The Structure and Complete Nucleotide Sequence of the Human Cyclophilin 40 (PPID) Gene

GENOMICS

35, 448–455 (1996) 0384

ARTICLE NO.

The Structure and Complete Nucleotide Sequence of the Human Cyclophilin 40 (PPID) Gene HARUHIKO YOKOI,*,† YUKIKO SHIMIZU,* HIDEHARU ANAZAWA,* CHARLES A. LEFEBVRE,† ROBERT G. KORNELUK,† AND JOH-E IKEDA†,‡,1 *Tokyo Research Laboratories, Kyowa Hakko Kogyo, Machida, Tokyo, 194, Japan; †Ikeda Genosphere Project, ERATO, JRDC, University of Ottawa Faculty of Medicine, Ottawa, Ontario, K1H 8M5, Canada; and ‡Tokai University School of Medicine, Isehara, Kanagawa, 259-11, Japan Received November 13, 1995; accepted May 7, 1996

Cyclophilin 40 is a recently identified member of the cyclophilin family that is found in an unactivated steroid hormone receptor complex. Cyclophilin 40 possesses a region homologous to FKBP59, a member of the FK506-binding protein family that is also a component of the receptor complex. We report the isolation and sequencing of the entire human cyclophilin 40 (hCyP40) gene (human gene symbol PPID). The gene contains 10 exons (43 to 698 bp) and 9 introns encompassing 14.2 kb. The exon organization of the cyclophilin-like region is not similar to that of the human cyclophilin A gene (PPIA), suggesting their early divergence in evolution. Determination of the sequence of the 5* end of the hCyP40 mRNA by an ‘‘anchor-ligation PCR’’ procedure showed that transcription is initiated from a cluster of sites about 80 bp upstream from the first in-frame ATG. The immediate 5*-flanking region of the gene lacks typical TATA and CAAT boxes, but is GC-rich and contains Sp1 sites, features characteristic of promoters associated with housekeeping genes. The hCyP40 gene was mapped to chromosome 4 by PCR with genomic DNA from somatic cell hybrids. As shown by ‘‘Zoo blot’’ analysis, the cyclophilin 40 gene appears to be highly conserved throughout evolution. q 1996 Academic Press, Inc.

INTRODUCTION

The cyclophilins (CyPs) are a highly conserved family of proteins that bind the immunosuppressant cyclosporin A (CsA) (Walsh et al., 1992; Quesniaux, 1993; Kunz and Hall, 1993). The first identified cyclophilin was CyPA, an abundant 18-kDa protein located in cytoplasm and ubiquitously expressed (Handschumacher et al., 1984). Later, CyPA was shown to be identical to one class of peptidyl prolyl cis– Sequence data from this article have been deposited with the DDBJ/GenBank/EMBL Data Libraries under Accession No. D63861. 1 To whom correspondence should be addressed. Telephone: /81(463) 93-1121 ext. 2566. Fax: /81-(463) 91-4993.

0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.

AID

Genom 4212

/

6r1b$$$101

trans isomerase (PPIase) that catalyzes the cis–trans isomerization of a peptide bond between proline and its N-terminal neighbor (Takahashi et al., 1989; Fischer et al., 1989). Five other members have been identified from mammalian sources so far: CyPB, a 22-kDa protein with an endoplasmic reticulum (ER) signal sequence (Price et al., 1991; Caroni et al., 1991); CyPC, a 23-kDa protein also with an ER signal sequence and predominantly expressed in kidney (Friedman and Weissman, 1991); CyP-3, a 22-kDa protein with a putative mitochondrial signal sequence (Bergsma et al., 1991); a 150-kDa protein of natural killer cell that is responsible for the recognition of tumors (Anderson et al., 1993); and CyP40, a 40-kDa cyclophilin-like protein with a lower affinity to CsA (Kieffer et al., 1992). Notably, all of the members of the cyclophilin family have PPIase activity. Based on amount and location, CyPA is considered to play a major role in immunosuppression by CsA. FK506 is another representative immunosuppressant drug whose mechanism of action is similar to CsA. These drugs inhibit T cell activation at a common step in the activation pathway between T cell receptor stimulation and cytokine gene transcription. The FKBP (FK506-binding protein) family members are specific binding proteins for FK506. To date, four distinct classes of FKBP are reported in human: FKBP12, FKBP13, FKBP25, and FKBP59. Among them, FKBP12 is considered to be mainly responsible for immunosuppressive effects. Although structurally unrelated to CyPs, FKBPs also possess PPIase activity (Siekierka et al., 1989) and are highly conserved throughout evolution (Trandinh et al., 1992). Based on their apparent physiological role, CyPs and FKBPs have been termed ‘‘immunophilins.’’ The PPIase activity of immunophilins can be specifically inhibited by cognate immunosuppressants, although this inhibition does not correlate with immunosuppressive activity. Rather, immunosuppression appears to be dependent upon the formation of complexes between the drugs and the respective immunophilins

448

06-27-96 22:35:35

gnma

AP: Genomics

HUMAN CyP40 GENE (PPID) STRUCTURE

(CyPA or FKBP12). The complexes were demonstrated to inhibit specifically calcineurin, a serine-threonine protein phosphatase involved in the signal transduction of the T cell activation pathway by the regulation of NF-AT, a transcription factor of the IL-2 gene (Liu et al., 1991). Although the roles of CyPA and FKBP12 in immunosuppression are well characterized, the physiological functions of these and the other members of the families are yet to be elucidated. Their PPIase activity suggests that they may have a potential role in protein folding. Studies concerning the characterization of ninaA, a mutant of a cyclophilin homologue of Drosophila, support this putative function. Mutations in the ninaA gene cause a dramatic reduction in rhodopsin levels, leading to a visual defect. The basis of this reduction is that rhodopsin is a specific substrate for NinaA and that rhodopsin synthesis, folding, transport, and/or activity is dependent upon this integral membrane protein (Stamnes et al., 1991). NinaA and other cyclophilin-like proteins are highly conserved in most species from bacteria to mammals and, as such, must play an important role in fundamental biological processes. Furthermore, the characterization of the physiological role of CyPs and FKBPs would help to elucidate the toxic effects of immunosuppressive drugs such as CsA and FK506. The 59-kDa protein FKBP59 is a component of the unactivated steroid (glucocorticoid) receptor complex (Yem et al., 1992; Lebeau et al., 1992; Tai et al., 1992). In addition to possessing three FKBP-like domains, FKBP59 contains a putative calmodulin binding site at the C-terminal (Callebaut et al., 1992). The glucocorticoid receptor complex typically includes the steroid receptor, heat shock proteins hsp90 and hsp70, FKBP59, and several other factors. These steroid receptor-associated proteins have been suggested to have a functional role in hormone binding or hormone-mediated structural alterations of the receptor resulting in a conformation change optimal for the activation of transcription. Consistent with this model are the observations that mutations in hsp90 abolish the response to hormones (Bohen and Yamamoto, 1993) and that FK506 potentiates hormone receptor-mediated gene expression (Ning and Sa´nchez, 1993). A new class of cyclophilin, CyP40, was recently cloned from bovine (Ratajczak et al., 1993) and human (Kieffer et al., 1993) cDNA libraries. In bovine uterus, CyP40 is a component of the unactivated estrogen receptor complex (Ratajczak et al., 1993). Analysis of the putative amino acid sequence showed that the N-half of the protein is similar to cyclophilins while the Chalf has striking homology to the C-terminal portion of FKBP59 in that it contains a tetratricopeptide repeat domain (Sikorski et al., 1990) and a calmodulin binding site. Based on these observations, the function of CyP40 may be similar or related to that of FKBP59. In this report, we describe cloning, sequencing, and analysis of the entire human CyP40 gene (PPID) in-

AID

Genom 4212

/

6r1b$$$102

06-27-96 22:35:35

449

cluding its promoter region. This characterization forms the basis of future genetic studies that may help to reveal the physiological role(s) of this interesting member of the immunophilin family. MATERIALS AND METHODS

Cloning cDNA. In the course of the analysis of cDNA clones from human X chromosome (Yokoi et al., 1994), a cyclophilin-like sequence was identified in a chimeric clone generated by co-insertion with a cDNA sequence from Xq. Using this sequence (B8.3au; 280 bp) as a probe, a full-length (1.8 kb) cDNA clone designated pC9A was isolated from the human fetal brain cDNA library (SC936206, Stratagene, La Jolla, CA). This cDNA was sequenced, and an open reading frame (ORF) of 370 amino acids (41 kDa) was identified. Later, the same amino acid sequence was reported by Kieffer et al. (1993) as cyclophilin 40. The nucleotide sequence was almost the same as that of our clone except that their clone lacked an Alu-like sequence in the 3*noncoding region and the first 20 nucleotides in the 5*-noncoding region. Genomic sequence. The genomic library (Stratagene 946205) in the lFixII vector derived from human male placenta DNA (Sau3A partial digest; 2.0 1 106 primary plaques) was screened using a 32Plabeled PstI–ScaI fragment of pC9A corresponding to the first 1.3 kb of the cDNA. After two rounds of screening from 6 1 105 plaques, three independent positive clones (G3, G14-1, G14-2) were isolated. DNA was prepared from plate lysates using the Qiagen lambda kit (Qiagen, Chatsworth, CA). The 5*-end fragment of the cDNA (PstI– XhoI fragment of pC9A; 135 bp) hybridized to DNA of G3 and G142, suggesting that these clones contain the 5* upstream region of the gene. The PCR analysis using primers CYP1325F (5*-TAGGAGTACTGATAGGGGTTCA-3*) and CYP1759R (5*-CAAGTTTAAAAAGACTGGACACC-3*), both of which are derived from the 3 *-noncoding region of the hCyP40 cDNA, suggested that G3 and G14-1 include the 3* terminus of the gene.

Subcloning and Sequencing of the Entire hCyP40 Gene and its 5*-Flanking Region G3 DNA was digested with SacI, and five SacI fragments derived from the insert (5.1, 4.0, 4.0, 2.3, 0.5 kb) were recovered from the agarose gel, purified with the GeneClean II kit (BIO 101, La Jolla, CA), and ligated with SacI-digested pBluescript II SK(0) (Stratagene). G14-2 DNA was digested with XhoI and SspI, and a 1.8-kb fragment hybridizing to the 5* end portion of the cDNA was recovered, purified, and ligated with XhoI- and EcoRV-digested pBluescript II SK(0). These ligation mixtures were used to transform Escherichia coli strain XL1Blue. Plasmid DNA was prepared from white and ampicillin-resistant transformants according to Applied Biosystems’ instructions (Foster City, CA). The inserts of these subcloned plasmids were sequenced in both orientations with the ABI 373A autosequencer (Applied Biosystems) mainly by the transposon gdbased method (Strathmann et al., 1991) with some modifications for cycle sequencing (Yokoi et al., 1994). The sequence of gap portions between transposons was determined by primer walking. For the confirmation of the sequence around the SacI sites, 10- and 3.2-kb SmaI fragments of G3 were subcloned into pBluescript II SK(0) and sequenced by primer walking. Alignment to the cDNA sequence was performed, and DNA sequence motifs were surveyed using programs from Genetyx-Mac software (Software Development, Japan). For the search of Alu repeats, the genomic sequence was aligned to the Alu consensus sequence (Kariya et al., 1987).

5*RACE PCR The hCyP40 mRNA 5* end was cloned using two commercially available kits (SuperScript preamplification system for first strand

gnma

AP: Genomics

450

YOKOI ET AL.

cDNA synthesis; Gibco BRL, Gaithersburg, MD, and 5*-AmpliFINDER RACE kit; Clontech, Palo Alto, CA). The RACE (rapid amplification of cDNA ends) procedure was basically according to the manufacturer’s instructions. Briefly, the oligonucleotide 5*-GGAAATCTGGATGACTGTCG-3* (Primer 1) corresponding to the reverse complement sequence of nt 597–616 with respect to the ATG was used as a primer to synthesize first-strand cDNA from 12 mg of human brain total RNA (Clontech) using the SuperScript kit. After hydrolysis of the RNA with RNase H and purification of the cDNA with the GeneClean II kit, a 3*-modified anchor primer (5* P-CACGAATTCACTATCGATTCTGGAACCTTCAGAGG-NH3-3*) was ligated to the cDNA by T4 RNA ligase in the AmpliFINDER kit. Onehundredth of the resulting cDNA products was amplified by PCR using 0.4 mM each of the anchor primer (5*-CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG-3*) and a nested primer (5*CCGATCATGCTTGTAATGGA (Primer 2) corresponding to the reverse complement sequence of nt 323–342 with respect to the ATG. PCR was performed in a Perkin–Elmer Cetus 480 thermal cycler (Norwalk, CT) with the parameters consisting of 947C for 45 s, 557C for 1 min, and 727C for 1 min for 40 cycles. Analysis by agarose gel electrophoresis showed an apparently single amplified product of about 500 bp. The amplified product was isolated from the gel, and one-thousandth of the product was further amplified as above for 20 cycles. The amplified product was digested with EcoRI (digesting anchor primer) and EcoRV (digesting cDNA at nt 117) or EcoRI and XhoI (digesting cDNA at nt 49) and cloned into pBluescript II SK(0) vector. The 5* end of the mRNA was determined by sequencing the insert with the REV primer. For the control, the 5* end of the human transferrin receptor mRNA was determined with the same RNA and the same protocol as above using control primers of the AmpliFINDER kit.

Southern Blot Analysis for Evolutionary Conservation A cDNA fragment corresponding to nucleotides 081 to 575 with respect to the ATG was generated by PCR and digestion with SspI. The fragment was labeled with [a-32P]dCTP by random priming (Feinberg and Vogelstein, 1983) and hybridized to Evo-genetic Model Blot (BIOS, New Haven, CT) membranes containing EcoRI- or HindIII-digested DNA from bacteria (E. coli), yeast (Saccharomyces cerevisiae), nematode (Caenorhabditis elegans), fruit fly (Drosophila melanogaster), frog (Xenopus laevis), lobster (Homarus americanus), chicken (Gallus domesticus), fish (Tautoga onitis), mussel (Mytilus edulis), mouse (Mus musculus), and human (Homo sapiens). The amount of DNA used was 8 mg for all the animals in both blots except for bacteria (1.8 mg), yeast (5.5 mg), nematode (2.0 mg), and fruit fly (4.9 mg) in the HindIII-digested blot. Hybridization was performed by the method of Nguyen et al. (1988) at 657C for 18 h. The final wash was performed with 11 SSC, 0.25% SDS at 657C for 30 min. Autoradiograms were analyzed with a Bio-image analyzer (BAS 2000, Fuji Film, Japan).

Chromosome Localization of the hCyP40 Gene A set of 3*-untranslated region oligonucleotide primers 1325F (5*TAGGAGTACTGATAGGGGTTCA-3*, corresponding to nt 1241– 1262 with respect to the ATG) and 1759R (5*-CAAGTTTAAAAAGACTGGACACC-3*, corresponding to the reverse complement sequence of nt 1653–1675) were used for the PCR of genomic DNA derived from somatic cell hybrids (PCRable DNA for chromosome localization; BIOS). The PCR mixture contained 40 ng template DNA, 400 nM each primer, 1 unit of Taq polymerase, 50 mM KCl, 10 mM Tris (pH 8.3), 1.5 mM MgCl2 , 0.01% gelatin, and 200 mM each dNTP in a final volume of 40 ml. The samples were covered with an equal volume of mineral oil, and the PCR was performed in a Perkin–Elmer Cetus 480 thermal cycler. Cycling conditions were 210 s at 957C followed by 40 cycles consisting of 90 s at 957C, 60 s at 607C, and 60 s at 727C. Ten-microliter aliquots were electrophoresed in 1.5% agarose gels stained with ethidium bromide.

AID

Genom 4212

/

6r1b$$$102

06-27-96 22:35:35

RESULTS

Cloning of the hCyP40 Gene (PPID) A cDNA fragment displaying striking homology to known cyclophilins was identified in the course of the analysis of clones from a human fetal brain cDNA library. A full-length cDNA of 1838 nucleotides that we designated pC9A was obtained from the same cDNA library using the fragment as a probe. Later, Kieffer et al. reported cloning of a cDNA for the human homologue of 40-kDa bovine cyclophilin (CyP40; Kieffer et al., 1993) based on the partial peptide sequence of the protein (Kieffer et al., 1992). The sequence of their clone was identical to that of our clone except that their clone lacked an Alu-like sequence that occurred in the 3*noncoding region and the first 20 nucleotides in the 5*noncoding region. The cDNA for the human homologue of CyP40 contained an open reading frame of 370 amino acids. The NH2 terminus of the deduced protein was found to be similar to cyclophilins from various organisms, while the COOH portion was highly homologous to FKBP59, a member of the FKBP family and a component of the untransformed steroid hormone receptor complex (Yem et al., 1992; Lebeau et al., 1992; Tai et al., 1992). Genomic Southern blot was performed using a cDNA fragment within the ORF region as a probe. This analysis indicated a single copy of the gene in human (data not shown). A genomic library from human placenta DNA was screened using a portion of the cDNA as a probe for the hCyP40 gene under high-stringency conditions. Three independent positive clones (G3, G14-1, G14-2) were isolated after two rounds of screening from 6 1 105 plaques. Hybridization analysis using the 5* end fragment of the cDNA suggested that G3 and G142 contain the 5* upstream region of the gene, while a PCR analysis with primers both derived from the 3*noncoding region suggested that G3 and G14-1 contained the 3* terminus of the gene (data not shown). Therefore, G3 may contain the whole sequence of the hCyP40 gene while G14-1 or G14-2 lacks the 5* or the 3* end, respectively. Restriction patterns of the clones (Fig. 1) indicated that G3 and G14-2 contained about 0.5 and 10 kb, respectively, of sequence upstream from the 5* terminus of the hCyP40 cDNA. Sequence of the hCyP40 Gene To obtain the sequence of the hCyP40 gene, the region spanning about 17 kb containing the whole gene and about 1.8 kb of its 5*-flanking region was subcloned from G3 and G14-2. Nucleotide sequence of the subclones was determined in both orientations mainly by the transposon gd-based method (Strathmann et al., 1991) with some modifications for cycle sequencing (Yokoi et al., 1994). Alignment to the cDNA sequence revealed that the hCyP40 gene was composed of 10 exons contained within

gnma

AP: Genomics

451

HUMAN CyP40 GENE (PPID) STRUCTURE

FIG. 1. Restriction map and structural organization of the human CyP40 gene (PPID). A map of 17 kb including the whole human CyP40 gene is shown. The direction of transcription is from left to right. Exons are shown by open boxes with Roman numerals. A hatched region in the cDNA represents a coding region. ‘‘PrEv’’ denotes the probe used in Southern blot for evolutionary conservation (See Fig. 4). Alu repeat elements are shown by shaded arrowheads indicating orientations. A (GT)21 repeat is indicated by a hatched box. Locations of the three genomic clones (G14-2, G3, G14-1) are also shown.

14.2 kb. The exons ranged from 43 to 698 bp and were flanked by splice junctions that conform to the GT/AG rule (Table 1). The exon organization of the cyclophilinlike region of the hCyP40 gene was compared with that of the human cyclophilin A (CyPA) gene (Haendler and Hofer, 1990). The organizations were not similar to each other (Fig. 2). Although hCyP40 contained a 3-unit tetratricopeptide repeat domain (Sikorski et al., 1990) in the C-terminal region (Ratajczak et al., 1993), the exon organization did not correspond to the periodicity of the repeat unit (data not shown). A total of 10 Alu-repetitive sequences were identified, of which 9 were within the gene (Fig. 1). Eight repeats (Alus 1–3, 5, 7–10) were found to be complete, while the rest (Alus 4, 6) were incomplete. Four Alu sequences had a positive orientation (Alus 2, 4, 5, 9) and

six (Alus 1, 3, 6, 7, 8, 10) possessed a negative orientation, as shown in Fig. 1. In addition, a 21-unit GT repeat was identified in the 5* upstream region (positions 849–890; Fig. 3). This GT repeat may be useful as a polymorphic marker of the gene. The complete sequence of 17,133 nucleotides has been deposited with DDBJ/GenBank/EMBL under Accession No. D63861. Characterization of the Promoter Region The initiation sites of the hCyP40 mRNA were mapped using human total brain RNA by the 5*-RACE PCR method (Frohman, 1990). The reverse complement sequence of nt 323–342 (with respect to the ATG) and the anchor primer were used for nested PCR. The

TABLE 1 Exon/Intron Organization of the Human CyP40 Gene Exon

Size (bp)

Position

5* splice donor

Intron

Size (bp)

3* splice acceptor

1 2 3 4 5 6 7 8 9 10

169a 143 107 189 123 107 142 87 43 698

1829a –1997 3716–3858 5910–6016 7996–8184 9511–9633 9792–9898 11934–12075 14346–14432 14524–14566 15368–16065

GCGAG/gtgagc TCGAA/gtatgt ACAAG/gtaaag CTAAA/gtaagt AAGAT/gtgagt TTAAG/gtaata TAGAG/gtaagt CATTG/gtaaat TAAAG/gtaagt

1 2 3 4 5 6 7 8 9

1718 2051 1979 1326 158 2035 2270 91 801

cttttcttttag/TTGGT ccttttttgtag/TTATT ttatttctacag/CATGA ttatttttacag/TTGTG ttttttatacag/GTAGA tgcattctgcag/ATACG acttttttgtag/GCTCT ttccaattaaag/GCTGA tttatttttcag/CTATC

Note. Intron and exon sequences are shown in lowercase and uppercase, respectively. a The transcription initiation site is postulated to be at the 5* end of the cDNA clone pC9A.

AID

Genom 4212

/

6r1b$$$103

06-27-96 22:35:35

gnma

AP: Genomics

452

YOKOI ET AL.

corresponding to the cyclophilin-like region was used as a hybridization probe. Southern blots containing EcoRI- or HindIII-digested genomic DNA from various organisms including human, mouse, chicken, frog, fish, lobster, mussel, fruit fly, nematode, yeast, and bacteria (Evo-genetic Model Blot; BIOS) were probed and washed under relatively low-stringency conditions (Fig. 4). The hCyP40 fragment hybridized to only one sequence in human DNA, indicating that these conditions did not allow for the detection of the other members of the cyclophilin family. Homologous sequences, however, were observed in DNA of vertebrates, lobster, and mussel, suggesting that the gene is highly conserved throughout evolution. Although the human genome has a single copy, the mouse genome appears to have a multiple number of genes or pseudogenes quite similar to hCyP40. Mapping the hCyP40 Gene on Chromosome 4

FIG. 2. Comparison of the exon organizations. Alignment of the amino acid sequences of the human CyP40 and human CyPA is shown. Asterisks denote identical amino acids, while dots represent a conserved change between the two cyclophilins. The arrows in the sequence alignment indicate intron positions. Underlines indicate ahelix (solid line), b-strand (double solid line), or b-turn (dotted line) structure of human CyPA (Ke et al., 1991).

amplified PCR product, giving apparently a single band of about 500 bp in agarose gel electrophoresis, was cloned into pBluescript II SK(0), and the 5* end of the mRNA was determined by sequencing the inserts. Twenty-five clones were sequenced. Although several initiation sites were identified, they tended to cluster around the start nucleotide of the cDNA clone pC9A (Fig. 3). A control experiment was performed for the human transferrin receptor gene using the same RNA. It showed a 5* end identical to that previously reported (Owen and Ku¨hn, 1987) in all eight clones tested (data not shown), suggesting that the RNA was not degraded. The nucleotide sequence of 1.8 kb of the proximal 5*flanking region, exon 1, and a part of intron 1 is shown in Fig. 3. A computer search of the sequence revealed a GC-rich region around the transcription initiation sites (GC content of 66% in the 240 bp 5* to the initiation codon). No clear TATA or CAAT box motifs were found in this region, while four GC boxes, known as binding sites for transcription factor Sp1 (Briggs et al., 1986), were present around the initiation sites (one 5* upstream, two in the 5*-noncoding region, and one in intron 1). Such a structure is typical of housekeeping genes (Bird, 1986). In addition several putative control elements were present in the 5* upstream region (Ap1, E-box, EF1A) or the first intron (NF-kB, heat shock element (HSE), NF-mE3) (Fig. 3). hCyP40 Sequence Is Highly Conserved To determine the extent of evolutionary conservation of the hCyP40 gene, a portion of the cDNA sequence

AID

Genom 4212

/

6r1b$$$103

06-27-96 22:35:35

The chromosomal location of the gene was identified by PCR using DNA from human–rodent somatic cell hybrid cells as template. PCR was performed using primers from the 3*-noncoding sequence of the cDNA. Amplification of the fragment with the target size (435 bp) was observed only with DNA from two cell lines containing human chromosomes 4, 5, 8, 11, 22, and X (cell line 803) or chromosomes 4, 5, 7, 8, 13, 15, 19, and 21 (cell line 1006). As chromosome 4 was contained only in these two cell lines while chromosomes 5 and 8 were also contained in the other cell lines, the hCyP40 gene was mapped conclusively to human chromosome 4 (data not shown). DISCUSSION

We report here the detailed characterization of the human CyP40 gene (PPID). This gene is composed of 10 exons and 9 introns within an overall length of 14.2 kb (Fig. 1). All the exon/intron splice junctions follow the GT/AG rule (Table 1). This is the second gene of the mammalian cyclophilin family after the human CyPA whose structure has been analyzed (Haendler and Hofer, 1990). Although the amino acid sequence of the N-half (cyclophilin-like) of the CyP40 gene is highly homologous to that of the CyPA gene, the overall exon organization is not similar (Fig. 2). Furthermore, the ‘‘Zoo Blot’’ result (Fig. 4) shows that the nucleotide sequence homologous with the human CyP40 gene is detected even in nonvertebrates under conditions that do not allow the detection of the sequence of other cyclophilin members. Therefore, these data suggest that the divergence of CyP40 and CyPA arose prior to the occurrence of introns, although the sequence is still highly conserved throughout evolution. This model is consistent with the following recent observations: (1) CyP40 (and the 150-kDa protein of natural killer cell) is distinct from the other members of the family in that it possesses eight amino acid inserts, five amino acids of

gnma

AP: Genomics

HUMAN CyP40 GENE (PPID) STRUCTURE

453

FIG. 3. Nucleotide sequence of the promoter-proximal region of the human CyP40 gene (PPID). Sequence with a solid underline (1829– 1997) matches the 5* terminus part of pC9A (1–169), indicating the first exon. The deduced amino acid sequence is shown below. The GT and Alu repeats are marked with dotted underlines. Binding sites for representative transcription factors, Ap1, E-box, Sp1, EF1A, NF-kB, and NF-mE3, are boxed. The heat shock element (HSE) is underlined. Sequences on solid lines represent the core sequence. Arrows denote the 5* end nucleotides of 5*-RACE products. Numbers above the arrows indicate the number of clones. The sequence has been deposited with the DDBJ/GenBank/EMBL Data Libraries under Accession No. D63861.

which, GKPLH, are conserved in plant CyPs but not in any other CyPs. Furthermore, inhibition of the PPIase activity of CyP40 by CsA is much weaker than that of the other members because of the lack of a Trp at position 141, corresponding to position 120 in CyPA, that has been found to be important for CsA sensitivity (Kieffer et al., 1993). (2) Computer analysis of the amino acid sequence of the cyclophilins from various classes and various species suggested that isozymic forms of the family existed before the emergence of eukaryotes (Trandinh et al., 1992). (3) There may exist a yeast homologue of CyP40 because yeast has a hsp90binding protein of 45 kDa whose partial amino acid sequence had homology to cyclophilins (Chang and Lindquist, 1994). Furthermore, a monoclonal antibody directed against a non-cyclophilin-like portion of hCyP40 cross-reacts to a 45-kDa protein from yeast (Yokoi et al., unpublished results). Recently, Pratt has hypothesized that heterocom-

AID

Genom 4212

/

6r1b$$$103

06-27-96 22:35:35

plexes between hsp90 and its associated proteins such as hsp70, p23 (Johnson et al., 1994), p60 (Honore´ et al., 1992), FKBP59, or CyP40 arose early in evolution (before the emergence of steroid hormones). These complexes function as ‘‘transportsomes,’’ which help many proteins fold properly and undergo trafficking through the cytoplasm (Pratt, 1993). Significantly, hsp90 and hsp70 are known to be highly conserved proteins found from prokaryotes to eukaryotes, and p60, p23, and FKBP59 have recently been suggested to have corresponding homologues in yeast (Smith et al., 1993; Johnson et al., 1994; Tai et al., 1993). Cloning and comparison of CyP40 homologues from other organisms (yeast, for example) may facilitate understanding of the evolutionary conservation and eventually the function of the gene and its protein product. Sequencing of the promoter region indicated that the immediate 5*-flanking region of the hCyP40 gene lacks a TATA or a CAAT box, but is rich in GC bases and

gnma

AP: Genomics

454

YOKOI ET AL.

associating with steroid receptors, has been shown to play a vital role in keeping the receptors hormone-responsive (Kimura et al., 1995). Thus it is possible that CyP40 also has a function in signal transduction of steroid hormones, and hence mutations of the gene may cause dysfunction of the signaling system and, in some circumstances, may eventually lead to cancer. The sequence and mapping data we present here will be useful for the investigation of such a possibility through genetic studies. FIG. 4. Southern blot analysis for evolutionary conservation. A cDNA fragment corresponding to nucleotides 4–659 of pC9A was labeled with [a-32P]dCTP and hybridized to Evo-genetic Model Blot (BIOS) membranes containing EcoRI (left)- or HindIII (right)-digested DNAs from Escherichia coli (bacteria; lane 1), Saccharomyces cerevisiae (yeast; lane 2), Caenorhabditis elegans (nematode; lane 3), Drosophila melanogaster (fruit fly; lane 4), Xenopus laevis (frog; lane 5), Homarus americanus (lobster; lane 6), Gallus domesticus (chicken; lane 7), Tautoga onitis (fish; lane 8), Mytilus edulis (mussel; lane 9), Mus musculus (mouse; lane 10), and Homo sapiens (human; lane 11). The final wash was performed with 11 SSC, 0.25% SDS at 657C for 30 min.

contains several Sp1 sites (Fig. 3). Such structure is characteristic in housekeeping genes and is consistent with the ubiquitous expression of CyP40 in human tissues shown by Western blot (Kieffer et al., 1992) or Northern blot analysis (Kieffer et al., 1993). This type of promoter often displays multiple start sites, as found in the case of the hCyP40 gene. Potential cis-acting regulatory elements in the 5*flanking region of the CyP40 gene were found. A number of regulatory aspects involved in the expression of immunophilins and components of steroid hormone receptor complexes are known. These include the heat induction of some cyclophilins or FKBPs in yeast (Sykes et al., 1993; Partaledis and Berlin, 1993) as well as in human FKBP59 and p60 (Honore´ et al., 1992), both of which have domains homologous with CyP40. Induction in the expression of the immunophilins also occurred in the response to accumulation of unfolded proteins of yeast FKBP13 (Partaledis and Berlin, 1993) or in the response to transformation by SV40 of human p60 (Honore´ et al., 1992). CyP40 may also be heatinducible, since a HSE is present in the first intron at positions 2204 to 2223 (Fig. 3). In addition, an Ap1 site is in the 5* upstream region, and two closely spaced NF-kB binding sites are in the first intron. Because the glucocorticoid receptor interacts and antagonizes the subunit of Ap1 (Jun) or NF-kB (p65) (Ray and Prefontaine, 1994), there may be some controls on expression of the components of steroid receptor complexes by Ap1 or NF-kB. Recently, an increasing number of components of the protein folding machinery have been found to interact with signaling molecules. These proteins have been suggested to play a crucial function in signal transduction by regulating folding and assembly of signaling molecules between active and inactive states (Rutherford and Zuker, 1994). DnaJ, one of the chaperones

AID

Genom 4212

/

6r1b$$$103

06-27-96 22:35:35

ACKNOWLEDGMENTS We thank Dr. Akiko Saito, Mayumi Enoki, and Xiaolin Kang for providing the synthetic oligonucleotides and Dr. Alex MacKenzie for helpful comments and suggestions. We also thank Dr. Seiga Itoh for encouragement throughout the work.

REFERENCES Anderson, S. K., Gallinger, S., Roder, J., Frey, J., Young, H., and Ortaldo, J. (1993). A novel cyclophilin-related protein involved in the function of NK cells. Proc. Natl. Acad. Sci. USA 90: 542–546. Bergsma, D. J., Eder, C., Gross, M., Kersten, H., Sylverster, D., Appelbaum, E., Cusimano, D., Livi, G. P., McLaughlin, M. M., Kasyan, K., Porter, T. G., Silverman, C., Dunnington, D., Hand, A., Prichett, W. P., Bossard, M. J., Brandt, M., and Levy, M. A. (1991). The cyclophilin multigene family of peptidyl-prolyl isomerases: Characterization of three separate human isoforms. J. Biol. Chem. 266: 23204–23214. Bird, A. P. (1986). CpG-rich islands and the function of DNA methylation. Nature 321: 209–213. Bohen, S. P., and Yamamoto, K. R. (1993). Isolation of Hsp90 mutants by screening for decreased steroid receptor function. Proc. Natl. Acad. Sci. USA 90: 11424–11428. Briggs, M. R., Kadonaga, J. T., Bell, S. P., and Tjian, R. (1986). Purification and biochemical characterization of the promoter-specific transcription factor, Sp1. Science 234: 47–52. Callebaut, I., Renoir, J.-M., Lebeau, M.-C., Massol, N., Burny, A., Baulieu, E.-E., and Mornon, J.-P. (1992). An immunophilin that binds Mr 90,000 heat shock protein: Main structural features of a mammalian p59 protein. Proc. Natl. Acad. Sci. USA 89: 6270– 6274. Caroni, P., Rothenfluh, A., McGlynn, E., and Schneider, C. (1991). S-cyclophilin. New member of the cyclophilin family associated with the secretory pathway. J. Biol. Chem. 266: 10739–10742. Chang, H-C. J., and Lindquist, S. (1994). Conservation of hsp90 macromolecular complexes in Saccharomyces cerevisiae. J. Biol. Chem. 269: 24983–24988. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6–13. Fischer, G., Wittmann-Liebold, B., Lang, K., Kiefhaber, T., and Schmid, F. X. (1989). Cyclophilin and peptidyl-prolyl cis–trans isomerase are probably identical proteins. Nature 337: 476–478. Friedman, J., and Weissman, I. (1991). Two cytoplasmic candidates for immunophilin action are revealed by affinity to a new cyclophilin: One in the presence and one in the absence of CsA. Cell 66: 799–806. Frohman, M. A. (1990). RACE: Rapid amplification of cDNA ends. In ‘‘PCR Protocols: A Guide to Methods and Applications’’ (M. A. Innis, D. H. Gelford, J. J. Sninsky, and T. J. White, Eds.), pp. 28– 38, Academic Press, New York. Haendler, B., and Hofer, E. (1990). Characterization of the human

gnma

AP: Genomics

HUMAN CyP40 GENE (PPID) STRUCTURE cyclophilin gene and of related processes pseudogenes. Eur. J. Biochem. 190: 477–482. Handschumacher, R. E., Harding, M. W., Rice, J., Drugge, R. J., and Speicher, D. W. (1984). Cyclophilin: A specific cytosolic binding protein for cyclosporin A. Science 226: 544–546. Honore´, B., Leffers, H., Madsen, P., Rasmussen, H. H., Vandekerckhove, J., and Celis, J. E. (1992). Molecular cloning and expression of a transformation-sensitive human protein containing the TPR motif and sharing identity to the stress-inducible yeast protein STI1. J. Biol. Chem. 267: 8485–8491. Johnson, J. L., Beito, T. G., Krco, C. J., and Toft, D. O. (1994). Characterization of a novel 23-kilodalton protein of unactive progesterone receptor complexes. Mol. Cell. Biol. 14: 1956–1963. Ke, H., Zydowsky, L. D., Liu, J., and Walsh, C. T. (1991). Crystal structure of recombinant human T-cell cyclophilin A at 2.5 A resolution. Proc. Natl. Acad. Sci. USA 88: 9483–9487. Kieffer, L. J., Thalhammer, T., and Handschumacher, R. E. (1992). Isolation and characterization of a 40-kDa cyclophilin-related protein. J. Biol. Chem. 267: 5503–5507. Kieffer, L. J., Seng, T. W., Li, W., Osterman, D. G., Handschumacher, R. E., and Bayney, R. M. (1993). Cyclophilin-40, a protein with homology to the p59 component of the steroid receptor complex. J. Biol. Chem. 268: 12303–12310. Kariya, Y., Kato, K., Hayashizaki, Y., Himeno, S., Tarui, S., and Matsubara, K. (1987). Revision of consensus sequence of human Alu repeats—A review. Gene 53: 1–10. Kimura, Y., Yahara, I., and Lindquist, S. (1995). Role of the protein chaperone YDJ1 in establishing Hsp90-mediated signal transduction pathways. Science 268: 1362–1365. Kunz, J., and Hall, M. N. (1993). Cyclosporin A, FK506 and rapamycin: More than just immunosuppression. Trends Biochem. Sci. 18: 334–338. Lebeau, M.-C., Massol, N., Herrick, J., Faber, L. E., Renoir, J.-M., Radanyi, C., and Baulieu, E.-E. (1992). P59, an hsp90-binding protein. J. Biol. Chem. 267: 4281–4284. Liu, J., Farmer, J. D., Lane, W. S., Friedman, J., Weismann, I., and Schreiber, S. L. (1991). Calcineurin is a common target of cyclophilin–cyclosporin A and FKBP–FK506 complexes. Cell 66: 807–815. Nguyen, C., Mattei, M. G., Rey, J. A., Nattei, J. F., and Jordan, B. J. (1988). Cytogenetic and physical mapping in the region of the X chromosome surrounding the fragile site. Am. J. Hum. Genet. 30: 601–611. Ning, Y.-M., and Sa´nchez, E. R. (1993). Potentiation of glucocorticoid receptor-mediated gene expression by the immunophilin ligands FK506 and rapamycin. J. Biol. Chem. 268: 6073–6076. Owen, D., and Ku¨hn, L. C. (1987). Noncoding 3* sequences of the transferrin receptor gene are required for mRNA regulation by iron. EMBO J. 6: 1287–1293. Partaledis, J. A., and Berlin, V. (1993). The FKB2 gene of Saccharomyces cerevisiae, encoding the immunosuppressant-binding protein FKBP-13, is regulated in response to accumulation of unfolded proteins in the endoplasmic reticulum. Proc. Natl. Acad. Sci. USA 90: 5450–5454. Pratt, W. B. (1993). The role of heat shock proteins in regulating the function, folding, and trafficking of the glucocorticoid receptor. J. Biol. Chem. 268: 21455–21458. Price, E. R., Zydowsky, L. D., Jin, M., Baker, C. H., McKeon, F. D., and Walsh, C. T. (1991). Human cyclophilin B: A second cyclophilin gene encodes a peptidyl-prolyl isomerase with a signal sequence. Proc. Natl. Acad. Sci. USA 88: 1903–1907.

AID

Genom 4212

/

6r1b$$$104

06-27-96 22:35:35

455

Quesniaux, V. F. J. (1993). Immunosuppressants: Tools to investigate the physiological role of cytokines. BioEssays 15: 731–739. Ratajczak, T., Carrello, A., Mark, P. J., Warner, B. J., Simpson, R., Moritz, R. L., and House, A. K. (1993). The cyclophilin component of the unactivated estrogen receptor contains a tetratricopeptide repeat domain and shares identity with p59 (FKBP59). J. Biol. Chem. 268: 13187–13192. Ray, A., and Prefontaine, K. E. (1994). Physical association and functional antagonism between the p65 subunit of transcription factor NFkB and the glucocorticoid receptor. Proc. Natl. Acad. Sci. USA 91: 752–756. Rutherford, S. L., and Zuker, C. S. (1994). Protein folding and the regulation of signaling pathways. Cell 79: 1129–1132. Siekierka, J. J., Hung, S. H. Y., Poe, M., Lin, C. S., and Sigal, N. H. (1989). A cytosolic binding protein for the immunosuppressant FK506 has peptidyl-prolyl isomerase activity but is distinct from cyclophilin. Nature 341: 755–757. Sikorski, R. S., Boguski, M. S., Goebl, M., and Hieter, P. (1990). A repeating amino acid motif in CDC23 defines a family of proteins and a new relationship among genes required for mitosis and RNA synthesis. Cell 60: 307–317. Smith, D. F., Sullivan, W. P., Marion, T. N., Zaitsu, K., Madden, B., McCormick, D. J., and Toft, D. O. (1993). Identification of a 60kilodalton stress-related protein, p60, which interacts with hsp90 and hsp70. Mol. Cell. Biol. 13: 869–876. Stamnes, M. A., Shieh, B.-H., Chuman, L., Harris, G. L., and Zuker, C. S. (1991). The cyclophilin homologue ninaA is a tissue-specific integral membrane protein required for the proper synthesis of a subset of Drosophila rhodopsins. Cell 65: 219–227. Strathmann, M., Hamilton, B. A., Mayeda, C. A., Simon, M. I., Meyerrowitz, E. M., and Palazzolo, M. J. (1991). Transposon-facilitated DNA sequencing. Proc. Natl. Acad. Sci. USA 88: 1247–1250. Sykes, K., Gething, M.-J., and Sambrook, J. (1993). Proline isomerases function during heat shock. Proc. Natl. Acad. Sci. USA 90: 5853–5857. Tai, P.-K. K., Albers, M. W., Chang, H., Faber, L. E., and Schreiber, S. L. (1992). Association of a 59-kilodalton immunophilin with the glucocorticoid receptor complex. Science 256: 1315–1318. Tai, P.-K. K., Chang, H., Albers, M. W., Schreiber, S. L., Toft, D. O., and Faber, L. E. (1993). P59 (FK506 binding protein-59) interaction with heat shock proteins is highly conserved and may involve proteins other than steroid receptors. Biochemistry 32: 8842–8847. Takahashi, N., Hayano, T., and Suzuki, M. (1989). Peptidyl-prolyl cis–trans isomerase is the cyclosporin A-binding protein cyclophilin. Nature 337: 473–475. Trandinh, C. C., Pao, G. M., and Saier, M. H., Jr. (1992). Structural and evolutionary relationships among the immunophilins: Two ubiquitous families of peptidyl-prolyl cis–trans isomerases. FASEB J. 6: 3410–3420. Walsh, C. T., Zydowsky, L. D., and McKeon, F. D. (1992). Cyclosporin A, the cyclophilin class of peptidylprolyl isomerase, and blockade of T cell signal transduction. J. Biol. Chem. 267: 13115–13118. Yem, A. W., Tomasselli, A. G., Heinrikson, R. L., Zurcher-Neely, H., Ruff, V. A., Johnson, R. A., and Deibel, M. R., Jr. (1992). The Hsp56 component of steroid receptor complexes binds to immobilized FK506 and shows homology to FKBP-12 and FKBP-13. J. Biol. Chem. 267: 2868–2871. Yokoi, H., Hadano, S., Kogi, M., Kang, X., Wakasa, K., and Ikeda, J-E. (1994). Isolation of expressed sequences encoded by the human Xq terminal portion using microclone probes generated by laser microdissection. Genomics 20: 404–411.

gnma

AP: Genomics