signaling pathways in tumorigenesis.

13. Future perspectives Even with all of the recent advances in Smad signaling, we have only scratched the surface. Many more Smad interacting transcription factors, co-activators and co-repressors will probably be described. These interacting proteins will likely function with the Smads as integrators of cell signaling to either repress or activate gene expression. The net e€ect of the Smads on any one promoter will depend on complex biochemical interactions between multiple protein factors and DNA, which are only beginning to be described. Studying these processes will surely increase our understanding of both Smad and TGF-b function. De®ning the transcriptional targets of the Smads may also provide insight into novel proteins or pathways that are responsible for the growth inhibitory and tumor suppressor functions of the Smads, thus broadening our understanding of tumorigenesis. Transgenic and targeted mouse models may prove to be invaluable in bridging the biochemistry of these interactions and transcriptional targets to mouse physiology and disease processes.

45

References [1] Letterio JJ, Roberts AB. Regulation of immune responses by TGF-b. Annu Rev Immunol 1998;16:137±61. [2] O'Kane S, Ferguson MW. Transforming growth factor-bs and wound healing. Int J Biochem Cell Biol 1997;29:63±78. [3] Border WA, Noble NA. Transforming growth factor-b in tissue ®brosis. N Engl J Med 1994;331:1286±92. [4] Markowitz SD, Roberts AB. Tumor suppressor activity of the TGF-b pathway in human cancers. Cytokine Growth Factor Rev 1996;7:93±102. [5] Akhurst RJ, Balmain A. Genetic events and the role of TGFb in epithelial tumour progression. J Pathol 1999;187:82±90. [6] Moses HL, Serra R. Regulation of di€erentiation by TGF-b. Curr Opin Genet Dev 1996;6:581±6. [7] Roberts AB. Molecular and cell biology of TGF-b. Miner Electrolyte Metab 1998;24:111±9. [8] Hu PP-C, Datto MB, Wang X-F. Molecular mechanisms of transforming growth factor-b signaling. Endocrine Rev 1998;19:349±63. [9] Massague J. TGF-b signal transduction. Annu Rev Biochem 1998;67:753±91. [10] Attisano L, Wrana JL, Lopez-Casillas F, Massague J. TGF-b receptors and actions. Biochim Biophys Acta 1994;1222:71±80. [11] Sekelsky JJ, Newfeld SJ, Raftery LA, Charto€ EH, Gelbart WM. Genetic characterization and cloning of mothers against dpp, a gene required for decapentaplegic function in Drosophila melanogaster. Genetics 1995;139:1347±58. [12] Raftery LA, Twombly V, Wharton K, Gelbart WM. Genetic screens to identify elements of the decapentaplegic signaling pathway in Drosophila. Genetics 1995;139:241±54. [13] Savage C, Das P, Finelli AL, Townsend SR, Sun CY, Baird SE, Padgett RW. Caenorhabditis elegans genes sma-2, sma-3, sma-4 de®ne a conserved family of transforming growth factor b pathway components. Proc Natl Acad Sci USA 1996;93:790±4. [14] Eppert K, Scherer SW, Ozcelik H, Pirone R, Hoodless P, Kim H, Tsui LC, Bapat B, Gallinger S, Andrulis IL, Thomsen GH, Wrana JL, Attisano L. MADR2 maps to 18q21 and encodes a TGFb-regulated MAD-related protein that is functionally mutated in colorectal carcinoma. Cell 1996;86:543±52. [15] Hoodless PA, Haerry T, Abdollah S, Stapleton M, O'Connor MB, Attisano L, Wrana JL. MADR1, a MAD-related protein that functions in BMP2 signaling pathways. Cell 1996;85:489± 500. [16] Lechleider RJ, de Coestecker MP, Dehejia A, Polymeropoulos MH, Roberts AB. Serine phosphorylation, chromosomal localization and transforming growth factor-b signal transduction by human bsp-1. J Biol Chem 1996;271:17617±20. [17] Liu F, Hata A, Baker JC, Goody J, Carcamo J, Harland RM, Massague J. A human Mad protein acting as a BMP-regulated transcriptional activator. Nature 1996;381:620±3. [18] Yingling JM, Das P, Savage C, Zhang M, Padgett RW, Wang X-F. Mammalian dwar®ns are phosphorylated in response to TGF-b and are implicated in control of cell growth. Proc Natl Acad Sci USA 1996;93:8940±4. [19] Zhang Y, Feng X, We R, Derynck R. Receptor-associated Mad homologues synergize as e€ectors of the TGF-b response. Nature 1996;383:168±272. [20] Hahn SA, Schutte M, Hoque AT, Moskaluk CA, da Costa LT, Rozenblum E, Weinstein CL, Fischer A, Yeo CJ, Hruban RH, Kern SE. DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1. Science 1996;271:350±3. [21] Lagna G, Hata A, Hemmati-Brivanlou A, Massague J. Partnership between DPC4 and Smad proteins in TGF-b signalling pathways. Nature 1996;383:832±6.

46

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

[22] Macias-Silva M, Abdollah S, Hoodless PA, Pirone R, Attisano L, Wrana JL. MADR2 is a substrate of the TGF-b receptor and its phosphorylation is required for nuclear accumulation and signaling. Cell 1996;87:1215±24. [23] Kretzschmar M, Liu F, Hata A, Goody J, Massague J. The TGF-b family mediator Smad1 is phosphorylated directly and activated functionally by the BMP receptor kinase. Genes & Dev 1997;11:984±95. [24] Baker JC, Harland RM. From receptor to nucleus: the Smad pathway. Curr Opin in Genet Dev 1997;7:467±73. [25] Heldin CH, Miyazono K, ten Dijke P. TGF-b signaling from cell membrane to nucleus through Smad proteins. Nature 1997;390:465±71. [26] Zhang Y, Derynck R. Regulation of Smad signaling by protein association and signalling crosstalk. Trends in Cell Biology 1999;9:274±9. [27] Hata A, Lo RS, Wotton D, Lagna G, Massague J. Mutations increasing autoinhibition inactivate tumour suppressors Smad2 and Smad4. Nature 1997;388:82±7. [28] Imamura T, Takase M, Nishihara A, Oeda E, Hanai J, Kawabata M, Miyazono K. Smad6 inhibits signalling by the TGF-b superfamily. Nature 1997;389:622±6. [29] Nakao A, Afrakhte M, Moren A, Nakayama T, Christian JL, Heuchel R, Itoh S, Kawabata M, Heldin NE, Heldin CH, ten Dijke P. Identi®cation of Smad7, a TGF-b-inducible antagonist of TGF-b signaling. Nature 1997;389:631±5. [30] Hata A, Lagna G, Massague J, Hemmati-Brivanlou A. Smad6 inhibits BMP/Smad1 signaling by speci®cally competing with the Smad4 tumor suppressor. Genes & Dev 1998;12:186±97. [31] Chen Y, Lebrun JJ, Vale W. Regulation of transforming growth factor-b- and activin-induced transcription by mammalian Mad proteins. Proc Natl Acad Sci USA 1996;93:12992±7. [32] Yingling JM, Datto MB, Wong C, Frederick JP, Liberati NT, Wang X-F. The tumor suppressor Smad4 is a transforming growth factor b-inducible DNA binding protein. Mol Cell Biol 1997;17:7019±28. [33] Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B, Kern SE. Human Smad3 and Smad4 are sequence-speci®c transcription activators. Mol Cell 1998;1:611±8. [34] Kim J, Johnson K, Chen HJ, Carroll S, Laughon A. Drosophila Mad binds to DNA and directly mediate activation of vestigial by Decapentaplegic. Nature 1997;388:304±8. [35] Xu X, Yin Z, Hudson JB, Ferguson EL, Frasch M. Smad proteins act in combination with synergistic and antagonistic regulators to target Dpp responses to the Drosophila mesoderm. Genes & Dev 1998;12:2354±70. [36] Szuts D, Eresh S, Bienz M. Functional intertwining of Dpp and EGFR signaling during Drosophila endoderm induction. Genes & Dev 1998;12:2022±35. [37] Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S, Gauthier JM. Direct binding of Smad3 and Smad4 to critical TGF-binducible elements in the promoter of human plasminogen activator inhibitor-type 1 gene. EMBO J 1998;17:3091±100. [38] Song CZ, Siok TE, Gelehrter TD. Smad4/DPC4 and Smad3 mediate transforming growth factor-b (TGF-b) signaling through direct binding to a novel TGF-b-responsive element in the human plasminogen activator inhibitor-1 promoter. J Biol Chem 1998;273:29287±90. [39] Stroschein SL, Wang W, Luo K. Cooperative binding of Smad proteins to two adjacent DNA elements in the plasminogen activator inhibitor-1 promoter mediates transforming growth factor b-induced smad-dependent transcriptional activation. J Biol Chem 1999;274:9431±41. [40] Hua X, Liu X, Ansari DO, Lodish HF. Synergistic cooperation of TFE3 and smad proteins in TGF-b-induced tran-

[41]

[42]

[43]

[44]

[45] [46]

[47] [48] [49] [50] [51]

[52] [53] [54]

[55] [56]

[57]

[58]

scription of the plasminogen activator inhibitor-1 gene. Genes & Dev 1998;12:3084±95. Chen SJ, Yuan W, Mori Y, Levenson A, Trojanowska M, Varga J. Stimulation of type I collagen transcription in human skin ®broblasts by TGF-b: involvement of Smad 3. J Invest Dermatol 1999;112:49±57. Vindevoghel L, Kon A, Lechleider RJ, Uitto J, Roberts AB, Mauviel A. Smad-dependent transcriptional activation of human type VII collagen gene (COL7A1) promoter by transforming growth factor-b. J Biol Chem 1998;273:13053±7. Wong C, Rougier-Chapman EM, Frederick JP, Datto MB, Liberati NT, Li JM, Wang X-F. Smad3-Smad4 and AP-1 complexes synergize in transcriptional activation of the c-Jun promoter by transforming growth factor-b. Mol Cell Biol 1999;19:1821±30. Jonk LJ, Itoh S, Heldin CH, ten Dijke P, Kruijer W. Identi®cation and functional characterization of a Smad binding element [SBE] in the JunB promoter that acts as a transforming growth factor-b, activin, bone morphogenetic proteininducible enhancer. J Biol Chem 1998;273:21145±52. Dennler S, Huet S, Gauthier JM. A short amino-acid sequence in MH1 domain is responsible for functional di€erences between Smad2 and Smad3. Oncogene 1999;18:1643±8. Yagi K, Goto D, Hamamoto T, Takenoshita S, Kato M, Miyazono K. Alternatively spliced variant of Smad2 lacking exon 3. Comparison with wild-type Smad2 and Smad3. J Biol Chem 1999;274:703±9. Chen X, Rubock MJ, Whitman M. A transcriptional partner for MAD proteins in TGF-b signaling. Nature 1996;383:691± 6. Chen X, Weisberg E, Fridmacher V, Watanabe M, Naco G, Whitman M. Smad4 and FAST-1 in the assembly of activinresponsive factor. Nature 1997;389:85±9. Liu F, Pouponnot C, Massague J. Dual role of the Smad4/ DPC4 tumor suppressor in TGF-b inducible transcriptional complexes. Genes & Dev 1997;11:3157±67. Liu B, Dou CL, Prabhu L, Lai E. FAST-2 is a mammalian winged-helix protein which mediates transforming growth factor b signals. Mol Cell Biol 1999;19:424±30. Labbe E, Silvestri C, Hoodless PA, Wrana JL, Attisano L. Smad2 and Smad3 positively and negatively regulate TGF-bdependent transcription through the forkhead DNA-binding protein FAST2. Mol Cell 1998;2:109±20. Nagarajan RP, Liu J, Chen Y. Smad3 Inhibits Transforming Growth Factor-b and Activin Signaling by Competing with Smad4 for FAST-2 Binding. J Biol Chem 1999;274:31229±35. Zhou S, Zawel L, Lengauer C, Kinzler KW. Vogelstein B Characterization of human FAST-1, a TGF-b and activin signal transducer. Mol Cell 1998;2:121±7. Liberati NT, Datto MB, Frederick JP, Shen X, Wong C, Rougier-Chapman EM, Wang X-F. Smads bind directly to the Jun family of AP-1 transcription factors. Proc Natl Acad Sci USA 1999;96:4844±9. Zhang Y, Feng XH, Derynck R. Smad3 and Smad4 cooperate with c-Jun/c-Fos to mediate TGF-b-induced transcription. Nature 1998;394:909±13. Yanagisawa J, Yanagi Y, Masuhiro Y, Suzawa M, Watanabe M, Kashiwagi K, Toriyabe T, Kawabata M, Miyazono K, Kato S. Convergence of transforming growth factor-b and vitamin D signaling pathways on Smad transcriptional coactivators. Science 1999;283:1317±21. Song CZ, Tian X, Gelehrter TD. Glucocorticoid receptor inhibits transforming growth factor-b signaling by directly targeting the transcriptional activation function of Smad3. Proc Natl Acad Sci USA 1999;96:11776±81. Sano Y, Harada J, Tashiro S, Gotoh-Mandeville R, Maekawa T, Ishii S. ATF-2 is a common nuclear target of Smad and

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48

[59]

[60]

[61]

[62]

[63]

[64]

[65]

[66]

[67] [68]

[69] [70] [71] [72] [73]

[74]

[75]

TAK1 pathways in transforming growth factor-b signaling. J Biol Chem 1999;274:8949±57. Kurokawa M, Mitani K, Irie K, Matsuyama T, Takahashi T, Chiba S, Yuzaki Y, Matsumoto K, Hirai H. The oncoprotein Evi-1 represses TGF-b signalling by inhibiting Smad3. Nature 1998;394:92±6. Verschueren K, Remacle JE, Collart C, Kraft H, Baker BS, Tylzanowski P, Nelles L, Wuytens G, Su MT, Bodmer R, Smith JC, Huylebroeck D. SIP1, a novel zinc ®nger/homeodomain repressor, interacts with Smad proteins and binds to 5'CACCT sequences in candidate target genes. J Biol Chem 1999;274:20489±98. Wu Y, Haugen JD, Zinsmeister AR, Kumar R. 1a25-dihydroxyvitamin D3 increases transforming growth factor and transforming growth factor receptor type I and II synthesis in human bone cells. Biochem Biophys Res Com 1997;239:734±9. Liu P, Oyajobi BO, Russell RG, Scutt A. Regulation of osteogenic di€erentiation of human bone marrow stromal cells: interaction between transforming growth factor-b and 1,25(OH) vitamin D(3) In vitro. Calcif Tissue Int 1999;65:173±80. Staal A, Van Wijnen AJ, Desai RK, Pols HA, Birkenhager JC, Deluca HF, Denhardt DT, Stein JL, Van Leeuwen JP, Stein GS, Lian JB. Antagonistic e€ects of transforming growth factor-b on vitamin D3 enhancement of osteocalcin and osteopontin transcription: reduced interactions of vitamin D receptor/retinoid X receptor complexes with vitamin E response elements. Endocrinology 1996;137:2001±11. Feng XH, Zhang Y, Wu RY, Derynck R. The tumor suppressor Smad4/DPC4 and transcriptional adaptor CBP/p300 are coactivators for Smad3 in TGF-b-induced transcriptional activation. Genes & Dev 1998;12:2153±63. Nishihara A, Hanai JI, Okamoto N, Yanagisawa J, Kato S, Miyazono K, Kawabata M. Role of p300, a transcriptional coactivator, in signalling of TGF-b. Genes Cells 1998;3:613± 23. Shen X, Hu PP, Liberati NT, Datto MB, Frederick JP, Wang X-F. TGF-b-induced phosphorylation of Smad3 regulates its interaction with the coactivator p300/CREB-binding protein. Mol Biol Cell 1998;9:3309±19. Pouponnot C, Jayaraman L, Massague J. Physical and functional interaction of Smads and p300/CBP. J Biol Chem 1998;273:22865±8. Nakashima K, Yanagisawa M, Arakawa H, Kimura N, Hisatsune T, Kawabata M, Miyazono K, Taga T. Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science 1999;284:479±82. Stroschein SL, Wang W, Zhou S, Zhou Q, Luo K. Negative feedback regulation of TGF-b signaling by the SnoN oncoprotein. Science 1999;286:771±4. Sun Y, Liu X, Ng Eaton E, Lane WS, Lodish HF, Weinberg RA. Interaction of the Ski oncoprotein with Smad3 regulated TGF-b signaling. Mol Cell 1999;4:1±20. Luo K, Stroschein S, Wang W, Chen D, Martens E, Zhou S, Zhou Q. The Ski oncoprotein interacts with the Smad proteins to repress TGF-b signaling. Genes & Dev 1999;13:2196±206. Wotton D, Lo RS, Lee S, Massague J. A Smad transcriptional corepressor. Cell 1999;97:29±39. Datto MB, Frederick JP, Pan L, Borton AJ, Zhuang Y, Wang X-F. Targeted disruption of Smad3 reveals an essential role in transforming growth factor-b-mediated signal transduction. Mol Cell Biol 1999;19:2495±504. Yang X, Letteria JJ, Lechleider RJ, Chen L, Hayman R, Gu H, Roberts AB, Deng C. Targeted disruption of Smad3 results in impaired mucosal immunity and diminished T cell responsivness to TGF-b. EMBO J 1999;18:1280±91. Zhu Y, Richardson JA, Parada JM. Smad3 mutant mice develop metastatic colorectal cancer. Cell 1998;94:703±14.

47

[76] Sirard C, de la Pompa JL, Elia A, Itie A, Mirtsos C, Cheung A, Hahn S, Wakeham A, Schwartz L, Kern SE, Rossant J, Mak TW. The tumor suppressor gene Smad4/Dpc4 is required for gastrulation and later for anterior development of the mouse embryo. Genes & Dev 1998;12:107±19. [77] Weinstein M, Yang X, Li C, Xu X, Gotay J, Deng CX. Failure of egg cylinder elongation and mesoderm induction in mouse embryos lacking the tumor suppressor Smad2. Proc Natl Acad Sci USA 1998;95:9378±83. [78] Nomura M, Li E. Smad2 role in mesoderm formation, leftright patterning and craniofacial development. Nature 1998;393:786±90. [79] Waldrip WR, Biko€ EK, Hoodless PA, Wrana JL, Robertson EJ. Smad2 signaling in extraembryonic tissues determines anterior-posterior polarity of the early mouse embryo. Cell 1998;92:797±808. [80] Yang X, Castilla LH, Xu X, Li C, Gotay J, Weinstein M, Liu PP, Deng CX. Angiogenesis defects and mesenchymal apoptosis in mice lacking Smad5. Development 1999;126:1571±80. [81] Bottinger EP, Letterio JJ, Roberts AB. Biology of TGF-b in knockout and transgenic mouse models. Kidney Int 1997;51:1355±60. [82] Kaartinen V, Voncken JW, Shuler C, Warburton D, Bu D, Heisterkamp N, Gro€en J. Abnormal lung development and cleft palate in mice lacking TGF-b3 indicates defects of epithelial-mesenchymal interaction. Nat Genet 1995;4:415±21. [83] Sanford LP, Ormsby I, Gittenberger-de Groot AC, Sariola H, Friedman R, Boivin GP, Cardell EL, Doetschman T. TGFb2 knockout mice have multiple developmental defects that are non-overlapping with other TGFb knockout phenotypes. Development 1997;13:2659±70. [84] Oshima M, Oshima H, Taketo MM. TGF-b receptor type II de®ciency results in defects of yolk sac hematopoiesis and vasculogenesis. Dev Biol 1996;179:297±302. [85] Rich JN, Zhang M, Datto MB, Bigner DD, Wang X-F. Transforming growth factor-b-mediated p15 induction and growth inhibition in astrocytes is Smad3-dependent and a pathway prominently altered in human glioma cell lines. J Biol Chem (in press). [86] Ashcroft GS, Yang X, Glick AB, Weinstein M, Letterio JJ, Mizel DE, Anzano M, Greenwell-Wild T, Wahl SM, Deng C, Roberts AB. Mice lacking Smad3 show accelerated wound healing and an impaired local in¯ammatory response. Nature Cell Biol 1999;1:260±6. [87] Wang XF, Datto MB, Liberati NT, Bornt AJ, Fredrick JP. Unpublished observations 1999. [88] Datto MB, Yu Y, Wang X-F. Functional analysis of the transforming growth factor b responsive elements in the WAF1/Cip1/p21 promoter. J Biol Chem 1995;270:28623±8. [89] Li J-M, Nichols MA, Chandrasekharan S, Xiong Y, Wang XF. Transforming growth factor b activates the promoter of cyclin-dependent kinase inhibitor p15INK4B through an Sp1 consensus site. J Biol Chem 1995;270:26750±3. [90] Moustakas A, Kardassis D. Regulation of the human p21/ WAF1/Cip1 promoter in hepatic cells by functional interactions between Sp1 and Smad family members. Proc Natl Acad Sci USA 1998;95:6733±8. [91] Zhou S, Buckhaults P, Zawel L, Bunz F, Riggins G, Dai JL, Kern SE, Kinzler KW, Vogelstein B. Targeted deletion of Smad4 shows it is required for transforming growth factor b and activin signaling in colorectal cancer cells. Proc Natl Acad Sci USA 1998;95:2412±6. [92] Dai JL, Schutte M, Bansal RK, Wilentz RE, Sugar AY, Kern SE. Transforming growth factor-b responsiveness in DPC4/ SMAD4-null cancer cells. Mol Carcinog 1999;26:37±43. [93] Kulkarni AB, Huh CG, Becker D, Geiser A, Lyght M, Flanders KC, Roberts AB, Sporn MB, Ward JM, Karlsson S.

48

[94]

[95] [96]

[97]

[98] [99] [100]

[101]

[102]

M. Datto, X.-F. Wang / Cytokine & Growth Factor Reviews 11 (2000) 37±48 Transforming growth factor b1 null mutation in mice causes excessive in¯ammatory response and early death. Proc Natl Acad Sci USA 1993;90:770±4. Shull MM, Ormsby I, Kier AB, Pawlowski S, Diebold RJ, Yin M, Allen R, Sidman C, Proetzel G, Calvin D. Targeted disruption of the mouse transforming growth factor-b 1 gene results in multifocal in¯ammatory disease. Nature 1992;359:693±9. Kulkarni AB, Karlsson S. In¯ammation and TGF-b1: lessons from the TGF-b1 null mouse. Res Immunol 1997;148:453±6. Li YC, Pirro AE, Amling M, Delling G, Baron R, Bronson R, Demay MB. Targeted ablation of the vitamin D receptor: an animal model of vitamin D-dependent rickets type II with alopecia. Proc Natl Acad Sci USA 1997;94:9831±5. Yoshizawa T, Handa Y, Uematsu Y, Takeda S, Sekine K, Yoshihara Y, Kawakami T, Arioka K, Sato H, Uchiyama Y, Masushige S, Fukamizu A, Matsumoto T, Kato S. Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nat Genet 1997;16:391±6. Noda M, Camilliere JJ. In vivo stimulation of bone formation by transforming growth factor-b. Endocrinology 1989;124:2991±4. Marcelli C, Yates AJ, Munday GR. In vivo e€ects of human recombinant transforming growth factor b on bone turnover in normal mice. J Bone Min Res 1990;5:1087±96. Robey PG, Young MF, Flanders KC, Roche NS, Kondaiah P, Reddi AH, Termine JD, Sporn MB, Roberts AB. Osteoblasts synthesize and respond to transforming growth factor-type b (TGF-b) in Vitro. J Cell Biol 1987;105:457±63. Centrella M, McCarthy TL, Canalis E. Transforming growth factor b is a bifunctional regulator of replication and collagen synthesis in osteoblast-enriched cell cultures from fetal rat bone. J Biol Chem 1987;262:2869±74. Pfeilschifter J, Wolf O, Naumann A, Minne HW, Mundy GR,

[103]

[104]

[105]

[106] [107]

[108]

[109] [110]

Ziegler R. Chemotactic Response of osteoblastlike cells to transforming growth factor-b. J Bone and Mineral Res 1990;5:825±9. Takai H, Kanematsu M, Yano K, Tsuda E, Higashio K, Ikeda K, Watanabe K, Yamada Y. Transforming growth factor-b stimulates the production of osteoprotegerin/osteoclastogenesis inhibitory factor by bone marrow stromal cells. J Biol Chem 1998;273:27091±6. Breen EC, Ignotz RA, McCabe L, Stein JL, Stein GS, Lian JB. TGF-b alters growth and di€erentiation related gene expression in proliferating osteoblasts in vitro, preventing development of the mature bone phenotype. J Cell Phys 1994;160:323±35. Serra R, Johnson M, Filvaro€ EH, LaBorde J, Sheehan DM, Derynck R, Moses HL. Expression of truncated, kinase-defective TGF-b type II receptor in mouse skeletal tissue promotes terminal chondrocyte di€erentiation and osteroarthritis. J Cell Biol 1997;139:541±52. Riggins GJ, Kinzler KW, Vogelstein B, Thiagalingam S. Frequency of Smad gene mutations in human cancers. Cancer Res 1997;57:2578±80. Howe JR, Roth S, Ringold JC, Summers RW, Jarvinen HJ, Sistonen P, Tomlinson IP, Houlston RS, Bevan S, Mitros FA, Stone EM, Aaltonen LA. Mutations in the SMAD4/DPC4 gene in juvenile polyposis. Science 1998;280:1086±8. Takaku K, Oshima M, Miyoshi H, Matsui M, Seldin MF, Taketo MM. Intestinal tumorigenesis in compound mutant mice of both Dpc4 [Smad4] and Apc genes. Cell 1998;92:645± 56. Pennisi E. How a growth control path takes a wrong turn to cancer. Science 1998;281:1438±9. Oshima M, Oshima H, Kitagawa K, Kobayashi M, Itakura C, Taketo M. Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice carrying a truncated Apc gene. Proc Natl Acad Sci USA 1997;92:4482±6.