The Sympathetic Nervous System Mitigates CNS Autoimmunity via β2-Adrenergic Receptor Signaling in Immune Cells

Article

The Sympathetic Nervous System Mitigates CNS Autoimmunity via b2-Adrenergic Receptor Signaling in Immune Cells Graphical Abstract

Authors Leandro Pires Araujo, Juliana Terzi Maricato, Marcia Grando Guereschi, ..., Francisco J. Quintana, Patrı´cia C. Brum, Alexandre S. Basso

Correspondence [email protected]

In Brief Araujo et al. show that neurotransmitters released by the sympathetic nervous system regulate the generation of adaptive immune responses mitigating autoimmune inflammation within the CNS.

Highlights d

Sympathetic nervous system (SNS) limits CNS autoimmune inflammation

d

Adrb2 signaling in immune cells mediates the SNS effects on EAE development

d

Adrb2-mediated SNS suppressive effects involve ICERdriven inhibition of CD4+ T cells

Araujo et al., 2019, Cell Reports 28, 3120–3130 September 17, 2019 ª 2019 The Authors. https://doi.org/10.1016/j.celrep.2019.08.042

Cell Reports

Article The Sympathetic Nervous System Mitigates CNS Autoimmunity via b2-Adrenergic Receptor Signaling in Immune Cells Leandro Pires Araujo,1,5 Juliana Terzi Maricato,1 Marcia Grando Guereschi,1 Maisa Carla Takenaka,1 Vanessa M. Nascimento,1 Filipe Menegatti de Melo,1 Francisco J. Quintana,2,4 Patrı´cia C. Brum,3 and Alexandre S. Basso1,6,*

~o Paulo, Sa ~o Paulo de Microbiologia, Imunologia e Parasitologia, Escola Paulista de Medicina, Universidade Federal de Sa 04023-062, Brazil 2Ann Romney Center for Neurologic Diseases, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02458, USA 3Escola de Educac ~o Fı´sica e Esporte, Universidade de Sa ~o Paulo, Sa ~o Paulo 05508-030, Brazil ¸a 4The Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA 5Present address: Department of Microbiology and Immunology, Vagelos College of Physicians and Surgeons, Columbia University, New York, NY 10032, USA 6Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2019.08.042 1Departamento

SUMMARY

Noradrenaline (NE), the main neurotransmitter released by sympathetic nerve terminals, is known to modulate the immune response. However, the role of the sympathetic nervous system (SNS) on the development of autoimmune diseases is still unclear. Here, we report that the SNS limits the generation of pathogenic T cells and disease development in the experimental autoimmune encephalomyelitis (EAE) model of multiple sclerosis (MS). b2-Adrenergic receptor (Adrb2) signaling limits T cell autoimmunity in EAE through a mechanism mediated by the suppression of IL-2, IFN-g, and GM-CSF production via inducible cAMP early repressor (ICER). Accordingly, the lack of Adrb2 signaling in immune cells is sufficient to abrogate the suppressive effects of SNS activity, resulting in increased pathogenic T cell responses and EAE development. Collectively, these results uncover a suppressive role for the SNS in CNS autoimmunity while they identify potential targets for therapeutic intervention. INTRODUCTION The sympathetic nervous system (SNS) innervates lymphoid organs including the spleen and lymph nodes (Bellinger et al., 1989, 1992; Nance and Sanders, 2007). The anatomy of SNS innervation within lymphoid organs suggests that noradrenaline (NE), the main neurotransmitter released by sympathetic nerves, modulates the immune response. Indeed, signaling via adrenergic receptors expressed in macrophages, dendritic cells (DCs), and T cells, influences a variety of immune processes including antigen uptake (Yanagawa et al., 2010) and presentation (Herve´ et al., 2013) by DCs, T cell activation and differentiation (Kohm and Sanders, 2001; Madden et al., 1995; Ramer-

Quinn et al., 2000; Sanders and Straub, 2002), lymphocyte trafficking (Nakai et al., 2014; Suzuki et al., 2016), and cytokine production by myeloid cells and lymphocytes (Maestroni and Mazzola, 2003; Panina-Bordignon et al., 1997; Ramer-Quinn et al., 2000; Takenaka et al., 2016). The Adrb2, a G protein-coupled receptor (GPCR) associated with the Gas subunit, is the most expressed adrenergic receptor in immune cells, and its activation in DCs and CD4+ T cells leads to increased intracellular cAMP levels with consequent protein kinase A (PKA)-dependent CREB phosphorylation (Guereschi et al., 2013; Takenaka et al., 2016). PKA activation is reported to reduce Lck-mediated tyrosine phosphorylation of the T cell receptor (TCR)/CD3 z chain inhibiting signaling via the TCR (Vang et al., 2001), and cAMPdependent transcriptional mechanisms have been shown to diminish interleukin-2 (IL-2) production and a chain expression of the IL-2 receptor (CD25) following T cell activation (Chen and Rothenberg, 1994; Krause and Deutsch, 1991; Tamir and Isakov, 1994). Despite the accumulating evidence demonstrating that the SNS modulates the immune response, its role on T cell-dependent autoimmunity is still poorly understood. Most studies addressing this point are based on the chemical ablation of sympathetic peripheral fibers by the injection of 6-hydroxydopamine (6-OHDA). This experimental strategy has yielded controversial results on experimental autoimmune encephalomyelitis (EAE) development. Thus, depletion of splenic NE by 6-OHDA administration resulted in the development of more severe EAE (Leonard et al., 1991). Similarly, in a passive EAE model, when lymph node cells were obtained either from 6-OHDA-treated or control donors, the disease was more severe in animals receiving the cells from the 6-OHDA donors (Chelmicka-Schorr et al., 1992). However, chemical sympathectomy with 6-OHDA is also reported to cause less severe EAE, which was associated with a TGF-b-dependent increase in the peripheral number of regulatory T cells (Bhowmick et al., 2009). One possible explanation for these conflicting data is that immune cells, including macrophages and lymphocytes, can synthesize catecholamines (Bergquist et al., 1994; Cosentino et al., 2007; Flierl et al., 2007;

3120 Cell Reports 28, 3120–3130, September 17, 2019 ª 2019 The Authors. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Shaked et al., 2015) and because of that are probably targeted by 6-OHDA as well. In fact, treatment with 6-OHDA was already shown to eliminate catecholamine-producing immune cells in different experimental models of T cell-mediated autoimmune diseases (Capellino et al., 2012; Shaked et al., 2015). Moreover, 6-OHDA was reported to exert anti-inflammatory effects, acting directly in immune cells regardless of their ability to synthesize catecholamines (Josefsson et al., 1994). Herein, we utilized a2a/c adrenergic receptor-deficient mice as a different strategy to investigate the role of the SNS in T cell responses and EAE development. a2a/c-Adrenergic receptors (Adra2ac) constitute an important negative-feedback mechanism required for the presynaptic control of neurotransmitter release from sympathetic fibers (Hein et al., 1999). Thus, mice lacking a2a/c-adrenergic receptors display increased systemic NE levels due to SNS hyperactivity (Hein et al., 1999). Our results unravel that the release of neurotransmitters such as NE by the SNS limits pathogenic T cell responses mitigating CNS autoimmune inflammation via signaling through Adrb2 in immune cells. RESULTS Adra2ac
/
Mice Develop Less Severe Clinical EAE and Reduced CNS Inflammation To study whether the SNS regulates T cell-driven autoimmunity, we used animals lacking Adra2ac, which are characterized by increased systemic levels of NE because of SNS hyperactivity (Hein et al., 1999). We induced EAE by immunizing wild-type (WT) or Adra2ac
/
mice with MOG35–55 emulsified in complete Freund’s adjuvant (CFA) and monitored further disease development. The first signs of EAE appeared at days 9–10 (peaking at days 15–16), and a partial recovery starting at days 20–21 was observed. We verified that, compared to WT mice, Adr2ac
/
developed less severe EAE with significant lower clinical scores mainly during the peak of the disease and the recovery phase (Figure 1A). To assess the inflammation in the target organ, we analyzed mononuclear cells taken from the CNS at the peak of the disease by flow cytometry. Looking at infiltrating inflammatory cells after immunostaining with anti-CD11b and antiCD45 antibodies (Figure 1B), we found that while activated microglia/macrophage cells (CD11b+CD45hi) were less frequent in Adra2ac
/
mice compared to WT animals (Figure 1C), resting microglia (CD11b+CD45lo) were present in higher percentages in the CNS of Adra2ac
/
mice (Figure 1D). We also verified a reduction in the total number of activated microglia/macrophage cells within the CNS of Adra2ac
/
mice (Figure 1E). In addition, Adra2ac
/
animals displayed a decreased total number of CD3+CD4+ T cells, reduced absolute number and frequency of interferon-g (IFN-g)-producing CD4+ T cells, and also reduced IFN-g expression by the CD4+ T cells secreting this cytokine (Figures 1F–1H). No changes were seen in the CD4+IL-17A+ population and in the IL-17A expression by CD4+ T cells (Figure 1I). Altogether, these results suggest that SNS hyperactivity by Adra2ac deficiency suppresses T cell-mediated CNS autoimmune inflammation.

Adra2ac
/
Mice Display Impaired Generation of Encephalitogenic CD4+ T Cells Next, we investigated the effects of Adra2ac deficiency on the generation of the antigen-specific T cell response. First, the frequency of CD4+ and CD8+ T cells, and B cells (CD19+) was not affected in the lymph nodes, spleen, and blood of Adra2ac
/
naive mice (Figures S1 and S2). Seven days after immunization of WT or Adra2ac
/
mice with MOG35–55 emulsified in CFA, draining lymph node cells were harvested for the evaluation of proliferation and cytokine secretion upon in vitro antigen-specific stimulation. We detected decreased MOG35–55-induced T cell proliferation and IL-2 production in Adra2ac
/
mice when comparing them with WT animals (Figures 2A and 2B). Moreover, we found that cells from Adra2ac
/
mice secreted lower amounts of IFN-g and granulocyte-macrophage colony-stimulating factor (GM-CSF) (Figures 2C and 2D), whereas there was no difference in the secretion of IL-17A by antigen-specific T cells (Figure 2E). Therefore, the amelioration of clinical EAE and inflammation in the CNS of Adra2ac
/
mice is associated with an impaired generation of encephalitogenic T cells within draining lymph nodes. Giving further support to the idea that the control of SNS activity within lymph nodes is important to regulate T cell-driven autoimmunity, we found that local pharmacological blockade of a2-adrenergic receptors in draining lymph nodes results in less severe EAE in WT mice, similar to what was observed in Adra2ac
/
mice (Figure S3). Absence of Adra2ac in CD4+ T Cells and DCs Does Not Account for the EAE Amelioration and the Impaired Generation of Encephalitogenic T Cells in Adra2ac
/
Mice In addition to the terminal endings of sympathetic nerve fibers, immune cells, including DCs and T cells, also express a2-adrenergic receptors (Guereschi et al., 2013; Yanagawa et al., 2010). Thus, to rule out that the effects observed in the generation of antigen-specific encephalitogenic T cells in Adra2ac
/
mice result from the lack of these receptors in immune cells but rather from SNS hyperactivity, we first conducted in vitro experiments with DCs and CD4+ T cells obtained from WT or Adra2ac
/
mice. We did not detect any defects in the production of IFN-g by Adr2ac
/
CD4+ T cells following in vitro activation under Th1-skewing conditions (Figure 3A). In addition, WT MOG35–55specific TCR transgenic CD4+ T cells (2D2 T cells) or Adr2ac
/
2D2 T cells showed indistinguishable proliferative response following stimulation with MOG35–55-pulsed bone marrowderived dendritic cells (BMDCs) derived from either WT mice (Figure 3B) or Adr2ac
/
-deficient (Figure 3C) mice. Moreover, WT and Adr2ac
/
lipopolysaccharide (LPS)-stimulated BMDCs produced equivalent levels of IL-12p70 (Figure 3D). Accordingly, after being loaded with MOG35–55, LPS-stimulated Adra2ac
/
and WT BMDCs triggered similar amounts of IFN-g production by naive 2D2 CD4+ T cells (Figure 3E). Finally, Rag1
/
mice reconstituted with purified naive CD4+ T cells either from WT 2D2 donors or Adra2ac
/
2D2 animals developed similar EAE following immunization with MOG35–55 emulsified in CFA (Figure 3F). Overall, these results suggest Adra2ac deficiency in DCs and CD4+ T cells do not contribute

Cell Reports 28, 3120–3130, September 17, 2019 3121

Figure 1. Adra2ac
/
Mice Develop Less Severe Clinical EAE and Reduced CNS Inflammation

EAE was induced in WT or Adra2ac
/
mice by immunization with MOG35–55 in complete Freund’s adjuvant (CFA). (A) The clinical course of EAE is shown as mean clinical score ± SEM. n = 10 mice per group. ***p < 0.001 versus Adra2ac
/
(two-way ANOVA with Bonferroni’s post-test). Data are representative of four experiments. (B) Inflammatory cells were isolated from the CNS of WT or Adra2ac
/
at the peak of EAE and immune stained for CD45 and CD11b. (C and D) Frequency of activated microglia/macrophage (CD11b+CD45hi) (C) and resting microglia (CD11b+CD45lo) (D). (E) Total number of activated microglia/macrophage (CD11b+CD45hi) within the CNS during EAE. Results are mean ± SEM. *p < 0.05 versus WT (Student’s t test). (F) Representative dot plots showing the production of IFN-g and IL-17A by CNS-infiltrating CD4+ T cells at 16 days after immunization. Percentages are shown in each quadrant. (G) Total CD4+ T cells were gated in the CD3+CD4+ population. (H) Absolute number and percentage of CD4+IFN-g+ T cells and IFN-g expression by mean fluorescence intensity (MFI) are shown. (I) CD4+IL-17A+ T cells and intracellular expression of IL-17A (MFI) by CD4+ T cells. Results are mean ± SEM. n = 5 mice per group. *p < 0.05 versus WT (Student’s t test). Data are representative of two independent experiments.

to the amelioration of EAE and the impaired generation of encephalitogenic T cell responses in Adra2ac
/
mice. Hyperactivity of the SNS Limits EAE Development and Antigen-Specific CD4+ T Cell Proliferation In Vivo To further investigate the effects of the SNS on the generation of effector T cell responses, we adoptively transferred CFSElabeled CD45.1+ 2D2 T cells to either Adra2ac
/
or WT mice. The recipients were then immunized with LPS-stimulated WT BMDCs pulsed with MOG35–55, and 60 h later we analyzed by flow cytometry the antigen-specific proliferation of the trans-

3122 Cell Reports 28, 3120–3130, September 17, 2019

ferred CD45.1+ 2D2 T cells. We verified that the 2D2 T cells displayed lower proliferation rates in Adra2ac
/
mice than in WT recipients (Figure 4A), suggesting that the SNS limits antigenspecific CD4+ T cell proliferation in vivo. Moreover, we analyzed EAE development in either Rag1
/
or Adra2ac
/
Rag1
/
mice reconstituted with WT 2D2 T cells (Figure 4B). Following immunization with MOG35–55 emulsified in CFA, we detected development of milder disease in Adra2ac
/
Rag1
/
recipients (Figure 4C). Based on our in vivo and in vitro findings, we hypothesized that Adrb2 signaling in T cells in the context of increased NE systemic

Figure 2. Adra2ac
/
Mice Display Impaired Generation of Encephalitogenic T Cell Response Draining lymph nodes (DLNs) were harvested from WT or Adra2ac
/
mice 7 days after immunization with MOG35–55/CFA and the cells were cultivated in the presence of MOG35–55. (A) T cell proliferation was measured by [3H] thymidine incorporation after 72 h of culture. (B–E) Supernatants were collected after 48 h and assessed by CBA and ELISA to measure (B) IL-2, (C) IFN-g, (D) GM-CSF, and (E) IL-17A production upon antigen-specific stimulation. Results are mean ± SEM. n = 5 mice per group. *p < 0.05 and ***p < 0.001, Student’s t test. Data are representative of two independent experiments.

levels in Adra2ac
/
mice limits the pathogenic autoimmune response during EAE. In vitro, Adrb2 signaling is reported to reduce CD4+ T cell activation and proliferation upon TCR engagement (Riether et al., 2011). Indeed, we observed that prior Adrb2 activation (fenoterol) decreased antigen-specific 2D2 CD4+ T cell proliferation in vitro following stimulation with MOG35–55-pulsed BMDCs (Figure 4D). We found that this Adrb2-mediated reduction in the proliferation of 2D2 CD4+ T cells was accompanied by increased expression of the inducible cAMP early repressor (ICER) (Figure 4E) and decreased Il-2 transcription levels (Figure 4F). In contrast, these Adrb2 agonist-induced changes in gene expression were not observed with 2D2 CD4+ T cells that lacked Adrb2, demonstrating that the agonist acted specifically on the b2-adrenergic receptor in T cells. ICER is a cAMP-, PKA-dependent splice variant of CREM (cAMP response element modulator), and particularly in T cells, it plays an important role in the negative regulation of nuclear factor of activated T cells (NFAT)- and AP-1-mediated transcription, including that of IL-2, GM-CSF, and IFN-g genes (Bodor et al., 2001; Bodor and Habener, 1998). Exactly as for the 2D2 CD4 T cells treated in vitro with the Adrb2 agonist, we observed that T cells harvested from Adra2ac
/
mice 7 days after MOG35–55 immunization displayed reduced proliferation and diminished IL-2 secretion following antigen-specific stimulation (Figures 2A and 2B). Because of

that we further hypothesized that ICER could be an important mechanism regulating the generation of effector CD4+ T cell responses in Adra2ac
/
mice. To test that, we immunized WT and Adra2ac
/
animals with MOG35–55 emulsified in CFA, sorted CD4+ T cells from draining lymph nodes 7 days later, and measured Icer and il2 expression by qPCR. Consistent with the idea that in Adra2ac
/
mice the CD4+ T cells have increased cAMP levels due to augmented Adrb2 activation, we verified increased Icer expression (Figure 4G) and decreased il2 transcript levels (Figure 4H) in Adra2ac
/
CD4+ T cells as compared with WT cells from MOG-immunized mice. Of note, we did not find any evidence supporting long-term Adrb2 desensitization in CD4 T cells due to increased NE levels in Adra2ac
/
mice. Thus, upon in vitro treatment of fluorescence-activated cell sorting (FACS)-sorted CD4 T cells with an Adrb2 agonist, we observed a similar increase in intracellular cAMP levels when comparing cells isolated from WT or Adra2ac
/
mice (Figure S4). The SNS Limits EAE Development and the Generation of Encephalitogenic T Cell Responses via b2-Adrenergic Signaling Strengthening the role of Adrb2 signaling in suppressing EAE, we observed that upon MOG35–55/CFA immunization, Adrb2-deficient mice (Adrb2
/
) developed more severe EAE as compared with WT mice (Figure 5A), suggesting that signaling through Adrb2 limits disease development even in animals in which the SNS is not hyperactive. To further test the hypothesis that, in Adra2ac
/
animals, the hyperactive SNS limits the encephalitogenic CD4+ T cell response and EAE development via Adrb2 signaling, we blocked this receptor with a specific Adrb2 antagonist (10 mg/kg/day, subcutaneously [s.c.]) administered with osmotic pumps. We implanted the pumps 3 days before immunization to provide

Cell Reports 28, 3120–3130, September 17, 2019 3123

Figure 3. Absence of Adra2ac in CD4+ T Cells and DCs Does Not Account for the EAE Amelioration and the Impaired Generation of Encephalitogenic T Cells in Adra2ac
/
Mice

(A) FACS-sorted naive CD4+ cells from WT or Adra2ac
/
mice were activated under Th1-polarizing conditions, and the frequency of CD4+ IFN-g+ cells was analyzed by flow cytometry. (B and C) WT (B) or Adra2ac
/
(C) BMDCs were stimulated with LPS, pulsed with MOG35–55, and co-cultured with Cell Tracer-labeled naive T CD4+ from WT 2D2 or Adra2ac
/
2D2 mice. After 3 days, the dilution of the Cell Tracer was analyzed by flow cytometry in the gated CD4+ population. (D) WT or Adra2ac
/
BMDCs were stimulated with 1 mg/mL LPS, and after 18 h IL-12 p70 production was analyzed by ELISA. (E) IFN-g production was measured by ELISA in the supernatant of co-cultures of naive CD4+ 2D2 T cells with MOG35–55-loaded WT or Adra2ac
/
BMDCs stimulated with 1 mg/mL LPS for 6 h. *p < 0.05. (F) Rag1
/
mice were reconstituted with either purified WT 2D2 CD4+ T cells or Adra2ac
/
2D2 CD4+ T cells. In the next day, the reconstituted mice were immunized with MOG35–55/CFA, and EAE development was monitored. Results are mean ± SEM. n = 7 mice per group. Two-way ANOVA with Bonferroni’s post-test. Data are representative of two independent experiments.

continuous delivering of either vehicle or the antagonist for 10 days (until day 6 post-immunization) (Figure 5B). The pharmacological blockade of Adrb2 was sufficient to recover EAE development in Adra2ac
/
mice (Figure 5C). Accordingly, Adrb2 blockade also rescued the generation of encephalitogenic T cells in Adra2ac
/
animals. Thus, following in vitro stimulation with MOG35–55, the cells isolated from the lymph nodes of Adra2ac
/
animals treated with the Adrb2 antagonist produced similar amounts of IFN-g and GM-CSF compared with the cells harvested from WT animals (Figures 5D and 5E). No differences were found when looking at antigen-specific induced IL-17A production (Figure 5F).

3124 Cell Reports 28, 3120–3130, September 17, 2019

In support of a role of ICER-dependent mechanisms in the Adrb2-mediated suppressive effects of the SNS on the pathogenic T cell response and EAE development, Adrb2 blockade reduced Icer expression while it concomitantly increased il2 transcript levels in CD4+ T cells isolated from the draining lymph nodes 7 days after MOG35–55/CFA immunization (Figures 5G and 5H). The SNS Limits EAE Development and Encephalitogenic CD4+ T Cell Responses via Directly Signaling through b2-Adrenergic Receptors Expressed by Immune Cells Our in vitro experiments show that signaling through Adrb2 in T cells can modulate antigen-specific proliferation and IL-2

Figure 4. Hyperactivity of the SNS Limits EAE Development and Antigen-Specific CD4+ T Cell Proliferation In Vivo

(A) FACS-sorted naive 2D2 CD4+ T cells from congenic mice (CD45.1+) were CFSE labeled and adoptively transferred (intravenously [i.v.]) to WT or Adra2ac
/
mice. The recipient mice were immunized with MOG35–55-loaded DCs (s.c.), and after 60 h the draining lymph node cells were harvested and immune stained with anti-CD45.1 and CD4. The dilution of CFSE was analyzed in the gated CD45.1+CD4+ cells by flow cytometry, and the proliferation index was quantified using FlowJo software. Results are mean ± SEM. n = 5 mice per group. *p < 0.05, Student’s t test. (B and C) Rag1
/
or Adra2ac
/
Rag1
/
mice received 106 WT 2D2 CD4+ T cells (i.v.) and were immunized with MOG35–55/CFA (B), and EAE development was monitored (C). Results are mean ± SEM. n = 5–10 mice per group. ***p < 0.001 (two-way ANOVA with Bonferroni’s post-test). (D) Purified naive 2D2 CD4+ T cells were Cell Tracer labeled and treated or not with 1 mM Adrb2 agonist (fenoterol) for 1 h, washed, and co-cultured with MOG35–55-loaded DCs. After 72 h, the dilution of the Cell Tracer in the 2D2 CD4+ T cells was analyzed by flow cytometry. Results are mean ± SEM. **p < 0.01. (E and F) Sorted WT 2D2 CD4+ T cells or Adrb2
/
2D2 CD4+ T cells were treated or not with 1 mM Adrb2 agonist (fenoterol) for 1 h, washed and activated by MOG35–55-pulsed DCs in vitro for 5 h, and then 2D2 T cells were FACS-sorted for (E) Icer and (F) Il-2 expression analysis by qPCR. (G and H) WT or Adra2ac
/
mice were immunized with MOG35–55/CFA, and after 7 days the draining lymph node cells were harvested and (G) Icer and (H) Il-2 expression was analyzed by qPCR in sorted CD4+ T cells. Data are mean ± SD. n = 3 mice per group. *p < 0.05, **p < 0.01, and ***p < 0.001.

secretion. However, in vivo, neurotransmitters released by the SNS may interfere with EAE development either via Adrb2 signaling directly in immune cells or indirectly, for instance by inducing other neuroendocrine changes that modulate immune cells. Although noradrenergic inputs reach the paraventricular nucleus of the hypothalamus playing a role in the regulation of

the hypothalamus-pituitary-adrenal axis (Levy and Tasker, 2012), we did not find any difference in serum corticosterone levels between Adra2ac
/
and WT mice that could explain EAE amelioration (Figure S5). Thus, to determine whether Adrb2 signaling in immune cells limits EAE development, we used bone marrow (BM) chimeric

Cell Reports 28, 3120–3130, September 17, 2019 3125

Figure 5. The SNS Limits EAE Development and the Generation of the Encephalitogenic T Cell Response via b2-Adrenergic Signaling

(A) WT or Adrb2
/
mice were immunized with MOG35–55/CFA, and EAE development was monitored. n = 10 mice per group. *p < 0.05 and **p < 0.01, two-way ANOVA with Bonferroni’s post-test. (B) Continuous delivery of the Adrb2 antagonist (10 mg/kg/day, s.c.) by osmotic pumps in Adra2ac
/
mice from day
3 until day 6 after immunization. (C) Mice were immunized with MOG35–55/CFA and monitored for EAE development. n = 6–10 mice per group. **p < 0.01 and ***p < 0.001, two-way ANOVA with Bonferroni’s post-test. (D–F) Draining lymph node cells of MOG35–55immunized mice were harvested 7 days after immunization and cultivated with MOG35–55 for 48 h to the analysis of (D) IFN-g, (E) GM-CSF, and (F) IL17A production by ELISA (n = 5–6 mice per group). One-way ANOVA with Bonferroni’s post-test. (G and H) FACS-sorted CD3+CD4+ T cells isolated 7 days after immunization from the DLNs of WT, Adra2ac
/
vehicle, and Adra2ac
/
ADRB2 antagonist mice were used to measure the expression of (G) Icer2 and (H) Il-2 by qPCR. n = 3 mice per group. In (A)–(E), results are mean ± SEM. *p < 0.05, **p < 0.01, and ***p < 0.001. In (G) and (H), results are mean ± SD. All data are representative of two independent experiments.

mice in which only hematopoietic cells lack Adrb2. We found that the absence of Adrb2 in immune cells recapitulates the EAE phenotype of Adrb2
/
animals. Indeed, animals reconstituted with Adrb2
/
BM developed more severe EAE than those reconstituted with WT BM (Figure 6A). Moreover, draining lymph node cells from MOG35–55-immunized mice reconstituted with Adrb2
/
BM produced increased levels of GM-CSF, IFN-g,

3126 Cell Reports 28, 3120–3130, September 17, 2019

and IL-2 upon in vitro antigen-specific stimulation (Figures 6B–6D). No differences were detected in IL-17A production (Figure 6E). Of note, reconstitution efficiency did not differ between the two BM donor groups (data not shown). To further suggest a role of Adrb2 signaling in T cells in the suppressive effects of the SNS on EAE development, and we reconstituted Rag1
/

/

/
Adra2ac Rag1 mice with WT 2D2 T cells or Adrb2
/
2D2 T cells and immunized them with MOG35–55 emulsified in CFA to monitor disease development (Figure 6F). The reconstitution of Adra2ac
/
Rag1
/
mice with Adrb2
/
2D2 T cells recovered EAE development (Figure 6G). Moreover, we found that cells taken from the CNS of Adra2ac
/
Rag1
/
mice reconstituted with WT 2D2 T cells produced lower amounts of GM-CSF and IFN-g upon MOG35–55 stimulation than did cells taken from the CNS of Rag1
/
recipients. Importantly, the ability to secrete GM-CSF and IFN-g was fully recovered when the cells were harvested from the CNS of Adra2ac
/
Rag1
/
mice reconstituted with Adrb2
/
2D2 T cells (Figures 6H and 6I). Hence, Adrb2 signaling in CD4+ T cells mediates the suppression of CNS autoimmunity by the SNS.

Figure 6. The SNS Limits EAE Development and the Encephalitogenic T Cell Response via Directly Signaling through b2-Adrenergic Receptors Expressed by Immune Cells (A) Bone marrow (BM) chimeras were generated using CD45.1+ or Adrb2
/
CD45.1+ mice as donors and WT (CD45.2) as recipients. After 8 weeks, the reconstituted animals were immunized with MOG35–55/CFA and monitored for EAE development. (B–E) The antigen-specific stimulation was done using draining lymph node cells harvested from the animals reconstituted with CD45.1+ or Adrb2
/
CD45.1+ BM cells, and (B) IL-2, (C) IFN-g, (D) GM-CSF, and (E) IL-17A production were measured by ELISA after 48 h of MOG35–55 stimulation. (F) Rag1
/
or Adra2ac
/
Rag1
/
mice were reconstituted with either WT 2D2 T cells or Adrb2
/
2D2 T cells. (G) Reconstituted mice were immunized and monitored for EAE development. Results are mean ± SEM (n = 12–16 mice per group). *p < 0.05 and **p < 0.01. Pooled data from two independent experiments. (H and I) CNS-infiltrating cells were harvested at the peak of EAE and stimulated with MOG35–55 for 48 h. (H) IFN-g and (I) GM-CSF were measured by ELISA (*p < 0.05). Two-way ANOVA with Bonferroni’s post-test (A and G) and one-way ANOVA Bonferroni’s post-test (B–E, H, and I).

DISCUSSION In this study, we used Adra2ac
/
mice as a different strategy to investigate how the SNS modulates CNS autoimmunity. Animals lacking Adra2ac display SNS hyperactivity and increased systemic NE levels because they miss a negative-feedback mechanism that is required to control neurotransmitter release by sympathetic fibers. We showed here that the release of neurotransmitters such as NE by the SNS mitigates the development of CNS autoimmunity via Adrb2 signaling in immune cells. We

found that the SNS effects on limiting EAE development are mediated by Adrb2-driven impairment in the generation of encephalitogenic CD4+ T cells. Adrb2 signaling in CD4+ T cells was reported to reduce T cell proliferation upon in vitro TCR engagement (Riether et al., 2011; Sanders et al., 1997). These effects were associated with PKAdependent inhibition of calcineurin activity, leading to reduced dephosphorylation of cytosolic NFAT (Riether et al., 2011). Herein, we propose an additional mechanism to explain in vivo Adrb2mediated suppressive effects of the SNS on the generation of

Cell Reports 28, 3120–3130, September 17, 2019 3127

encephalitogenic CD4+ T cell responses. We found that CD4+ T cells primed within lymph nodes following MOG immunization in the context of increased systemic NE express high levels of Icer and reduced levels of il2. Upon antigen-specific stimulation, these CD4+ T cells expressing high levels of Icer display a lower proliferative response and secrete diminished amounts of GM-CSF, IFN-g, and IL-2. Adrb2 pharmacological blockade reduced Icer expression and concomitantly rescued il2 expression and GM-CSF/IFN-g secretion following MOG35–55 stimulation of CD4+ T cells isolated from Adra2ac
/
mice. Accordingly, Adrb2 pharmacological blockade also rescued EAE development in Adra2ac
/
mice. Moreover, in vitro, Adrb2 activation in CD4+ T cells led to increased Icer expression and reduced proliferative response and il2 expression upon TCR engagement. Thus, our results suggest that Adrb2-mediated suppressive effects of the SNS on the generation of encephalitogenic CD4+ T cell responses and CNS autoimmunity are associated with ICER-dependent mechanisms. ICER is a splice variant of the CREM gene and is expressed in a cAMP-PKA-dependent manner. Because it lacks the activation and kinase-inducible domains and contains only the DNA binding domains, ICER functions as an endogenous transcriptional repressor of many genes containing cAMP response element (CRE) regions in their promoters (Bodor and Habener, 1998). Particularly in T cells, increased ICER expression prior to TCR engagement favors the formation of the NFAT/ICER complex instead of the NFAT/pCREB complex that normally occurs following TCR signaling. Competing with NFAT/pCREB, the formed NFAT/ICER complex binds to the CD28RE region of the IL-2 promoter and avoids CBP/p300 recruitment, strongly inhibiting IL-2 gene transcription and proliferation in T cells (Bodor et al., 2000). ICER was shown to bind to a conserved element of GM-CSF and IFN-g promoters as well (Bodor et al., 2001; Bodor and Habener, 1998). Indeed, T cells from a transgenic mouse expressing ICER under the control of a lymphocyte-specific lck promoter exhibited reduced levels of IL-2 and IFN-g upon activation. In addition, splenic T cells from ICER-transgenic mice showed a defect in proliferation and lacked a mixed lymphocyte reaction response (Bodor et al., 2001). Despite being involved in the negative transcriptional regulation of GM-CSF, IL-2, and IFN-g in CD4+ T cells, ICER was found to be a requisite for the differentiation of IL-17-producing CD4+ T cells (Yoshida et al., 2016). In fact, ICER binds to the il17a promoter where it favors the recruitment of the master regulator RORgT, contributing to Th17 differentiation (Yoshida et al., 2016). Naive CD4+ T cells from ICER/CREM-deficient mice have an impaired capacity to differentiate into Th17 cells and forced ICER expression rescues Th17 differentiation in ICER/ CREM-deficient CD4+ T cells (Yoshida et al., 2016). Consistently, we observed that concomitantly with high expression of ICER and decreased secretion of GM-CSF and IFN-g, IL-17A production is not affected in CD4+ T cells isolated from animals with SNS hyperactivity. Although we provided evidence showing that Adrb2 signaling in CD4+ T cells mediates the SNS-suppressive effects on CNS autoimmunity, we cannot rule out the possibility that Adrb2 signaling in other immune cell types, such as DCs, plays a role as well. Indeed, we previously showed that Adrb2 signaling in DCs inhibits IL-12 secretion while it preserves

3128 Cell Reports 28, 3120–3130, September 17, 2019

IL-23 production upon LPS stimulation (Takenaka et al., 2016). This Adrb2-mediated change in the profile of cytokines produced by DCs inhibited IFN-g production and favored IL-17A secretion in CD4+ T cells following in vitro TCR engagement (Takenaka et al., 2016). Thus, Adrb2 signaling in DCs may be an additional mechanism in the in vivo suppressive effects of the SNS on the generation of IFN-g-secreting T cells, with minor effects on IL-17A T cell responses. Signaling through Adrb2 also modulates other aspects of T cell function besides proliferation and cytokine production. For instance, Adrb2 was shown to control lymphocyte egress from lymph nodes by altering the responsiveness of the chemokine receptors CXCR4 and CCR7 (Nakai et al., 2014). Thus, Adrb2 activation in lymphocytes by intravenous injection of agonists promotes lymphocyte retention within lymph nodes and rapidly produces lymphopenia in mice (Nakai et al., 2014). In our study, we did not detect any alteration in the number of CD4+ or CD8+ T cells in the blood of Adra2ac
/
mice. Our data demonstrate that in vivo Adrb2 signaling, besides controlling lymphocyte trafficking also regulates the generation of encephalitogenic T cell responses within the lymph nodes, limiting CNS autoimmune inflammation. In multiple sclerosis (MS) patients, sympathetic dysfunction was associated with the clinical activity of the disease (Flachenecker, 2007; Flachenecker et al., 2001). Thus, serum levels of NE and epinephrine were found to be lower in active MS compared to stable MS patients (Flachenecker et al., 2001). Moreover, alterations in Adrb2 expression in peripheral blood mononuclear cells have been correlated with disease activity (Zoukos et al., 1994, 2003). A trial showed that an Adrb2 agonist (albuterol) improves clinical outcomes in MS patients as an addon therapy to glatiramer acetate treatment (Khoury et al., 2010). In addition, another study showed that the use of another Adrb2 agonist (fenoterol) is negatively associated with the incidence of MS, suggesting that the use of fenoterol has the potential to reduce the risk of developing MS (Tsai et al., 2014). In conclusion, our results unravel how the SNS contributes to the regulation of encephalitogenic CD4+ T cell responses and CNS autoimmunity, opening perspectives to therapeutic interventions and disease prevention. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS METHOD DETAILS B Induction of EAE B Preparation of CNS mononuclear cells B Flow cytometry analysis B Flow cytometry analysis of lymphoid organs B CD4+ and CD8+ T cells from peripheral blood B Intracellular cAMP measurement by ELISA B Corticosterone measurement B In vitro differentiation of Th1 cells

B

Intracellular cytokine staining Generation of bone marrow–derived dendritic cells (DC) B T cell activation and proliferation assays B Cytokine measurement + B CD4 T Cell Transfer B Bone-marrow (BM) chimera B Pharmacological treatment B qPCR QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY B

d d

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. celrep.2019.08.042. ACKNOWLEDGMENTS We would like to thank Daniela Teixeira for the cell-sorting procedures; Geova Pereira, Claudemir Rodrighero, and CEDEME staff for animal care; and Howard L. Weiner, who kindly provided 2D2 mice. The illustration of graphical ab~o de stract was created with BioRender. This work was supported by Fundac¸a ~o Paulo (FAPESP) grants 08/58564-9, 14/ Amparo a` Pesquisa do Estado de Sa 24156-2, and 11/02738-1 and Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq) grants 400450/2014-3 and 165940/2014-0. This ~o de Aperfeic¸oamento de Pessoal study was financed in part by Coordenac¸a de Nı´vel Superior-Brasil (CAPES) Finance Code 001. AUTHOR CONTRIBUTIONS L.P.A. designed and performed experiments, analyzed results, discussed and/ or interpreted findings, and wrote the manuscript. J.T.M., M.G.G., M.C.T., V.M.N., and F.M.d.M. performed experiments and discussed and/or interpreted findings. F.J.Q. discussed and/or interpreted findings. P.C.B. provided unique reagents. A.S.B. designed experiments, analyzed results, discussed and/or interpreted findings, supervised the study, and wrote the manuscript. DECLARATION OF INTERESTS The authors declare no competing interests. Received: December 26, 2017 Revised: June 18, 2019 Accepted: August 12, 2019 Published: September 17, 2019 REFERENCES Bellinger, D.L., Felten, S.Y., Lorton, D., and Felten, D.L. (1989). Origin of noradrenergic innervation of the spleen in rats. Brain Behav. Immun. 3, 291–311. Bellinger, D.L., Lorton, D., Felten, S.Y., and Felten, D.L. (1992). Innervation of lymphoid organs and implications in development, aging, and autoimmunity. Int. J. Immunopharmacol. 14, 329–344. Bergquist, J., Tarkowski, A., Ekman, R., and Ewing, A. (1994). Discovery of endogenous catecholamines in lymphocytes and evidence for catecholamine regulation of lymphocyte function via an autocrine loop. Proc. Natl. Acad. Sci. USA 91, 12912–12916. Bettelli, E., Pagany, M., Weiner, H.L., Linington, C., Sobel, R.A., and Kuchroo, V.K. (2003). Myelin oligodendrocyte glycoprotein-specific T cell receptor transgenic mice develop spontaneous autoimmune optic neuritis. J. Exp. Med. 197, 1073–1081. Bhowmick, S., Singh, A., Flavell, R.A., Clark, R.B., O’Rourke, J., and Cone, R.E. (2009). The sympathetic nervous system modulates CD4+FoxP3+ regula-

tory T cells via a TGF-beta-dependent mechanism. J. Leukoc. Biol. 86, 1275– 1283. Bodor, J., and Habener, J.F. (1998). Role of transcriptional repressor ICER in cyclic AMP-mediated attenuation of cytokine gene expression in human thymocytes. J. Biol. Chem. 273, 9544–9551. Bodor, J., Bodorova, J., and Gress, R.E. (2000). Suppression of T cell function: a potential role for transcriptional repressor ICER. J. Leukoc. Biol. 67, 774–779. Bodor, J., Feigenbaum, L., Bodorova, J., Bare, C., Reitz, M.S., Jr., and Gress, R.E. (2001). Suppression of T-cell responsiveness by inducible cAMP early repressor (ICER). J. Leukoc. Biol. 69, 1053–1059. Brum, P.C., Kosek, J., Patterson, A., Bernstein, D., and Kobilka, B. (2002). Abnormal cardiac function associated with sympathetic nervous system hyperactivity in mice. Am. J. Physiol. Heart Circ. Physiol. 283, H1838–H1845. Capellino, S., Weber, K., Gelder, M., Ha¨rle, P., and Straub, R.H. (2012). First appearance and location of catecholaminergic cells during experimental arthritis and elimination by chemical sympathectomy. Arthritis Rheum. 64, 1110–1118. Chelmicka-Schorr, E., Kwasniewski, M.N., and Wollmann, R.L. (1992). Sympathectomy augments adoptively transferred experimental allergic encephalomyelitis. J. Neuroimmunol. 37, 99–103. Chen, D., and Rothenberg, E.V. (1994). Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles. J. Exp. Med. 179, 931–942. Chruscinski, A.J., Rohrer, D.K., Schauble, E., Desai, K.H., Bernstein, D., and Kobilka, B.K. (1999). Targeted disruption of the beta2 adrenergic receptor gene. J. Biol. Chem. 274, 16694–16700. Cosentino, M., Fietta, A.M., Ferrari, M., Rasini, E., Bombelli, R., Carcano, E., Saporiti, F., Meloni, F., Marino, F., and Lecchini, S. (2007). Human CD4+CD25+ regulatory T cells selectively express tyrosine hydroxylase and contain endogenous catecholamines subserving an autocrine/paracrine inhibitory functional loop. Blood 109, 632–642. Flachenecker, P. (2007). Autonomic dysfunction in Guillain-Barre´ syndrome and multiple sclerosis. J. Neurol. 254 (Suppl 2), II96–II101. Flachenecker, P., Reiners, K., Krauser, M., Wolf, A., and Toyka, K.V. (2001). Autonomic dysfunction in multiple sclerosis is related to disease activity and progression of disability. Mult. Scler. 7, 327–334. Flierl, M.A., Rittirsch, D., Nadeau, B.A., Chen, A.J., Sarma, J.V., Zetoune, F.S., McGuire, S.R., List, R.P., Day, D.E., Hoesel, L.M., et al. (2007). Phagocytederived catecholamines enhance acute inflammatory injury. Nature 449, 721–725. Guereschi, M.G., Araujo, L.P., Maricato, J.T., Takenaka, M.C., Nascimento, V.M., Vivanco, B.C., Reis, V.O., Keller, A.C., Brum, P.C., and Basso, A.S. (2013). Beta2-adrenergic receptor signaling in CD4+ Foxp3+ regulatory T cells enhances their suppressive function in a PKA-dependent manner. Eur. J. Immunol. 43, 1001–1012. Hein, L., Altman, J.D., and Kobilka, B.K. (1999). Two functionally distinct alpha2-adrenergic receptors regulate sympathetic neurotransmission. Nature 402, 181–184. Herve´, J., Dubreil, L., Tardif, V., Terme, M., Pogu, S., Anegon, I., Rozec, B., Gauthier, C., Bach, J.M., and Blancou, P. (2013). b2-Adrenoreceptor agonist inhibits antigen cross-presentation by dendritic cells. J. Immunol. 190, 3163–3171. Josefsson, E., Ma˚nsson, J.E., Blennow, K., and Tarkowski, A. (1994). Immunomodulating and anti-inflammatory properties of the sympatholytic compound 6-hydroxydopamine. J. Neuroimmunol. 55, 161–169. Khoury, S.J., Healy, B.C., Kivisa¨kk, P., Viglietta, V., Egorova, S., Guttmann, C.R., Wedgwood, J.F., Hafler, D.A., Weiner, H.L., Buckle, G., et al. (2010). A randomized controlled double-masked trial of albuterol add-on therapy in patients with multiple sclerosis. Arch. Neurol. 67, 1055–1061. Kohm, A.P., and Sanders, V.M. (2001). Norepinephrine and beta 2-adrenergic receptor stimulation regulate CD4+ T and B lymphocyte function in vitro and in vivo. Pharmacol. Rev. 53, 487–525.

Cell Reports 28, 3120–3130, September 17, 2019 3129

Krause, D.S., and Deutsch, C. (1991). Cyclic AMP directly inhibits IL-2 receptor expression in human T cells: expression of both p55 and p75 subunits is affected. J. Immunol. 146, 2285–2296. Leonard, J.P., MacKenzie, F.J., Patel, H.A., and Cuzner, M.L. (1991). Hypothalamic noradrenergic pathways exert an influence on neuroendocrine and clinical status in experimental autoimmune encephalomyelitis. Brain Behav. Immun. 5, 328–338. Levy, B.H., and Tasker, J.G. (2012). Synaptic regulation of the hypothalamicpituitary-adrenal axis and its modulation by glucocorticoids and stress. Front. Cell. Neurosci. 6, 24. Madden, K.S., Sanders, V.M., and Felten, D.L. (1995). Catecholamine influences and sympathetic neural modulation of immune responsiveness. Annu. Rev. Pharmacol. Toxicol. 35, 417–448. Maestroni, G.J., and Mazzola, P. (2003). Langerhans cells beta 2-adrenoceptors: role in migration, cytokine production, Th priming and contact hypersensitivity. J. Neuroimmunol. 144, 91–99. Nakai, A., Hayano, Y., Furuta, F., Noda, M., and Suzuki, K. (2014). Control of lymphocyte egress from lymph nodes through b2-adrenergic receptors. J. Exp. Med. 211, 2583–2598. Nance, D.M., and Sanders, V.M. (2007). Autonomic innervation and regulation of the immune system (1987-2007). Brain Behav. Immun. 21, 736–745. Panina-Bordignon, P., Mazzeo, D., Lucia, P.D., D’Ambrosio, D., Lang, R., Fabbri, L., Self, C., and Sinigaglia, F. (1997). Beta2-agonists prevent Th1 development by selective inhibition of interleukin 12. J. Clin. Invest. 100, 1513–1519. Ramer-Quinn, D.S., Swanson, M.A., Lee, W.T., and Sanders, V.M. (2000). Cytokine production by naive and primary effector CD4+ T cells exposed to norepinephrine. Brain Behav. Immun. 14, 239–255. Riether, C., Kavelaars, A., Wirth, T., Pacheco-Lo´pez, G., Doenlen, R., Willemen, H., Heijnen, C.J., Schedlowski, M., and Engler, H. (2011). Stimulation of b2-adrenergic receptors inhibits calcineurin activity in CD4+ T cells via PKA-AKAP interaction. Brain Behav. Immun. 25, 59–66.

Schmittgen, T.D., and Livak, K.J. (2008). Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108. Shaked, I., Hanna, R.N., Shaked, H., Chodaczek, G., Nowyhed, H.N., Tweet, G., Tacke, R., Basat, A.B., Mikulski, Z., Togher, S., et al. (2015). Transcription factor Nr4a1 couples sympathetic and inflammatory cues in CNS-recruited macrophages to limit neuroinflammation. Nat. Immunol. 16, 1228–1234. Suzuki, K., Hayano, Y., Nakai, A., Furuta, F., and Noda, M. (2016). Adrenergic control of the adaptive immune response by diurnal lymphocyte recirculation through lymph nodes. J. Exp. Med. 213, 2567–2574. Takenaka, M.C., Araujo, L.P., Maricato, J.T., Nascimento, V.M., Guereschi, M.G., Rezende, R.M., Quintana, F.J., and Basso, A.S. (2016). Norepinephrine controls effector T cell differentiation through b2-adrenergic receptor-mediated inhibition of NF-kB and AP-1 in dendritic cells. J. Immunol. 196, 637–644. Tamir, A., and Isakov, N. (1994). Cyclic AMP inhibits phosphatidylinositolcoupled and -uncoupled mitogenic signals in T lymphocytes. Evidence that cAMP alters PKC-induced transcription regulation of members of the jun and fos family of genes. J. Immunol. 152, 3391–3399. Tsai, C.P., Lin, F.C., and Lee, C.T. (2014). Beta2-adrenergic agonist use and the risk of multiple sclerosis: a total population-based case-control study. Mult. Scler. 20, 1593–1601. Vang, T., Torgersen, K.M., Sundvold, V., Saxena, M., Levy, F.O., Ska˚lhegg, B.S., Hansson, V., Mustelin, T., and Taske´n, K. (2001). Activation of the COOH-terminal Src kinase (Csk) by cAMP-dependent protein kinase inhibits signaling through the T cell receptor. J. Exp. Med. 193, 497–507. Yanagawa, Y., Matsumoto, M., and Togashi, H. (2010). Enhanced dendritic cell antigen uptake via alpha2 adrenoceptor-mediated PI3K activation following brief exposure to noradrenaline. J. Immunol. 185, 5762–5768. Yoshida, N., Comte, D., Mizui, M., Otomo, K., Rosetti, F., Mayadas, T.N., Crispı´n, J.C., Bradley, S.J., Koga, T., Kono, M., et al. (2016). ICER is requisite for Th17 differentiation. Nat. Commun. 7, 12993.

Sanders, V.M., and Straub, R.H. (2002). Norepinephrine, the beta-adrenergic receptor, and immunity. Brain Behav. Immun. 16, 290–332.

Zoukos, Y., Kidd, D., Woodroofe, M.N., Kendall, B.E., Thompson, A.J., and Cuzner, M.L. (1994). Increased expression of high affinity IL-2 receptors and beta-adrenoceptors on peripheral blood mononuclear cells is associated with clinical and MRI activity in multiple sclerosis. Brain 117, 307–315.

Sanders, V.M., Baker, R.A., Ramer-Quinn, D.S., Kasprowicz, D.J., Fuchs, B.A., and Street, N.E. (1997). Differential expression of the beta2-adrenergic receptor by Th1 and Th2 clones: implications for cytokine production and B cell help. J. Immunol. 158, 4200–4210.

Zoukos, Y., Thomaides, T.N., Kidd, D., Cuzner, M.L., and Thompson, A. (2003). Expression of beta2 adrenoreceptors on peripheral blood mononuclear cells in patients with primary and secondary progressive multiple sclerosis: a longitudinal six month study. J. Neurol. Neurosurg. Psychiatry 74, 197–202.

3130 Cell Reports 28, 3120–3130, September 17, 2019

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Anti-mouse CD3e (145-2C11), Purified

eBioscience

Cat# 14-0031-86; RRID: AB_467051

Anti-mouse CD3e (145-2C11), PE-Cy7

eBioscience

Cat# 25-0031-82, RRID:AB_469572

Anti-mouse CD4 (RM4-5), APC

eBioscience

Cat# 17-0042-83 RRID:

Antibodies

Anti-mouse CD4 (RM4-5), PerCP-eFluor 710

eBioscience

Cat# 46-0042-82, RRID:AB_1834431)

Anti-mouse CD4 (RM4-5), PE

eBioscience

Cat# 12-0042-82, RRID:AB_465510

Anti-mouse CD8 (53-6.7), APC

eBioscience

Cat# 17-0081-83, RRID:AB_469336

Anti-mouse CD11b (M1/70), FITC

eBioscience

Cat# 11-0112-85, RRID:AB_464936

Anti-mouse CD11c (N418), PE

eBioscience

Cat# 12-0114-83, RRID:AB_465553

Anti-mouse CD16/32 (93), Purified

eBioscience

Cat# 14-0161-86, RRID:AB_467135

Anti-mouse CD19 (eBio1D3 (1D3)), PerCP-Cy5.5

eBioscience

Cat# 45-0193-82, RRID:AB_1106999

Anti-mouse CD25 (PC61.5), PE-Cy5

eBioscience

Cat# 15-0251-81, RRID:AB_468732

Anti-mouse CD28 (37.51), Purified

eBioscience

Cat# 16-0281-86, RRID:AB_468923

Anti-mouse CD45 (30-F11), PE

eBioscience

Cat# 12-0451-82, RRID:AB_465668

Anti-mouse CD45.1 (A20), PE-Cy7

eBioscience

Cat# 25-0453-82, RRID:AB_469629

Anti-mouse CD45.2 (104), APC-eFluor 780

eBioscience

Cat# 47-0454-82, RRID:AB_1272175)

Anti-mouse CD62L (MEL-14), PE

eBioscience

Cat# 12-0621-85, RRID:AB_465723

Anti-mouse CD86 (GL1), APC

eBioscience

Cat# 17-0862-82, RRID:AB_469419

Anti-mouse IFN-g (XMG1.2), APC

eBioscience

Cat# 17-7311-82, RRID:AB_469504

Anti-mouse IL-17A (eBio17B7), PE

eBioscience

Cat# 12-7177-81, RRID:AB_763582

Anti-mouse IL-4 (11B11), Purified

eBioscience

Cat# 16-7041-85, RRID:AB_469209

Anti-mouse TCR Vb11, PE

BD Biosciences

Cat# 553198, RRID:AB_394704

CD4+ T cell isolation kit

Miltenyi Biotec

Cat# 130-104-454

BD Difco

Cat# 231141

Brefeldin A Solution (1000X)

eBioscience

Cat# 00-4506-51

CellTraceTM Violet Cell Proliferation Kit

Invitrogen

Cat# C34557

CellTrace CFSE Cell Proliferation Kit

Invitrogen

Cat# C34554

Collagenase D

Roche

Cat# 11088858001

Fenoterol hydrobromide, ADRB2 agonist

Sigma-Aldrich

Cat# F1016-1G

Freund’s Adjuvant, Incomplete

Sigma-Aldrich

Cat# F5506

ICI 118,551 hydrochloride, ADRB2 antagonist

Sigma-Aldrich

Cat# I127

Intracellular Fixation & Permeabilization Buffer Set

eBioscience

Cat# 88-8824-00

Ionomycin calcium salt

Sigma-Aldrich

Cat# I3909

MOG35-55 peptide (MEVGWYRSPFSRVVHLYRNGK)

Proteimax

N/A

Percoll

Sigma-Aldrich

Cat# P1644-500ML

Pertussis toxin from Bordetella pertussis

Sigma-Aldrich

Cat# P7208

Phorbol 12-myristate 13-acetate (PMA)

Sigma-Aldrich

Cat# P8139

Recombinant Mouse GM-CSF Protein

R&D Systems

Cat# 415-ML

Bacterial and Virus Strains Mycobacterium tuberculosis extract H37 Ra Chemicals, Peptides, and Recombinant Proteins

Recombinant Mouse IL-2 Protein

R&D Systems

Cat# 402-ML

Recombinant Mouse IL-12 Protein

R&D Systems

Cat# 419-ML

[3H]thymidine

Amersham

N/A

SKF-86466 hydrochloride, ADRA2 antagonist

Sigma-Aldrich

Cat# 51563 (Continued on next page)

Cell Reports 28, 3120–3130.e1–e5, September 17, 2019 e1

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Ultrapure LPS

InvivoGen

Cat# tlrl-3pelps

cAMP Direct BioTrak EIA

GE Healthcare

Cat# RPN225

Corticosterone ELISA kit

Enzo Life Sciences

Cat# ADI-900-097

Mouse IL-2 ELISA Ready-SET-Go Kit

eBioscience

Cat# 88-7024-86, RRID:AB_2574950

Mouse IL-17A (homodimer) ELISA Ready-SET-Go Kit

eBioscience

Cat# 88-7371-86, RRID:AB_2575103

Mouse IFN gamma ELISA Ready-SET-Go Kit

eBioscience

Cat# 88-7314-86, RRID:AB_2575069

Critical Commercial Assays

Mouse IL-12 p70 ELISA Ready-SET-Go Kit

eBioscience

Cat# 88-7121-86, RRID:AB_2575017

Mouse GM-CSF ELISA Ready-SET-Go Kit

eBioscience

Cat# 88-7334-86, RRID:AB_2575086

BD Cytometric Bead Array (CBA) flex kit

BD

Cat# 560005

CEDEME/UNIFESP

N/A

Experimental Models: Organisms/Strains Mouse: C57BL/6
/


Brum et al., 2002

N/A

Mouse: Adrb2
/


Chruscinski et al., 1999

N/A

Mouse: Adrb2
/
B6 background

This paper

N/A

Mouse: 2D2

Bettelli et al., 2003

N/A

Mouse: Adra2ac

Mouse: Adrb2
/
CD45.1

This paper

N/A

Mouse: 2D2 Adra2ac
/


This paper

N/A

Mouse: 2D2 Adrb2
/


This paper

N/A

Mouse: 2D2 CD45.1

This paper

N/A

Mouse: CD45.1

CEDEME/UNIFESP

N/A

Mouse: Rag1
/


CEDEME/UNIFESP

N/A

Mouse: Adra2ac
/
Rag1
/


This paper

N/A

Gapdh Foward: 50 -AAATGGTGAAGGTCGGTGTG-30

Invitrogen

N/A

Gapdh Reverse: (50 -TGAAGGGGTCGTTGATGG-30

Invitrogen

N/A

Icer Forward: 50 -GCAGCACAATCAGCCGATGGTA-30

Invitrogen

N/A

Icer Reverse: 50 -AGCTCGGATCTGGTAAGTTGGC-30

Invitrogen

N/A

Il-2 Forward: 50 TGTGCTCCTTGTCAACAGCGCA 30

Invitrogen

N/A

Il-2 Reverse: 50 CAATTCTGTGGCCTGCTTGGGC 30

Invitrogen

N/A

FlowJo software, 9.8 version

Tree Star, Inc.

https://www.flowjo.com/

GraphPad Prism (version 5.0 for Windows)

GraphPad

https://www.graphpad.com/

Alzet

Cat# 0004317

Oligonucleotides

Software and Algorithms

Other Alzet osmotic pumps (Model 1002)

LEAD CONTACT AND MATERIALS AVAILABILITY Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Alexandre S. Basso ([email protected]). This study did not generate new unique reagents. EXPERIMENTAL MODEL AND SUBJECT DETAILS Female C57BL/6 mice at 7–8-week-old were used for all experiments. Adra2ac
/
deficient mice were generated as previously described (Hein et al., 1999) and backcrossed to C57BL/6 background (Brum et al., 2002). Adrb2
/
mice were previously described (Chruscinski et al., 1999) and backcrossed to C57BL/6 mice for ten generations at Centro de Desenvolvimento de Modelos Experimentais para Biologia e Medicina - CEDEME/UNIFESP. 2D2 TCR transgenic mice were previously generated (Bettelli et al., 2003) and were kindly provided by Dr. Howard L. Weiner, Center for Neurologic Diseases, Brigham and Women’s Hospital, Harvard Medical School. We generated Adrb2
/
2D2 and Adra2ac
/
2D2 by intercrossing. C57BL/6, CD45.1 and Rag1
/
mice were obtained

e2 Cell Reports 28, 3120–3130.e1–e5, September 17, 2019

in the CEDEME/UNIFESP. We bred Adrb2
/
and CD45.1 to obtain Adrb2
/
CD45.1 mice and Adra2ac
/
and Rag1
/
to generate Adra2ac
/
Rag1
/
mice. All mice were maintained under specific pathogen-free conditions in the animal facilities at the Federal ~o Paulo. This study was carried out in strict accordance with the recommendations in the Guide for the Care and University of Sa Use of Laboratory Animals of the Brazilian National Council of Animal Experimentation. All the protocols were approved by the Com~o Paulo. mittee on the Ethics of Animal Experimentation at the Federal University of Sa METHOD DETAILS Induction of EAE EAE was induced by subcutaneous immunization of C57BL/6J or Adra2ac
/
into the flanks with 200 mL of an emulsion containing 150 mg of MOG35–55 peptide (MEVGWYRSPFSRVVHLYRNGK; Proteimax, Brazil) and 400 mg of Mycobacterium tuberculosis extract H37 Ra (Difco) in incomplete Freund’s adjuvant oil (Sigma–Aldrich). In addition, the animals received 200 ng of pertussis toxin (Sigma– Aldrich) i.p. on day 0 and day 2. EAE in C57BL/6J or Adrb2
/
mice was induced by immunization with 100 mg of MOG35-55 peptide in complete Freund’s adjuvant (CFA). Chimeras were immunized with 50 mg of MOG35-55/CFA. Clinical signs of EAE were assessed according to the following score: 0, no signs of disease; 1, loss of tone in the tail; 2, hindlimb paresis; 3, hindlimb paralysis; 4, tetraplegia; 5, moribund. Preparation of CNS mononuclear cells In the EAE peak, mice were anaesthetized and perfused through the heart with cold PBS. Brain was dissected and spinal cords flushed out by hydrostatic pressure with PBS. Central nervous system tissue was cut into pieces and digested using collagenase D (2.5 mg/ml, Roche Diagnostics) at 37 C for 45 min. Mononuclear cells were isolated by passing the tissue through a cell strainer (70 mm), followed by a Percoll (Sigma–Aldrich) gradient (37%/70%) centrifugation at 900 g for 20 min with no break. Mononuclear cells were removed from the interphase, washed and suspended in PBS for FACS analysis. Flow cytometry analysis CNS mononuclear infiltrating cells were resuspended in FACS buffer. Cells were blocked with 0.5 mg of anti-mouse CD16/CD32 purified for 20 min at 4 C. After Fc blocking, cells were stained with anti-mouse CD4 APC, anti-mouse CD11b FITC and anti-mouse CD45 PE conjugated antibodies according to manufacturer’s specifications (eBioscience) for 20 min at 4 C. Cells were then washed and suspended in FACS buffer to acquisition in the FACS Canto II (BD Biosciences) and were analyzed by the FlowJo software, 9.8 version (Tree Star, Inc.). Proliferation index is defined as the total number of divisions divided by the number of cells that went into division. The proliferation index only takes into account the cells that underwent at least one division, that is, only responding cells are reflected in the proliferation index. Flow cytometry analysis of lymphoid organs Spleen and lymph nodes from WT or Adra2ac
/
mice were collected and disrupted in cell strainer (70 uM, BD bioscience). After Fc blocking (anti-CD16/32 purified), cells were stained with anti-mouse CD3 PE-Cy7 and anti-mouse CD19 PerCP-Cy5.5 for 20 min. Samples were washed with FACs buffer and analyzed by FACSCANTO II (BD bioscience). CD4+ and CD8+ T cells from peripheral blood Blood samples were submitted to hemolysis with ACK buffer and washed with PBS. After Fc blocking (anti-CD16/32 purified), cells were stained with anti-mouse CD4 PE and anti-mouse CD8a APC for 20 min. Samples were washed with FACs buffer and analyzed by FACSCANTO II (BD bioscience). Intracellular cAMP measurement by ELISA To measure intracellular cAMP levels, 3 3 105 naive T cells from WT or Adra2ac
/
mice were purified as described, treated for 15 min with the phosphodiesterase inhibitor IBMX (Sigma-Aldrich) followed by the indicated treatment. The cells were washed and incubated with lyses buffer for 10 min and cAMP measurement was performed using the Amersham cAMP Biotrak Enzyme Immunoassay System kit (GE Healthcare). Corticosterone measurement Blood was collected from WT and Adra2ac
/
and serum was used to measure corticosterone levels by ELISA kit (Enzo Life Sciences) following manufactures’ instructions. In vitro differentiation of Th1 cells Sorted naive T cells (CD4+CD62L+) from WT or Adra2ac
/
were cultured (3 3 105/well) in presence of 1 mg/mL of plate-bound antimouse CD3ε and 2 mg/mL of soluble anti-CD28. Th1 cells were differentiated in the presence of IL-12 (20 ng/mL), IL-2 (20 ng/mL) and anti-mouse IL-4 (5 mg/mL) for 5 days. All recombinant cytokines were purchased from R&D Systems and the neutralizing antibody from eBioscience.

Cell Reports 28, 3120–3130.e1–e5, September 17, 2019 e3

Intracellular cytokine staining For intracellular staining of cytokines, SNC mononuclear cells or in vitro differentiated Th1 cells were stimulated with 50 ng/mL PMA, 1 mM Ionomycin (Sigma–Aldrich) and Brefeldin A (eBioscience) for 4 h. After staining of surface CD4 and CD3, cells were fixed and made permeable using intracellular fixation/permeabilization buffer set (eBioscience) according to the manufacturer’s instructions. All antibodies to surface antigens (CD4 and CD3) and cytokines (IFN-g, IL-17A) were obtained from eBiosciences. Samples were acquired in FACSCanto II (BD Biosciences) and were analyzed by the software FlowJo, 9.8 version (Tree Star, Inc.). Generation of bone marrow–derived dendritic cells (DC) The generation of bone marrow-derived DC was previously described (Takenaka et al., 2016). Briefly, bone marrow cells of female mice (8–12 wk) were cultured with supplemented DMEM in the presence of 20 ng/ml GM-CSF (R&D Systems). At day 4, cells were fed with 1 mL of complete DMEM and 20 ng/ml GM-CSF. On day 7, medium was aspirated (0.5 mL) and 1 mL of fresh medium was added. On day 9, immature DCs (iDC) were obtained, and DCs were stimulated with ultrapure LPS (1 mg/mL, InvivoGen) for analysis of IL-12p70 production and pulsed with MOG35-55 peptide for proliferation experiments. In all experiments the differentiated of DCs was confirmed by flow cytometry (CD11c+ cells >95%) T cell activation and proliferation assays Cells were cultured in RPMI 1640 medium supplemented with 10% FBS, 50 mM b-mercaptoethanol, 1 mM sodium pyruvate, 1 mM nonessential amino acids, 2 mM GlutaMAX, 100 U/mL penicillin and 100 mg/mL streptomycin (GIBCOTM). Naive T cells (CD4+CD25-CD62L+) from WT or Adra2ac
/
were sorted (FACSAria II cell sorter, BD Biosciences) and stained with CellTraceTM Violet Cell Proliferation Kit (Invitrogen) according to manufacturer specifications. For antigen-specific proliferation assays, 2 3 105 sorted naive 2D2 T cells (CD4+CD25-CD62L+) from WT 2D2 or Adra2ac
/
2D2 were stained with CellTraceTM Violet and cocultured with 5 3 104 MOG35–55 (100 mg/mL) pulsed bone marrow dendritic cells from WT or Adra2ac
/
mice per well for 72 h. To analyze the proliferation in vivo, CD4+ T cells were purified (> 98% purity) from spleen and lymph nodes of 2D2 CD45.1 mice as CD4+ Vb11+ cells by using FACS Aria II (BD bioscience). Cells were labeled with 5 mM CFSE (Life Technology), and 5x105 cells were transferred into WT or Adra2ac
/
mice by i.v. injection. Recipients were immunized with 1x106 MOG35–55 (100 mg/mL) pulsed bone marrow dendritic cells from WT by s.c paw injection. After 60 hours following immunization, draining lymph nodes were harvested, stained with anti-CD45.1 PE-Cy7 (BD) and anti-CD4 APC (eBioscience), and analyzed on a FACSCanto II (BD Biosciences). Proliferation data were analyzed in the proliferation platform of FlowJo software (Tree Star Inc.) and presented as proliferation index. To measured proliferation during the recall ex vivo, draning lymph nodes cells were collected and platted (5x105 cells/well) in 96 wells round-bottom plates. Cells were stimulated or not with 10-100 mg/mL MOG35–55 for 72 hours. During the last 16 h, cells were pulsed with 1 mCi of [3H]thymidine (Amersham) followed by harvesting on glass fiber filters (FilterMate Universal Harvester, PerkinElmer) and analysis of incorporated [3H]thymidine in a b-counter (MicroBeta2 LumiJET, PerkinElmer). Cytokine measurement After 7 days of MOG35-55/CFA immunization, draining lymph nodes cells were obtained and platted (5x105 cells/well) in 96 wells round-bottom plates. Cultures were stimulated or not with 10 or 100 mg/mL MOG35–55 for 48 hours. Supernatants were collected and IL-2, IFN-g, IL-17A were measured by cytometric bead array (CBA Flex Set, BDTM Biosciences) and enzyme linked immunosorbent assay (ELISA, eBioscience) according to manufacturer’s protocol. For IL-12p70 measurement, bone-marrow DCs were stimulated or not with 1 mg/mL of ultrapure LPS (InvivoGen) for 18 hours. Cells were spun down, and the supernatant was collected and analyzed for IL-12p70 by ELISA (eBioscience) according to the manufacturer’s specifications. CD4+ T Cell Transfer CD4+ T cells from the spleen and lymph nodes of WT 2D2 or Adra2ac
/
2D2 mice were purified using CD4+ T cell isolation kit (Miltenyi Biotec) with the AutoMacs purification system (Miltenyi Biotec). Cells were washed in PBS and 1 3 106 cells were injected i.v. into Rag1
/
or Adra2ac
/
Rag1
/
mice. EAE immunizations occurred on the day following CD4+ transfer. Bone-marrow (BM) chimera For BM chimera generation, WT recipient mice were lethally irradiated with two doses of 550 rad given 3 hours apart. In the same day, recipients were injected i.v. with 2 3 106 BM cells isolated from donors (CD45.1 or Adrb2
/
CD45.1 mice) femur and tibia. BM recipients were then allowed to rest for 8 weeks before use. Pharmacological treatment A potent and specific beta2-adrenergic antagonist (ICI118,551; Sigma-Aldrich) were administered continuously by using Alzet osmotic pumps (Alzet) implanted s.c. Osmotic pumps were implanted 3 days before MOG35-55/CFA immunization for equilibration. ICI118,551 was administered (10 mg/kg/day) in saline/DMSO (1:1) and control mice received vehicle alone for a total of 10 days. A specific alpha2-adrenergic antagonist (SFK-86466, Sigma-Aldrich) was added (100 mM) to the MOG35-55/CFA emulsion for local pharmacological blockade of these receptors.

e4 Cell Reports 28, 3120–3130.e1–e5, September 17, 2019

qPCR Draining lymph node cells were collected 7 days after MOG35-55/CFA immunization and purified (CD3+CD4+) by FACSAria II (BD Bioscience). Total RNA was obtained by Trizol (Invitrogen) method following the manufacturer’s instructions. cDNA was synthesized with Superscript II reverse transcriptase kit (Invitrogen). Gene expression was evaluated by quantitative real-time PCR (qPCR) using the SybrGreen-based system of detection (Applied Biosystems) and the GAPDH gene as the reference for normalizations. Relative expression was calculated by DDCt method (Schmittgen and Livak, 2008). We used 3 animals per group in each experiment. Reactions were performed in triplicates and results are representative of at least 2 independent experiments. Primer sequences: Gapdh F (50 -AAATGGTGAAGGTCGGTGTG-30 ) and Gapdh R (50 -TGAAGGGGTCGTTGATGG-30 ); Icer F (50 -GCAGCACAATCAGCC GATGGTA-30 ) and Icer R (50 -AGCTCGGATCTGGTAAGTTGGC-30 ); Il-2 F (50 TGTGCTCCTTGTCAACAGCGCA 30 ) and Il-2 R (50 CAATTCTGTGGCCTGCTTGGGC 30 ), from Invitrogen. QUANTIFICATION AND STATISTICAL ANALYSIS Data are represented as mean ± SEM. For qPCR results data are represented as mean ± SD. Statistical differences between groups was carried out using the unpaired Student’s t test, One-way ANOVA or Two-way ANOVA, followed by the Bonferroni test, where appropriate. p˂0.05 were considered statistically significant. Statistical analysis was performed using GraphPad Prism version 5.0 for Windows (GraphPad Software). DATA AND CODE AVAILABILITY All software used are available on-line from a commercial supplier and are summarized in the Key Resources table. No new software was written for this project.

Cell Reports 28, 3120–3130.e1–e5, September 17, 2019 e5