- Email: [email protected]
The Study of Peripheral Blood Mononuclear Cell MHC I and MHC II Gene mRNA Expression in Acute Graft Rejection
The Study of Peripheral Blood Mononuclear Cell MHC I and MHC II Gene mRNA Expression in Acute Graft Rejection X.-D. Li, X. Zou, Y. Zhang, N. Lu, F.-R. Wan, S.-M. Zhao, X.-L. Li, and H. Jiang ABSTRACT Background. Early diagnosis of acute graft rejection is important in the clinic. To explore a reliable diagnostic marker, we selected skin-grafted rabbits as an animal model to study peripheral blood mononuclear cell (PBMC) major histocompatibility complex 1 (MHC I) and MHC II gene mRNA in acute graft rejection (AGR). Methods. Fifteen New Zealand white rabbits were randomly divided into three groups to observe skin graft rejection: three rabbits were in the autograft control group; six rabbits in a cyclosporine (CsA) treated allografted group; and the other six rabbits in untreated allografted group. The CsA-treated allografted group was given CsA (5 mg/kg) daily intramuscularly. PBMC samples were obtained every 2 days to detect by real-time polymerase chain reaction, PBMC MHC I and MHC II gene mRNA. Results. MHC I and MHC II gene mRNA levels did not show any obvious change in the autografted controls. MHC I gene mRNA levels showed a slow increase in the CsA-treated allografted group, but no obvious change in the untreated allografted group. MHC II gene mRNA reached the highest level at 2 to 3 days before graft rejection appeared macroscopically in the CsA-treated allografted group and untreated allografted group, then decreasing to a low level. Conclusion. Compared with MHC I gene mRNA expression, PBMC MHC II gene mRNA expression may be considered to be an earlier marker for AGR.
T
HE IMPLANT WILL BE REJECTED no matter what type of transplantation, as long as the donor expresses proteins or molecules different from the recipient. The aim of this research was to study peripheral blood mononuclear cell (PBMC) MHC I and MHC II gene mRNA expressions in acute graft rejection (AGR). MATERIALS AND METHODS Outbred New Zealand white rabbits (Oryctolagus cuniculus, New Zealand strain) and California rabbits (Oryctolagus cuniculus, California strain) of 2.5 to 3 kg were obtained from the Experimental Animal Center. Fifteen New Zealand white rabbits were randomly divided into three study groups: three rabbits in an autograft control group, six rabbits in a cyclosporine (CsA)-treated allograft group, and another six rabbits in an untreated allograft group. Two California rabbits were used as donors of full-thickness skin grafts transplanted onto the backs of each recipient using standard techniques.1 Bandages were removed on day 3. Skin grafts were scored twice daily. Graft rejection was detected by the macroscopic appearance of graft necrosis.2 The CsA-treated allografted group was given daily intramuscular 5 mg/kg doses.
Biopsies from the allografts were processed every 2 days after the operation. The biopsies fixed in formalin solution were embedded in paraffin for cutting, 4- to 5-m sections, which were stained with hematoxylin-eosin. PBMCs were isolated from heparinized whole blood by density gradient centrifugation on a lymphocyte separation agent. Total RNA was extracted from 3 ⫻ 106 cells using TRIZOL (Invitrogen). Total RNA was briefly exposed to RNAase-free DNAase I, and 1 g reverse transcribed to cDNA using M- MLV Reverse Transcriptase (Promega). The expression of MHC I and MHC II gene mRNAs were determined using the Lighter Cycler 2.0 real-time quantitative From the Department of Clinical Laboratory (X.-D.L., X.Z., Y.Z., N.L., F.-R.W., S.-M., Z.), Qilu Hospital, Shandong University, Jinan, China; Qianfoshan Hospital of Shandong Province (X.-D.L.), Jinan, China; and Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Public Health (H.J.), Jinan, China. Address reprint requests to Zou Xiong, Department of Clinical Laboratory, Qilu Hospital, Shandong University, 107 WenHua Road, Jinan, China 250012. E-mail: [email protected]
© 2006 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
0041-1345/06/$–see front matter doi:10.1016/j.transproceed.2006.08.185
Transplantation Proceedings, 38, 3055–3057 (2006)
3055
3056
LI, ZOU, ZHANG ET AL Table 1. Comparison of MHC I mRNA Expression in Three Groups Group
Day 0
Day 2
Day 4
Day 6
Day 8
Day 10
Autografted control group CsA-treated allografted group Untreated allografted group
0.25 ⫾ 0.10 0.47 ⫾ 0.13 0.20 ⫾ 0.06
0.16 ⫾ 0.08 0.28 ⫾ 0.08 0.15 ⫾ 0.08
0.24 ⫾ 0.12 0.72 ⫾ 0.18* 0.16 ⫾ 0.06
0.15 ⫾ 0.08 0.59 ⫾ 0.14* 0.22 ⫾ 0.08
0.16 ⫾ 0.09 1.07 ⫾ 0.23** 0.25 ⫾ 0.06
0.21 ⫾ 0.10 0.42 ⫾ 0.15 0.22 ⫾ 0.06
*P ⬍ .05. **P ⬍ .01 CsA-treated allografted group versus autografted control group.
polymerase chain reaction (PCR) instrument. All PCR reagents were from the SYBR green real-time PCR kit (TaKaRa). MHC I gene primer sequence was: forward: 5= CGACTACATCGCCCTGAACG 3=; reverse: 5= CCCAGAAGGCACCACCACA 3=. The MHC II gene primer sequence was: forward: 5= CTCCGAAATGGAAACCCT 3=; reverse: 5= ATGATGCCCACCAGACCC 3=, Beta-actin was used as an internal control gene with forward sequence: 5= CGTGCGGGACATCAAGGA 3=; reverse: 5= AGGAAGGAGGGCTGGAACA 3=. The PCR was performed for 10 seconds at 95°C and 1 minute at 60°C for 40 cycles followed by the thermal denaturation protocol. The expression of MHC I and MHC II gene mRNAs compared to beta-actin mRNA was determined using the 2⫺⌬CT method.3 All results are shown as mean values ⫾ standard deviation with differences between groups examined with student t test. A P value less than .05 was considered significant; less than .01, as extremely significant.
RESULTS
Skin grew well in the autografted control group with no AGR. The times for skin allograft rejection were: CsAtreated allograft group (7.75 ⫾ 0.72) days and untreated allograft group (6.57 ⫾ 0.53) days. CsA-treated allograft group and untreated allograft group showed many lymphocytes and monocytes in the dermis with AGR. There was no obvious change in autografted control group. MHC I and MHC II gene mRNA levels did not show any obvious change in the autografted control. MHC I gene mRNA levels slowly increased in the CsA-treated allograft group, but showed no obvious change in the untreated allografted group (Table 1 and Fig 1). MHC II gene mRNA
reached the highest level 2 to 3 days before graft rejection appeared macroscopically in the CsA-treated allograft group and untreated allograft group, soon decreasing to low levels (Table 2 and Fig 2). DISCUSSION
Peripheral blood lymphocyte CD4/CD8 ratios, interleukin-2, IL-6, tumor necrosis factor (TNF) cytokines, enzymes, and proteins like C-reactive protein have been used to detect graft rejection. In addition, in renal transplantation, serum soluble CD30 level in graft recipients has also been associated with increased rejection and graft loss. But organ and tissue transplantation is so complicated that none of these methods is totally reliable as a rejection marker. Recently the MHC has attracted attention. At first, soluble MHC were studied: MHC class I and class II molecules are expressed in soluble form in the serum of both healthy and diseased individuals. Detecting serum soluble class I levels may suggest graft rejection.4 But souble MHC is unstable and easily influenced by infection. PBMC MHC is more reliable than soluble MHC. Davenport et al5 studied rat liver allografts employing flow cytometry and observed T-lymphocyte MHC II expression to increase from 3.4% ⫾ 0.44% at days 2/3 to 4.9% ⫾ 1.1% at day 7. Complete sequential data further confirmed increased MHC II expression during rejection. We used real-time reverse transcriptase PCR method to study PBMC MHC I and MHC II mRNA expression after skin grafting in rabbits. We selected skin grafts in rabbits as autografted control group CsA-treated allografted group
1.2 1 MHCImRNA expression
Fig 1. The comparison of MHC I mRNA expression in three groups post–skin graft. mRNA levers of PBMCs from CsA-treated allografted group (——), untreated allografted group (—Œ—), and autografted control group (—⽧—) were determined by real-time reverse transcriptase PCR. *P ⬍ .05 CsA-treated allografted group versus autografted control group. **P ⬍ .01 CsA-treated allografted group versus autografted control group.
untreated allografted group
**
0.8
* *
0.6 0.4 0.2 0 day0
day2
day4
day6
day8
day10
Time
MHC I AND MHC II EXPRESSION IN ACUTE REJECTION
3057
Table 2. Comparison of MHC II mRNA Expression in Three Groups Group
Day 0
Day 2
Day 4
Day 6
Day 8
Day 10
Autografted control group CsA-treated allografted group Untreated allografted group
1.49 ⫾ 0.30 1.46 ⫾ 0.33 1.78 ⫾ 0.16
1.63 ⫾ 0.28 1.86 ⫾ 0.28 1.57 ⫾ 0.08
1.23 ⫾ 0.15 4.52 ⫾ 0.58* 4.05 ⫾ 0.56*
1.26 ⫾ 0.18 2.77 ⫾ 0.24 1.78 ⫾ 0.18
1.53 ⫾ 0.28 1.88 ⫾ 0.13 2.14 ⫾ 0.26
1.39 ⫾ 0.31 1.59 ⫾ 0.18 1.63 ⫾ 0.16
*P ⬍ .01 CsA-treated allografted group or untreated allografted group versus autografted control group.
an animal model because blood samples can be drawn continuously without any obvious effect on the host. Furthermore, AGR is easily observed in the skin graft. AGR occurs in a few days through 2 weeks after the graft operation. Cellular immunity plays an important role in this process with activated CD4 and CD8 T cells. Most PBMCs are lymphocytes, and the majority, T lymphocytes. Our result showed MHC II gene mRNA expression reached its highest level at 2 to 3 days before graft rejection appeared macroscopically among the CsA-treated allograft group and the untreated allograft group. One possible explanation was that the MHC II molecule might only be expressed by professional antigen-presenting cells and activated T lymphocytes. When AGR occurred, T lymphocytes were activated; therefore, PBMCs expressed more MHC II gene mRNA; cell immunity, and humoral immunity are enhanced, resulting in greater expression of MHC II molecules. As a matter of fact, MHC class II expression is recognized as a T-lymphocyte activation marker. MHC II gene mRNA expression by PBMCs correlated with activated T lymphocytes. Real-time reverse transcriptase PCR is a rapid, hypersensitive experimental method. The above results showed that PBMC MHC II gene mRNA expression reached the highest level at 2 to 3 days before graft rejection occurred
macroscopically. It is likely that the CsA-treated allograft group was treated with low doses of CsA (5 mg/kg), so MHC II gene mRNA expression showed a trend to a slow increase but MHC II gene mRNA expression showed no obvious change in the untreated allograft group. Therefore, compared with MHC I gene mRNA expression, PBMC MHC II gene mRNA expression may be considered to be an early marker of AGR. REFERENCES 1. Wang YB, Ogawa Y, Doi H, et al: Long-term immunologic induction of donor specific tolerance to skin allografts by bone marrow transplant in rabbits. Plast Reconstr Surg 111:291, 2003 2. Rouabhia M, Germain L, Belanger F, et al: Cultured epithelium allografts: Langerhans cell and Thy-1⫹ dendritic epidermal cell depletion effects on allograft rejection. Transplantation 56:259, 1993 3. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402, 2001 4. Kerman RH, Susskind B, Buelow R, et al: Correlation of ELISA-detected IgG and IgA anti-HLA antibodies in pretransplant sera with renal allograft rejection. Transplantation 62:201, 1996 5. Davenport M, Peakman M, Dunne JB, et al: Peripheral blood and intrahepatic subsets of T lymphocyte activation and function in liver allograft rejection and drug-induced tolerance in rats. Transpl Immunol 4:126, 1996
autografted control group
5
MHC II mRAN expression
CsA-treated allografted group untreated allografted group
**
4.5 4 3.5
**
3 2.5 2 1.5 1 0.5 0
day0
day2
day4
day6
day8
day10
Time
Fig 2. The comparison of MHC II mRNA expression in three groups post–skin graft. mRNA levers of PBMC from CsA-treated allografted group (——), untreated allografted group (—Œ—), and autografted control group (—⽧—) were determined by real-time reverse transcriptase PCR. **P ⬍ .01 CsA-treated allografted group or untreated allografted group versus autografted control group.
T
HE IMPLANT WILL BE REJECTED no matter what type of transplantation, as long as the donor expresses proteins or molecules different from the recipient. The aim of this research was to study peripheral blood mononuclear cell (PBMC) MHC I and MHC II gene mRNA expressions in acute graft rejection (AGR). MATERIALS AND METHODS Outbred New Zealand white rabbits (Oryctolagus cuniculus, New Zealand strain) and California rabbits (Oryctolagus cuniculus, California strain) of 2.5 to 3 kg were obtained from the Experimental Animal Center. Fifteen New Zealand white rabbits were randomly divided into three study groups: three rabbits in an autograft control group, six rabbits in a cyclosporine (CsA)-treated allograft group, and another six rabbits in an untreated allograft group. Two California rabbits were used as donors of full-thickness skin grafts transplanted onto the backs of each recipient using standard techniques.1 Bandages were removed on day 3. Skin grafts were scored twice daily. Graft rejection was detected by the macroscopic appearance of graft necrosis.2 The CsA-treated allografted group was given daily intramuscular 5 mg/kg doses.
Biopsies from the allografts were processed every 2 days after the operation. The biopsies fixed in formalin solution were embedded in paraffin for cutting, 4- to 5-m sections, which were stained with hematoxylin-eosin. PBMCs were isolated from heparinized whole blood by density gradient centrifugation on a lymphocyte separation agent. Total RNA was extracted from 3 ⫻ 106 cells using TRIZOL (Invitrogen). Total RNA was briefly exposed to RNAase-free DNAase I, and 1 g reverse transcribed to cDNA using M- MLV Reverse Transcriptase (Promega). The expression of MHC I and MHC II gene mRNAs were determined using the Lighter Cycler 2.0 real-time quantitative From the Department of Clinical Laboratory (X.-D.L., X.Z., Y.Z., N.L., F.-R.W., S.-M., Z.), Qilu Hospital, Shandong University, Jinan, China; Qianfoshan Hospital of Shandong Province (X.-D.L.), Jinan, China; and Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Public Health (H.J.), Jinan, China. Address reprint requests to Zou Xiong, Department of Clinical Laboratory, Qilu Hospital, Shandong University, 107 WenHua Road, Jinan, China 250012. E-mail: [email protected]
© 2006 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
0041-1345/06/$–see front matter doi:10.1016/j.transproceed.2006.08.185
Transplantation Proceedings, 38, 3055–3057 (2006)
3055
3056
LI, ZOU, ZHANG ET AL Table 1. Comparison of MHC I mRNA Expression in Three Groups Group
Day 0
Day 2
Day 4
Day 6
Day 8
Day 10
Autografted control group CsA-treated allografted group Untreated allografted group
0.25 ⫾ 0.10 0.47 ⫾ 0.13 0.20 ⫾ 0.06
0.16 ⫾ 0.08 0.28 ⫾ 0.08 0.15 ⫾ 0.08
0.24 ⫾ 0.12 0.72 ⫾ 0.18* 0.16 ⫾ 0.06
0.15 ⫾ 0.08 0.59 ⫾ 0.14* 0.22 ⫾ 0.08
0.16 ⫾ 0.09 1.07 ⫾ 0.23** 0.25 ⫾ 0.06
0.21 ⫾ 0.10 0.42 ⫾ 0.15 0.22 ⫾ 0.06
*P ⬍ .05. **P ⬍ .01 CsA-treated allografted group versus autografted control group.
polymerase chain reaction (PCR) instrument. All PCR reagents were from the SYBR green real-time PCR kit (TaKaRa). MHC I gene primer sequence was: forward: 5= CGACTACATCGCCCTGAACG 3=; reverse: 5= CCCAGAAGGCACCACCACA 3=. The MHC II gene primer sequence was: forward: 5= CTCCGAAATGGAAACCCT 3=; reverse: 5= ATGATGCCCACCAGACCC 3=, Beta-actin was used as an internal control gene with forward sequence: 5= CGTGCGGGACATCAAGGA 3=; reverse: 5= AGGAAGGAGGGCTGGAACA 3=. The PCR was performed for 10 seconds at 95°C and 1 minute at 60°C for 40 cycles followed by the thermal denaturation protocol. The expression of MHC I and MHC II gene mRNAs compared to beta-actin mRNA was determined using the 2⫺⌬CT method.3 All results are shown as mean values ⫾ standard deviation with differences between groups examined with student t test. A P value less than .05 was considered significant; less than .01, as extremely significant.
RESULTS
Skin grew well in the autografted control group with no AGR. The times for skin allograft rejection were: CsAtreated allograft group (7.75 ⫾ 0.72) days and untreated allograft group (6.57 ⫾ 0.53) days. CsA-treated allograft group and untreated allograft group showed many lymphocytes and monocytes in the dermis with AGR. There was no obvious change in autografted control group. MHC I and MHC II gene mRNA levels did not show any obvious change in the autografted control. MHC I gene mRNA levels slowly increased in the CsA-treated allograft group, but showed no obvious change in the untreated allografted group (Table 1 and Fig 1). MHC II gene mRNA
reached the highest level 2 to 3 days before graft rejection appeared macroscopically in the CsA-treated allograft group and untreated allograft group, soon decreasing to low levels (Table 2 and Fig 2). DISCUSSION
Peripheral blood lymphocyte CD4/CD8 ratios, interleukin-2, IL-6, tumor necrosis factor (TNF) cytokines, enzymes, and proteins like C-reactive protein have been used to detect graft rejection. In addition, in renal transplantation, serum soluble CD30 level in graft recipients has also been associated with increased rejection and graft loss. But organ and tissue transplantation is so complicated that none of these methods is totally reliable as a rejection marker. Recently the MHC has attracted attention. At first, soluble MHC were studied: MHC class I and class II molecules are expressed in soluble form in the serum of both healthy and diseased individuals. Detecting serum soluble class I levels may suggest graft rejection.4 But souble MHC is unstable and easily influenced by infection. PBMC MHC is more reliable than soluble MHC. Davenport et al5 studied rat liver allografts employing flow cytometry and observed T-lymphocyte MHC II expression to increase from 3.4% ⫾ 0.44% at days 2/3 to 4.9% ⫾ 1.1% at day 7. Complete sequential data further confirmed increased MHC II expression during rejection. We used real-time reverse transcriptase PCR method to study PBMC MHC I and MHC II mRNA expression after skin grafting in rabbits. We selected skin grafts in rabbits as autografted control group CsA-treated allografted group
1.2 1 MHCImRNA expression
Fig 1. The comparison of MHC I mRNA expression in three groups post–skin graft. mRNA levers of PBMCs from CsA-treated allografted group (——), untreated allografted group (—Œ—), and autografted control group (—⽧—) were determined by real-time reverse transcriptase PCR. *P ⬍ .05 CsA-treated allografted group versus autografted control group. **P ⬍ .01 CsA-treated allografted group versus autografted control group.
untreated allografted group
**
0.8
* *
0.6 0.4 0.2 0 day0
day2
day4
day6
day8
day10
Time
MHC I AND MHC II EXPRESSION IN ACUTE REJECTION
3057
Table 2. Comparison of MHC II mRNA Expression in Three Groups Group
Day 0
Day 2
Day 4
Day 6
Day 8
Day 10
Autografted control group CsA-treated allografted group Untreated allografted group
1.49 ⫾ 0.30 1.46 ⫾ 0.33 1.78 ⫾ 0.16
1.63 ⫾ 0.28 1.86 ⫾ 0.28 1.57 ⫾ 0.08
1.23 ⫾ 0.15 4.52 ⫾ 0.58* 4.05 ⫾ 0.56*
1.26 ⫾ 0.18 2.77 ⫾ 0.24 1.78 ⫾ 0.18
1.53 ⫾ 0.28 1.88 ⫾ 0.13 2.14 ⫾ 0.26
1.39 ⫾ 0.31 1.59 ⫾ 0.18 1.63 ⫾ 0.16
*P ⬍ .01 CsA-treated allografted group or untreated allografted group versus autografted control group.
an animal model because blood samples can be drawn continuously without any obvious effect on the host. Furthermore, AGR is easily observed in the skin graft. AGR occurs in a few days through 2 weeks after the graft operation. Cellular immunity plays an important role in this process with activated CD4 and CD8 T cells. Most PBMCs are lymphocytes, and the majority, T lymphocytes. Our result showed MHC II gene mRNA expression reached its highest level at 2 to 3 days before graft rejection appeared macroscopically among the CsA-treated allograft group and the untreated allograft group. One possible explanation was that the MHC II molecule might only be expressed by professional antigen-presenting cells and activated T lymphocytes. When AGR occurred, T lymphocytes were activated; therefore, PBMCs expressed more MHC II gene mRNA; cell immunity, and humoral immunity are enhanced, resulting in greater expression of MHC II molecules. As a matter of fact, MHC class II expression is recognized as a T-lymphocyte activation marker. MHC II gene mRNA expression by PBMCs correlated with activated T lymphocytes. Real-time reverse transcriptase PCR is a rapid, hypersensitive experimental method. The above results showed that PBMC MHC II gene mRNA expression reached the highest level at 2 to 3 days before graft rejection occurred
macroscopically. It is likely that the CsA-treated allograft group was treated with low doses of CsA (5 mg/kg), so MHC II gene mRNA expression showed a trend to a slow increase but MHC II gene mRNA expression showed no obvious change in the untreated allograft group. Therefore, compared with MHC I gene mRNA expression, PBMC MHC II gene mRNA expression may be considered to be an early marker of AGR. REFERENCES 1. Wang YB, Ogawa Y, Doi H, et al: Long-term immunologic induction of donor specific tolerance to skin allografts by bone marrow transplant in rabbits. Plast Reconstr Surg 111:291, 2003 2. Rouabhia M, Germain L, Belanger F, et al: Cultured epithelium allografts: Langerhans cell and Thy-1⫹ dendritic epidermal cell depletion effects on allograft rejection. Transplantation 56:259, 1993 3. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402, 2001 4. Kerman RH, Susskind B, Buelow R, et al: Correlation of ELISA-detected IgG and IgA anti-HLA antibodies in pretransplant sera with renal allograft rejection. Transplantation 62:201, 1996 5. Davenport M, Peakman M, Dunne JB, et al: Peripheral blood and intrahepatic subsets of T lymphocyte activation and function in liver allograft rejection and drug-induced tolerance in rats. Transpl Immunol 4:126, 1996
autografted control group
5
MHC II mRAN expression
CsA-treated allografted group untreated allografted group
**
4.5 4 3.5
**
3 2.5 2 1.5 1 0.5 0
day0
day2
day4
day6
day8
day10
Time
Fig 2. The comparison of MHC II mRNA expression in three groups post–skin graft. mRNA levers of PBMC from CsA-treated allografted group (——), untreated allografted group (—Œ—), and autografted control group (—⽧—) were determined by real-time reverse transcriptase PCR. **P ⬍ .01 CsA-treated allografted group or untreated allografted group versus autografted control group.