The therapeutic potential of recombinant BCG expressing the antigen S1PT in the intravesical treatment of bladder cancer

Urologic Oncology: Seminars and Original Investigations 28 (2010) 520 –525

Original article

The therapeutic potential of recombinant BCG expressing the antigen S1PT in the intravesical treatment of bladder cancer夡 Priscila M. Andrade, M.D., Ph.D.a,*, Daher C. Chade, M.D.a, Ricardo C. Borra, Ph.D.b, Ivan P. Nascimento, Ph.D.c, Fabiola E. Villanova, Ms.a, Luciana C. C. Leite, Ph.D.c, Enrico Andrade, M.D., Ph.D.a, Miguel Srougi, M.D., Ph.D.a a

Laboratory of Medical Investigation (LIM55) of the Division of Urology, University of Sao Paulo, Sao Paulo, Brazil b Ibirapuera University, Sao Paulo, Brazil c Laboratory of Molecular Biotechnology IV, Butantan Institute, Sao Paulo, Brazil Received 9 August 2008; received in revised form 17 December 2008; accepted 18 December 2008

Abstract Purpose: Bacillus Calmette-Guerin (BCG) continues to be employed as the most effective immunotherapy against superficial bladder cancer. We have developed an rBCG-S1PT strain that induces a stronger cellular immune response than BCG. This preclinical study was designed to test the potential of rBCG-S1PT as an immunotherapeutic agent for intravesical bladder cancer therapy. Materials and methods: A tumor was induced in C57BL/6 mice after chemical cauterization of the bladder and inoculation of the tumor cell line MB49. Next, mice were treated by intravesical instillation with BCG, rBCG-S1PT, or PBS once a week for 4 weeks. After 35 days, the bladders were removed and weighed, Th1 (IL-2, IL-12, INOS, INF-␥, TNF-␣), and Th2 (IL-5, IL-6, IL-10, TGF-␤) cytokine mRNA responses in individual mice bladders were measured by quantitative real time PCR, and the viability of MB49 cells in 18-hour coculture with splenocytes from treated mice was assessed. In an equivalent experiment, animals were observed for 60 days to quantify their survival. Results: Both BCG and rBCG-S1PT immunotherapy resulted in bladder weight reduction, and rBCG-S1PT increased survival time compared with the control group. There were increases in TNF-␣ in the BCG treated group, as well as increases in TNF-␣ and IL-10 mRNA in the rBCG-S1PT group. The viability of MB49 cells cocultured with splenocytes from rBCG-S1PT-treated mice was lower than in both the BCG and control groups. Conclusions: rBCG-S1PT therapy improved outcomes and lengthened survival times. These results indicate that rBCG could serve as a useful substitute for wild-type BCG. © 2010 Elsevier Inc. All rights reserved. Keywords: Immune response; rBCG-S1PT; Bladder cancer

1. Introduction In 1976, Morales et al. [1] reported, for the first time, on the successful intravesical use of Mycobacterium bovis BCG as an adjuvant treatment option for superficial bladder cancer following transurethral resection. Although the exact mechanism by which BCG mediates antitumor immunity remains unclear, a local, nonspecific immunological reaction reflecting various activities of immune cells has been 夡 This work was supported by a grant from The State of Sao Paulo Research Foundation-FAPESP. * Corresponding author. Tel.: ⫹55-11-3069-8080; fax: ⫹55-11-30617183. E-mail address: [email protected] (P.M. Andrade).

1078-1439/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.urolonc.2008.12.017

suggested [2,3]. One of the remarkable phenomena observed after BCG bladder instillation is a transient secretion of several cytokines into patients’ voided urine. Among these, a massive burst of urinary IFN-␥, along with other Th1 cytokines (IL-12 and IL-2), has been observed to be a common feature in BCG responders. In contrast, higher levels of the Th2 cytokines IL-10 and/or IL-6 appear to be associated with BCG failure therapy [4,5]. Correspondingly, in mouse models, IFN-␥ and IL-12, but not IL-10 and IL-4, are suggested to be required for immunotherapeutic control of orthotopic bladder cancer [6]. These observations suggest that effective BCG therapy of bladder cancer requires proper activation of the Th1 immune response [7]. Despite several clear advantages of BCG immunotherapy for the treatment of bladder cancer, several problems

P.M. Andrade et al. / Urologic Oncology: Seminars and Original Investigations 28 (2010) 520 –525

and limitations compromise its use. Currently, 30% to 40% of patients still do not respond to this line of treatment. Therefore, current studies aim at developing rBCG strains to further improve the effectiveness of the therapy [8,9]. Nascimento et al., [10] constructed an rBCG strain expressing the genetically detoxified rBCG-S1PT, in fusion with the signal sequence and under the control of the upregulated Mycobacterium fortuitum ␤-lactamase promoter. These authors have demonstrated that this new vaccine is able to elicit a stronger Th1-driving effect on the immune response induced against mycobacterial proteins than the wild BCG strain [10]. Therefore, we propose here an evaluation and comparison of the immune responses of orthotopic bladder cancer in an animal model using rBCG-S1PT and BCG.

521

2.4. Orthotopic tumor implantation Experiment I: Six- to 8-week-old female C57BL/6 mice (n ⫽ 60) were placed under general anesthesia by i.p. injection of a mixture of xylazine and ketamine (0.1 ml/10 g). A 24-gauge Teflon i.v. catheter (Nipro Medical Ltd., Sorocaba, Brazil) was then inserted into the bladder through the urethra using an inert lubricant (sterile contact gel). Next, in order to prepare the bladder for tumor implantation, a chemical lesion on the bladder wall was made by intravesical instillation of 0.3M AgNO3 (8 ␮l). This promoted an adequate and controlled diffuse bladder wall cauterization. After 10 seconds, the contents were washed out by transurethral infusion of phosphate buffered saline (PBS). Finally, a suspension of 2 ⫻ 105 viable tumor cells was instilled into the bladder. 2.5. BCG treatment

2. Materials and methods 2.1. Animals All animal care and experimental procedures were performed in accordance with the 1996 Guide for the Care and Use of Laboratory Animals and approved by the Committee on Ethics Animal Research of the Medical Faculty of University of Sao Paulo, Brazil. All mice were kept under pathogen-free conditions.

Experiment I: Twenty-four hours following tumor implantation, intravesical BCG therapy was initiated. Mice were randomly assigned to either a control group (receiving PBS) or 2 treatment groups (BCG or rBCG-S1PT). The BCG doses used were 1 ⫻ 106 CFU/mouse once a week for 1 month, given perurethrally in a volume of 100 ␮l while the mice were lightly anesthetized. Experiment II: identical to Experiment I, but where the animals (n ⫽ 60) were observed for 60 days to quantify their survival. 2.6. Assessment of tumors

2.2. BCG In the all experiments, the BCG strain Moreau and rBCG-S1PT, kindly provided by Dr. Luciana C.C. Leite (Butantan Institute), were prepared according to procedures previously described [10]. Briefly, growth cultures of both BCG and rBCG-S1PT were carried out under uniform conditions in Middlebrook 7H9 medium supplemented with albumin dextrose-catalase broth, incubated at 37°C with 5% CO2 and shaken continuously. Bacteria were harvested by centrifugation at 2700 ⫻ g using model 5810R (Eppendorff, Rexdale, Ontario), washed in aliquots and stored at ⬃80°C until use. Aliquots were thawed and colony forming units (CFU) were determined before use by plating onto Middlebrook 7H10 plates. 2.3. Tumor cell line The murine transitional cell carcinoma cell line MB49 (MB49) was a kind gift from Dr. Yi Lou (University of Iowa, USA). The cells were cultured at 37°C and 5% CO2 in RPMI 1640 medium supplemented with 10% FBS (Cultilab, Sao Paulo, Brazil), 100 U/ml penicillin and 100 ␮g/ml streptomycin. Tumor cells were harvested by trypsinization and suspended in RPMI 1640 without FBS or antibiotics.

The mice were evaluated on a daily basis for viability and gross hematuria. After 35 days, the animals (Experiment I) were sacrificed by CO2 inhalation, and each bladder with tumor implantation after removal was opened and weighed. After 60 days, the surviving mice (Experiment II) were sacrificed and examined macroscopically to check for the presence of intravesical tumors; those animals without tumors were excluded from analysis. 2.7. Determination of cytokine mRNA expression by Q-PCR Total RNA was extracted from the bladder using Trizol (GIBCO/BRL Life Technologies, Inc., Grand Island, NY) according to the manufacturer’s recommendations, and further purified with RNeasy columns (Qiagen Inc., Valencia, CA). All samples for controls, BCG, and BCG-S1PT were co-processed to eliminate technical variations. Reverse transcription of 1 ␮g of RNA into cDNA was performed using SuperScript III reverse transcriptase (Invitrogen Corp., Carlsbad, CA) after DNAse treatment (Qiagen Inc.). The real-time PCR primers for Th1 (INF-␥, IL-2, IL12, INOS, and TNF-␣), and Th2 (TGF-␤, IL-10, IL-5 and IL-6) described in Table 1 were synthesized by IDT (Coralville, IA). Quantitative PCR was performed on an Applied Biosystems

522

P.M. Andrade et al. / Urologic Oncology: Seminars and Original Investigations 28 (2010) 520 –525

Table 1 Q-PCR primers IL2 R TCCAGAACATGCCGCAGAG F CCTGAGCAGGATGGAGAATTACA IL5 R TCC AAT GCA TAG CTG GTG ATT T F AGC ACA GTG GTG AAA GAG ACC TT IL12p40 R AAC TTG AGG GAG AAG TAG GAA TGG F GGA AGC ACG GCA GCA GAA TA iNOS R CAT TGG AAG TGA AGC GTT TCG F CAG CTG GGC TGT ACA AAC CTT TGF-␤ R GGT TCA TGT CAT GGA TGG TGC F TGA CGT CAC TGG AGT TGT ACG G TNF-␣ R CAT CTT CTC AAA ATT CGA GTG ACA A F TGG GAG TAG ACA AGG TAC AAC CC INF-␥ F TCA AGT GGC ATA GAT GTG GAA GAA R TGG CTC TGC AGG ATT TTC ATG IL10 F GGT TGC CAA GCC TTA TCG GA R ACC TGC TCC ACT GCC TTG CT IL6 F CTG CAA GAG ACT TCC ATC CAG TT R GAA GTA GGG AAG GCC GTG G GAPDH F CAA CTC ACT CAA GAT TGT CAG CAA R GGC ATG GAC TGT GGT CAT GA

7500 Real Time PCR System (Applied Biosystems Inc., Foster City, CA). The reaction mixture contained SYBR Green PCR Master mix (Applied Biosystems), 0.5 ␮mol/␮l of forward and reverse primer and 1 ␮l of cDNA, in a total volume of 10 ␮l. Thermocycling conditions were 50°C for 2 minutes, 95°C for 10 minutes, and 40 cycles of [95°C/15 s; 60°C/1 min]. In order to normalize for inefficiencies in cDNA synthesis and RNA imputed amounts, GAPDH mRNA expression was used. After the PCR was performed, a dissociation/melting curve was constructed in the range of 60 –95°C. Data were analyzed using the comparative Ct method (⌬⌬Ct method) using the following formula: ⌬Ct ⫽ Ct (target) – Ct (normalized, GAPDH). The comparative ⌬⌬Ct calculation involved finding the difference between ⌬Ct of BCG and BCG-S1PT group and the mean value of the ⌬Ct from the control for each analyzed transcript. The fold increase in the expression of specific mRNA in BCG groups compared with normal controls was calculated as 2(⫺⌬⌬Ct) [11]. 2.8. Splenocyte-MB49 coculture assay Confluent monolayer adherent MB49 cells (1 ⫻ 105 cells), grown in RPMI 1640 medium supplemented with 10% of serum fetal bovine, 100 U/ml of penicillin, 100 ug/ml of streptomycin, and maintained at 37oC in a 5% CO2

atmosphere, were trypsinized. After cell integrity was confirmed by trypan blue exclusion (⬎90%), cells were seeded in a 48-well tissue culture microplate and incubated for 24 hours. Spleens were removed from 4 mice of each group, homogenized, and passed through a 70 ␮M cell strainer (BD Falcon, Bedford, MA). Pooled cells for each group (SF, BCG, and S1PT) were washed twice in cold 1⫻ PBS without Mg⫹2 and CA⫹2 and cocultured in triplicate with MB49 at ratios of 10:1 or 50:1 for 18 hours. Cytotoxicity assays were performed with Alamar Blue (Biosource, Carlsbad, CA) [12]. Half the media volume was substituted with fresh media containing 20% Alamar Blue. The cells were then incubated with Alamar Blue (final concentration 10%) for 4 hours, and the reduction level of solution (OD 570 – 600 nm) was measured by the monochromator microplate reader SpectraMax 340PC (Molecular Devices, Sunnyvale, CA). As controls, simple cultures of splenocytes from each group, as well as intact and dead MB49 cells, were employed. As a 0% viability control, Triton X-100 was added to MB49 cells (1% of final concentration) 30 minutes before changing the medium. The viability of MB49 was calculated in accordance with the following equation: viability ⫽ (MBSp ⫺ Sp ⫺ MBD)/(MBL ⫺ MBD) when MBSp ⫽ OD (570 ⫺ 600 ␩m) from MB49 ⫹ splenocyte co-culture wells, MBL ⫽ OD (570 ⫺ 600 ␩m) from live MB49 simple culture wells, MBD ⫽ OD (570 ⫺ 600 ␩m) from dead MB49 simple culture wells and Sp ⫽ OD (570 ⫺ 600 ␩m) from splenocyte simple culture wells [13]. 2.9. Statistical analysis The differences in relative cytokine gene expression, viability indices, and bladder weights between groups were analyzed by the Kruskal-Wallis test, ANOVA, and the Student-Newman-Keuls test for all pairwise comparisons. The survival curve was analyzed using the Kaplan-Meier test. Statistical significance was considered to be P ⬍ 0.05, and MedCalc 9.3 statistical software (Mariakerke, Belgium) was employed in all analyses.

3. Results 3.1. Bladder weight In the animals of Experiments I and II that received instillation of MB49 cells, 106 (88,3%) developed intravesical tumors after the 15-day period. At that time there was massive growth of a solid tumor inside the bladder. The mice without tumor implantation were detached from the experiment. Bladders from mice of Experimental I were weighed after 1-month of treatment. The difference between groups was analyzed by one-way ANOVA (P ⬍ 0.01) and the Student-Newman-Keuls test for all pairwise comparisons, after log data transformation. The mean weight (mg) of the SF

P.M. Andrade et al. / Urologic Oncology: Seminars and Original Investigations 28 (2010) 520 –525

Fig. 1. Weight (mg) of bladders inoculated with MB49 tumor cells from mice instilled weekly with BCG (n ⫽ 17), S1PT (n ⫽ 18), or saline (n ⫽ 17) after 4 weeks of treatment. The mean weight of the SF group was 230 ⫾ 110, the BCG group was 137 ⫾ 87, and the S1PT group was 93 ⫾ 50. P ⬍ 0.05 was considered statistically significant. Values were obtained from 3 independent experiments.

group was 230 ⫾ 110, of the BCG group was 137 ⫾ 87, and of the S1PT group was 93 ⫾ 50. Values were obtained from 3 independent experiments (Fig. 1). 3.2. Expression of cytokine Th1/Th2 mRNA by Q-PCR Mice treated with rBCG-S1PT showed induction of significantly increased levels of TNF-␣ and IL-10 mRNA. Equivalently, mice treated with BCG had an increased level of TNF-␣ compared with the control group (Fig. 2). 3.3. Splenocyte-MB49 coculture assay The viability of MB49 tumor cells after 18 hours of coculture with splenocytes from mice treated with S1PT

523

Fig. 3. Viability of MB49 (2.5 ⫻ 105) tumor cells after 18 hours of co-culture with 2 different proportions (1:10 and 1:50) of splenocytes from mice treated weekly with BCG (n ⫽ 4), S1PT (n ⫽ 4), or saline (n ⫽ 4) during 4 weeks. The data were analyzed by two-way analysis of variance (P ⬍ 0.05). The bars represent the mean ⫾ SEM.

(proportion 1:50) was significantly lower than that of those treated with BCG or control (Fig. 3). 3.4. Effect of immunotherapy on survival time Mice were inoculated with MB49 (2 ⫻ 105) tumor cells and were treated weekly with BCG (n ⫽ 15), S1PT (n ⫽ 16) or saline (n ⫽ 19) for 1 month. The difference between groups was analyzed by one-way ANOVA (P ⬍ 0.01) and the Student-Newman-Keuls test for all pairwise comparisons. The mean survival time for the SF group was 30 ⫾ 7 days, for the BCG group it was 29 ⫾ 7 days, and for the S1PT group it was 41 ⫾ 10 days (Fig. 4). The beginning of the gross hematuria for control mice was at 14 ⫾ 7 days, for BCG-treated mice it was the 9 ⫾ 4 days, and for S1PT-treated mice it was the 14 ⫾ 7 days (Fig. 5).

4. Discussion

Fig. 2. Relative cytokine gene expression of the bladder from mice challenged with MB49 tumor cells and treated with PBS (white bar), BCG (gray bar), or rBCG-S1PT (black bar) as determined by real time PCR. Data were expressed as mean values ⫾ SEM calculated from 10 different mice.

Bladder cancer is a unique cancer with a profound response to the immunostimulatory properties of BCG, which has been shown to exhibit antitumor effects [14]. Intravesical instillation with BCG, the most successful immunotherapy for superficial bladder cancer to date, induces a variety of proinflammatory cytokines. Although the mechanism of the antitumor effects of BCG has not been completely defined, it is generally accepted that intravesical BCG instillation causes nonspecific stimulation of the immune system, which induces local infiltration of the bladder wall by activated T cells. Intravesical BCG instillation predominantly induces a type-I helper T response in bladder patients [3]. In the present study, we evaluated 5 interleukins that characterize the Th1 immune response, and 4 that charac-

524

P.M. Andrade et al. / Urologic Oncology: Seminars and Original Investigations 28 (2010) 520 –525

Fig. 4. (A) Survival curve from mice (n ⫽ 60) challenged with 5 ⫻ 104 MB49 tumor cells and treated with PBS (solid line), BCG (doted line), or rBCG-S1PT (dashed line). (B) Survival curves were analyzed by the Kaplan-Meier Statistical test (P ⫽ 0.07).

terize the Th2 response. The proinflammatory cytokines revealed a pattern in both immunotherapies tested. BCG and rBCG-S1PT showed a tendency toward Th1 polarization, considering the increased levels of TNF-␣ in both groups, thus characterizing the acute immune response pattern unleashed by a bacillus. In this study, we observed that IL-10 mRNA was increased in the BCG-S1PT group, and this interleukin is considered essential in immune responses towards a Th2 milieu and/or inhibition of Th1 cytokines. IL-10 is also important in the down-regulation of delayed-type hypersen-

Fig. 5. Beginning of hematuria (days) in bladders inoculated with MB49 (2 ⫻ 105) tumor cells from mice instilled weekly with BCG (n ⫽ 15), S1PT (n ⫽ 16), or saline (n ⫽ 19) after 4 weeks of treatment. The differences between groups were analyzed by the Kruskal-Wallis test (P ⫽ 0.038) and Mann-Whitney pairwise comparisons. The mean time of the SF group was 14 days ⫾ 7 days, for the BCG group it was 9 ⫾ 4 days, and for the S1PT group it was 14 ⫾ 7 days. P ⬍ 0.05 was considered statistically significant.

sitivity (DHT) [6]. The highest TNF-␣ level was observed in the rBCG-S1PT group, characteristic of the acute immune response to a bacillus. Furthermore, bladder tumors involve the immune response in regard to its cytokine release. The experimental bladder tumor cell line MB49 does not produce IL-10, which suggests that its release is a result of local stimulation. We speculate that the increased level of IL-10 in this group could be a counterbalance, modulating the intense response of TNF-␣ [15]. The cytotoxicity assays used here showed that the splenocytes from mice treated with rBCG-S1PT were most effective in destroying MB49 tumor cells. It is likely that the profile of cytokines secreted during contact of rBCG-S1PT with immune competent cells favored the major production and/or activation of BCG-activated lymphocytes or other effector cells. In 2006, Luo [16] studying the role of Th1stimulating cytokines in BCG-induced macrophage cytotoxicity, showed that TNF-␣ appeared to play the most vital role in macrophage cytotoxicity against mouse bladder cancer MBT-2 cell targets. In our experiments, the expression of TNF-␣ in bladders of mice submitted to rBCG-S1PT was higher than in both the control and BCG groups. The findings also showed an adequate therapeutic effect of rBCG-S1PT by significantly reducing the mean bladder tumor weight and showed an increase in the survival curve compared with the BCG and control groups. In the experiment using 2 ⫻ 105 viable tumor cells, the survival of BCG-treated mice was no different from the control. It is likely that the number of tumor cells here was too high to allow any benefit in terms of survival time, although the analysis of bladder weight showed a better outcome in comparison with controls. In another experiment using a lower number of cells, 5 ⫻ 104 viable tumor cells (data not shown), BCG group had a survival curve better than the controls, but was still lower than rBCG-S1PT. The gross hematuria of BCG appeared before both the control and

P.M. Andrade et al. / Urologic Oncology: Seminars and Original Investigations 28 (2010) 520 –525

rBCG-S1PT groups (P ⬍ 0.05), where the latter 2 were similar. There was a significant delay to observe hematuria in the rBCG-S1PT group. However, this finding may not be related directly to depth of tumor invasion, considering the insufficient data of hematuria as a prognostic factor in bladder cancer. Consequently, our understanding on this matter was only as an additional data about the follow-up of the animal model after tumor implantation. In the clinical management of bladder cancer, hematuria is commonly intermittent and is not a reliable source of information about the tumor stage or other urinary tract disease as the primary cause, leading to a continuous search for biomarkers to be included in early diagnosis screening or as predictors of outcome [17].

[6]

[7]

[8]

[9]

[10]

5. Conclusion

[11]

In summary, these results indicate that rBCG-S1PT could serve as a useful substitute for wild-type BCG.

[12]

[13]

References [1] Morales A, Eidinger D, Bruce AW. Intracavitary bacillus CalmetteGuerin in the treatment of superficial bladder tumors. J Urol 1976; 116:180 –3. [2] Mungan NA, Witjes JA. Bacille Calmette-Guerin in superficial transitional cell carcinoma. Br J Urol 1998;82:213–23. [3] Bohle A, Brandau S. Immune mechanisms in bacillus CalmetteGuerin immunotherapy for superficial bladder cancer. J Urol 2003; 170:964 –9. [4] Herr HW, Schwalb DM, Zhang ZF, et al. Intravesical bacillus Calmette-Guerin therapy prevents tumor progression and death from superficial bladder cancer: 10-year follow-up of a prospective randomized trial. J Clin Oncol 1995;13:1404 – 8. [5] Sylvester RJ, van der MA, Lamm DL. Intravesical bacillus CalmetteGuerin reduces the risk of progression in patients with superficial

[14]

[15]

[16]

[17]

525

bladder cancer: A meta-analysis of the published results of randomized clinical trials. The J Urol 2002;168:1964 –70. Ratliff TL. Role of animal models in understanding intravesical therapy with bacille Calmette-Guerin. Clin Infect Dis 2000;31(Suppl 3):S106 – 8. Ratliff TL, Ritchey JK, Yuan JJ, et al. T-cell subsets required for intravesical BCG immunotherapy for bladder cancer. J Urol 1993; 150:1018 –23. Lee CF, Chang SY, Hsieh DS, et al. Immunotherapy for bladder cancer using recombinant bacillus Calmette-Guerin DNA vaccines and interleukin-12 DNA vaccine. J Urol 2004;171:1343–7. Luo Y, Yamada H, Chen X, et al. Recombinant Mycobacterium bovis bacillus Calmette-Guerin (BCG) expressing mouse IL-18 augments Th1 immunity and macrophage cytotoxicity. Clin Exp Immunol 2004;137:24 –34. Nascimento IP, Dias WO, Mazzantini RP, et al. Recombinant Mycobacterium bovis BCG expressing pertussis toxin subunit S1 induces protection against an intracerebral challenge with live Bordetella pertussis in mice. Infect Immun 2000;68:4877– 83. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C{T}) method. Methods (San Diego) 2001;25:402– 8. Nociari MM, Shalev A, Benias P, et al. A novel one-step, highly sensitive fluorometric assay to evaluate cell-mediated cytotoxicity. J Immunol Methods 1998;213:157– 67. Ahmed SA, Gogal RM Jr., Walsh JE. A new rapid and simple nonradioactive assay to monitor and determine the proliferation of lymphocytes: An alternative to [3H]thymidine incorporation assay. J Immunol Methods 1994;170:211–24. O’Donnell MA, Luo Y, Hunter SE, et al. Interleukin-12 immunotherapy of murine transitional cell carcinoma of the bladder: Dosedependent tumor eradication and generation of protective immunity. J Urol 2004;171:1330 –5. Daftarian PM, Kumar A, Kryworuchko M, et al. IL-10 production is enhanced in human T cells by IL-12 and IL-6 and in monocytes by tumor necrosis factor-␣. J Immunol 1996;157:12–20. Luo Y, Yamada H, Evanoff DP, et al. Role of Th1-stimulating cytokines in bacillus Calmette-Guerin (BCG)-induced macrophage cytotoxicity against mouse bladder cancer MBT-2 cells. Clin Exp Immunol 2006;146:181– 8. Bruins HM, Stein JP. Risk factors and clinical outcomes of patients with node-positive muscle-invasive bladder cancer. Expert Rev Anticancer Ther 2008;8(7):1091–101.