The Tousled gene in A. thaliana encodes a protein kinase homolog that is required for leaf and flower development

Cell, Vol. 75, 939-950,

December

3, 1993, Copyright

0 1993 by Cell Press

The Tousled Gene in A. Thaliana Encodes a Protein Kinase Homolog That Is Required for Leaf and Flower Development Judith L. Roe,* Carol J. Rivin,t R. Allen Sessions,* Kenneth A. Feldmann,S and Patricia C. Zambryski’ *Department of Plant Biology University of California Berkeley, California 94720 tDepartment of Botany and Plant Pathology Oregon State University Corvallis, Oregon 97331 *Department of Plant Sciences University of Arizona Tucson, Arizona 85721

Summary Mutation at the TOUSLED locus of A. thaliana results in a complex phenotype, the most dramatic aspect of which being the abnormal flowers produced in mutant plants. tsl flowers show a random loss of floral organs, and organ development is impaired. The TSL gene appears to be required in the floral meristem for correct initiation of floral organ primordia and for properdevelopment of organ primordia. Loss of TSL function also affects flowering time and leaf morphology. Using a mutation derived by T-DNA insertion mutagenesis, we have cloned the TSL gene and found that it encodes a protein kinase homolog with a novel N-terminal domain. This protein kinase gene identifies a novel signaling/regulatory pathway used during development in Arabidopsis. Introduction Development in higher plants results from the continued activities of the shoot and root meristems formed in the plant embryo. The vegetative meristem produces leaves and axillary meristems. In many species, the process of floral induction converts the shoot apical meristem into an infiorescence meristem, which then produces floral meristems (Bernier, 1988). The perianth and reproductive organs are formed on these determinate floral meristems in a species-specific array. How cells within each type of meristem coordinate their growth and differentiation during the initiation and development of organs is a central question in plant biology. Furthermore, the mechanisms controlling the pattern of formation of organs are largely unknown. Recent studies utilizing mutations in Arabidopsis thaliana and Antirrhinum majus have identified a number of genes important for meristem and organ development. The study of these genes has revealed that the development of a plant meristem is controlled by the expression of regulatory genes that act in combination to direct major developmental programs. The meristem identity genes promote or maintain the identity of each type of meristem (reviewed by Coen, 1992; Coen and Carpenter, 1993; Jack et al., 1993). Mutations in floral organ identity genes result

in homeotic tranformations of floral organ types in mutant flowers (reviewed by Haughn and Somerville, 1988; Schwarz-Sommer et al., 1990; Coen, 1991; Coen and Meyerowitz, 1991; Jack et al., 1993). In both Arabidopsis and Antirrhinum, the floral organ identity (or homeotic) genes cloned to date all encode members of the MADS box (MCMl agamous deficiens serum response factor) family of transcription factors (Sommer et al., 1990; Yanofsky et al., 1990; Jack et al., 1992; Mandel et al., 1992; Trobner et al., 1992; Bradley et al., 1993). These MADS box genes are expressed early in floral development within restricted regions of the floral meristem, where they are presumably involved in controlling the transcription of genes required during organogenesis of the different floral organs (Yanofsky et al., 1990; Bowman et al., 1991a; Drews et al., 1991; Jack et al., 1992; Schwarz-Sommer et al., 1992; Trobner et al., 1992; Bradley et al., 1993). Some play a dual role and also participate in the control of meristem identity (Shannon and Meeks-Wagner, 1993; reviewed by Coen and Carpenter, 1993). The overlapping expression of the different homeotic genes in regionalized combinations within the developing flower appears to determine floral organ fate in both Arabidopsis and Antirrhinum. The localized expression patterns of these genes is controlled in part by the homeotic genes themselves (Drews et al., 1991; Jack et al., 1992; Schwarz-Sommer et al., 1992; Trobner et al., 1992) and by other regulatory genes (Schultz et al., 1991; Bowman et al., 1992). In addition to these two classes, a number of mutations have phenotypes that suggest that their corresponding genes may participate in diverse activities, such as the control of meristem size, meristem architecture, and pattern formation. For example, a set of mutations in Arabidopsis displaying enlarged meristems may identify genes that regulate meristem size in the wild-type plant (Leyser and Furner, 1992; Medford et al., 1992). Other mutations display highly abnormal morphology of the shoot apical meristem and of the leaves (Medford et al., 1992). Both the leaves and the flowers can be affected in both the above types of mutations, suggesting that some processes are common to both vegetative and floral meristem development. We will describe the cloning of the TOUSLED (EL) gene encoding a protein kinase homolog in Arabidopsis required for both leaf and flower development. Recent studies have begun to provide insight into the role of protein kinases in plant development. For example, expression patterns of c&2 suggest that it plays a key role in proliferation of cells within the meristem during organogenesis (Martinez et al., 1992). In addition, a number of transmembrane receptor-like kinases also have been identified (reviewed by Ma, 1993) that may participate in cell-cell interactions. For example, the S locus receptor kinase has been directly implicated in the recognition of pollen by cells in the stigma in a self-incompatible species of Brassica (Goring et al., 1993). The tousled (tsf) mutation characterized here identifies

Cell 940

Figure 1. Phenotype

of the tsl Mutation and Complementation

of the Mutation with a Wild-Type

TSL Gene

(A) Wild-type A. thaliana third rosette leaf (left) and Is/-i third rosette leaf (right). The fsl leaf has deeper serrations in the margin than the wild-type leaf. (6) Wild-type cauline leaf (left) and rsl-l cauline leaf (right). The &l-l leaf curls up around the new axis, whereas the wild-type leaf unfolds. (C) Wild-type flower. Diagram represents positions of floral organs: the outer half-ovals represent sepals, the lines represent petals, the circles represent stamens, and the innermost set of two half-ovals represents the bicarpellate gynoecium. (0 and E) Examples of tsl-f flowers. Diagram represents organs present in each fsl-7 flower. tsl flowers are missing organs and have an unfused gynoecium. In (D), one of the sepals is reduced in size (bottom arrow), and one of the stamens is filamentous (top arrow). (F) Example of a tsl-2 flower. (G) Flower of primary transformant of a k/-P plant transformed with pHG17 (see Figure 3). The mutant floral phenotype has been rescued by addition of a wild-type TSL gene.

TOUSLED Encodes a Putative Protein Kinase 941

Table 1. Quantification

of Organs Present in k/-l

Flowers

Organ type

Number of Organs in a Whorl of &/-I Flowers (%) ~~~0 1 2

Sepal” Petalc

0 26.2

Stamen6

6.3

3

4

0 32.4

6.3 29.5

44.7 10.6

49.0 1.3

-

-

10.9

35.4

34.0

11.3

1.3

0

Total Number of Organs per Flower (%) 01234 Sepals plus Petals plus Stamens” s A total of number. b Wild-type c Wild-type d Wild-type e Sum in a

302 flowers on 7 fsl-1

0

5 0

0

0

0.3

3.3

plants were scored for the presence

6

7

10.9

19.2

5

,~_____~~ 0 9 24.2

26.6

of floral organs. The percentage

6

10

11

12

13

14

11.6

3.3

0

0

0

of the total flowers is shown below the

flowers have 4 sepals. flowers have 4 petals. flowers have 5-6 stamens (25% have only 5 [Smyth et al., 19901). flower (wild type = 14).

a gene required during meristem and organ development. The TSL gene does not appear to be a meristem or an organ identity gene based on its mutant phenotype. Instead, TSL likely participates in determining the pattern of initiation of floral organ primordia from the floral meristem and also may function during growth and differentiation of both the leaves and the floral organs. That the TSL gene encodes a putative protein kinase implicates the existence of a signal transduction or regulatory pathway that is different from the regulatory pathways specifying organ or meristem identity and that is required for proper leaf and flower development. Results The tsl Phenotype The TSL gene was identified by three noncomplementing alleles. tsl-7 is a recessive mutation isolated from a T-DNAmutagenized population of Arabidopsis seeds (Feldmann and Marks, 1987). Two other mutations, tsl-2 and b/-3, isolated from a population of diepoxybutane-mutagenized seeds, displayed a phenotype indistinguishable from Lsl-7 plants. In general, &l-7 mutant plants are delayed in flowering by approximately 1 week compared with wilti-type plants. Furthermore, the number of leaves produced in the vegetative rosette isslightly increased in tsl-7 plants. In three independent experiments under long day conditions (16 hr light and 8 hr dark), tsl-7 plants produced an average of 1.5 more rosette leaves than did their wild-type siblings. The average number of rosette leaves on wild-type plants was 5.9 + 0.4 (n = 20, 36, 27), whereas the average for &l-7 plants was 7.4 f 0.4 (n = 19, 33, 23). The shape of the leaves is altered in N-7 plants; the margins of tsl-7 rosette leaves show deeper serrations than wild type (Figure 1A). Secondary axes develop off the main inflorescence axis from the axils of cauline leaves. In the populations described above, &SC7plantsformed moresecondary axes off the main axis than did their wild-type siblings, 4.2 f 0.5 versus 2.4 j; 0.3, respectively. Furthermore, in H-7 plants, the cauline leaves curl up tightly around

the new axis, in contrast with wild-type cauline leaves, which unfold and bend away (Figure 1B). As in wild-type, flowers in tsl-7 plants are produced in a helical phyllotaxis (Figures 2A and 2B). Flowers produced in h/-l plants, however, are highly abnormal (see Figures lD-1E) when compared with a wild-type flower (see Figure 1 C). Wild-type Arabidopsis flowers are bilaterally symmetric and contain four sepals, four petals, six stamens, and a bicarpellate gynoecium. In general, the flowers produced on a b/-l plant display a disheveled, or tousled, appearance. Fewer organs are formed on each flower than are formed on wild-type flowers. All the organ types of the flower may be affected, and the loss appears to be stochastic. tsl-7 flowers contain 2-4 sepals, O-4 petals, O-5 stamens, and l-2 carpels comprising the gynoecium. Even on the same rsl plant, each flower is different in the complement of organs that are present. The position of the organs formed in tsl-7 flowers is correct with respect to the general apical/basal patterning of the flower into the four organ-type whorls. It appears, therefore, that no homeotic conversion of organ types has occurred. To determine whether trends in the pattern of floral organs produced in tslflowerscould be observed, aquantitative study was performed. The number of sepals, petals, and stamens present in a total of 302 flowers on seven tsl-7 plants was recorded (Table 1). The number of sepals present in mature flowers was the least affected by the mutation; 49% of the tsl-7 flowers had the normal number of sepals. Only 1.3% of the tsl-7 flowers had the normal complement of petals, however, and no flowers were observed with the normal number of six stamens. Interestingly, the total number of organs present in each kd-7 flower (excluding carpel number) centered around seven to nine, compared with a wild-type number of 14 organs. In general then, tsl-7 flowers have roughly one-half the correct number of organs, but which specific organs are present apparently is stochastic, especiallyforthe number of petals and stamens. In the analysis of the tsl-7 flowers, no trends were observed showing a preference toward loss of either the lateral or the medial organs.

Cell 942

Figure 2. The Development of N-1 Floral Meristems Is Altered at Very Early Stages Scanning electron microscopy was performed on wild-type and on tsl-7 floral meristems. Stag ing of the tsl-7 floral meristems is approximate, because the tsl-7 buds were so highly abnormal. Scale bar 25 urn. In (C-M), the medial plane is vertical. (A) A wild-type inflorescence meristem (I) with young floral meristems developing off the inflorescence meristem (I) (bud stages are numbered following the description of Smyth et al., 1990). Organ primordia then begin their development as bulges off the floral meristem domes. The sepal primordia are initiating in the stage 3 and stage 4 floral meristem (S indicates one of the four sepal primordia). (8) A ml-7 inflorescence meristem with developing buds (numbers show approximate stage). The stage 4 floral meristem has initiated sepals in an aberrant pattern. (C) Wild-type stage 5 floral meristem with four sepal primordia (S indicates one of the four sepal primordia). The arrow indicates 1 of the 4 medial stamen primordia that have just been initiated. (D-E) Stage 5 ml-7 floral meristems. In each, four sepal primordia have been initiated, but they are positioned asymmetrically (S indicates one of the four sepal primordia). The arrows indicate organ primordia that have just initiated. (F) Wild-type late stage 5 floral meristem. The two medial sepals have been removed, and the position of 1 of the 4 medial stamen primordia is indicated (M). The petal primordia are not visible, but are in positions just inside and alternate to the sepal primordia. (G-H) Stage 5/6 t&I floral meristem. Organ primordia (arrows) have initiated what may be stamen primordia, based on their position and size. The sepal primordia are delayed in growth, and all have not been initiated in these examples. (I) Wild-type stage 7 floral meristem with the sepal primordia removed. Five of the six stamen primordia are visible (four medial [one IS indicated by M] and one lateral [L]), and the sixth stamen primordia and the four petal primordiaare hidden (thearrowhead indicates the position of one of the four petal primordia below). The gynoecium (G) has been initiated and is developing as a slotted column. (J and K) Stage 7 rsC1 floral meristems with sepal primordia removed (G is the developing gynoecium). In (J), three putative stamen primordia (black arrowheads) in an unusual tricussate arrangement and one putative petal primordia (white arrow) are visible. In (K), no petal primordia and only three unequally developing putative stamen primordia have formed (arrowheads). (L) Wild-type stage 8 floral meristem with sepals removed: the gynoecium (G) is developing as a slotted cylinder and the two placental ridges (arrow) are thickening, forming the hour glass-shaped interior of the tube. (L, lateral stamen primordia; M, medial stamen primordia). (M) N-7 stage 8 floral meristem with sepals removed; the immature gynoecium (G) is irregularly shaped, and the tops of the walls are curving inward independently. The arrowheads indicate two petal primordia, and the other four are stamen primordia.

The M-7 floral organs formed are often misshapen, and some are reduced in size or are filamentous (see Figure 1E). The gynoecium is always present and produces ovules, but it can be composed of what appears to be only a single ovule-bearing carpel. The gynoecium is always split to some extent, and stigmatic tissue is not always formed. The &l-l and tsl-2 alleles are both sterile when grown at 22%. The gynoecia are more intact when the plants are grown at 16%, and occasionally self-pollination occurs and a few viable seeds are produced.

Organ Absence in tsl Flowers Is Due to a Failure to Initiate Floral Organ Primordia The stages of development in wild-type Arabidopsis floral meristems have been characterized by Smyth et al. (1990). In each developing flower, opposite pairs of organ primordia are formed in rapid succession in a characteristic pattern, initiating first as bulges off the floral meristem dome. Two opposite pairs of sepal primordia are the first organ primordia initiated from the floral meristem. This is followed by four petal primordia and six stamen primordia,

TOUSLED Encodes a Putative Protein Kinase 943

one lateral pair and a pair of medial doublets. Finally, a gynoecium is formed that develops from two congenitally fused carpel primordia. The mature gynoecium is capped by a style and stigmatic surface. To determine whether the absence of organs in IS/ flowers is due to the failure to initiate organ primordia, scanning electron microscopy was performed on developing tsl-7 floral meristems. Figure 2 shows a comparison of a developmental series of young floral meristems from wild-type and tsl-7 plants, each displaying a helical phyllotaxis off the inflorescence meristem (Figures 2A and B). By scanning electron microscopy, the earliest visible difference between wild-type and mutant floral meristems was apparent in stage 4 floral meristems. The symmetrical pattern of initiation of the four sepal primordia seen in wild-type floral meristems (Figure 2A) was altered dramatically in W-7 floral meristems (Figure 28). tsl-7 floral meristems continued to show aberrant and asymmetric initiation of organ primordia in later stages of development and, like mature W-7 flowers, were variable in morphology. Figures 2D and 2E show two examples of stage 5 tsl-7 floral meristems, in which each have initiated four asymmetrically positioned sepal primordia, as compared with a wild-type floral meristem of the same stage with two symmetrical pairs of sepal primordia (Figure 2C). The placement and number of subsequent primordia was abnormal in the rsl-7 buds (Figure 2D and 2E). In fact, unequivocal assignment of identity to the organ primordia in these early stages was not possible because their numbers and their arrangement were so abnormal. By late stage 5, all the petal and stamen primordia have been intiated in wild type (Figure 2F). Stage 5/6 tsl-7 meristems showed unusual positioning of primordia (Figures 2G and 2H), and, in the two examples shown, the full complement of sepal, petal, and stamen primordia were not formed. Also, the growth of the sepal primordia was delayed in W-7 meristems; one pair should enclose the developing meristem by this stage. Asymmetric positioning and absence of organ primordia are shown clearly in the two examples of stage 7 rsl-7 floral meristems (Figures 2J and 2K) compared with wild type (Figure 21). In Figure 2J, only three putative stamen primordia are present and they have been formed in a tricussate arrangement, unlike wild type (Figure 2l), which have six stamen primordia with an opposite phyllotaxy. In Figure 2K, two putative stamen primordia were formed opposite to a third. Most petal primordia are missing in these examples; one primordium visible in Figure 2J is most likely a petal primordium, and none have been formed in the floral meristem in Figure 2K. As primordia were differentiating into mature organs in later stages, they often showed abnormal morphology in the tsl-7 buds. For example, the gynoecium consistently showed developmental defects, possibly due to uncoordinated growth of the two carpel primordia, that lead to the split gynoecium always found in mature flowers. Figure 2M shows a stage 6 tsC7 floral meristem in which the two carpel primordia did not develop properly as a paired fused cylinder, as seen in wild type (Figure 2L). Incorrect lobing of the anthers was also seen in some tsl-7 buds (Figure 2M). In addition to the major

morphological defects described above, the cells of each organ type in the tsl-7 floral meristems consistently appeared more collapsed than in wild-type tissue, even though the samples were processed in the same manner. Molecular Cloning of the TSL Gene The rsl-7 allele, generated by T-DNA insertional mutagenesis, was used to isolate the TSL gene. Four T-DNA copies were present in the original mutant line, but only one copy cosegregated with mutant plants when analyzed by Southern blot analysis (data not shown), identifying it as the likely mutagenic T-DNA. Plant DNA sequences flanking the T-DNAs were recovered by plasmid rescue from DNA isolated from mutant plants, and the clone containing sequences from the mutagenic T-DNA (Figure 3A) was identified by Southern analysis (data not shown). pTRB contains 6.3 kb of T-DNA sequence including the right T-DNA border, and an additional 10.6 kb of plant sequence, which was used to isolate wild-type genomic clones from the region. To confirm directly that the T-DNA in tsl-7 plants identifies the TSL gene, a 17 kb wild-type genomic fragment overlapping the T-DNA insertion site in the tsl-7 allele was tested for its ability to rescue the rsl mutant phenotype. pHG17 (Figure 38) was transformed into the roots of individual W-2 mutant plants (see Figure 1 F), and three independent transformed calli were obtained. Phenotypically wild-type flowers, having the full complement of floral organs and a completely fused gynoecium with a normal stigmatic surface, were formed on plants regenerated from these calli (see Figure 1G). These primary transformants set seed normally once moved to soil, and these seeds segregated for wild-type and rsl plants. This result confirms that this genomic region, interrupted by the mutagenic T-DNA in the tsl-7 allele, contains the TSL gene. A 7 kb EcoRl subfragment of the 17 kb Xhol genomic fragment in pHG17 detected an RFLP between the Lands-

-E I

PTRB HE , I

anIp

x B

I

E

-5

on * I

x 4 hY&T’

1 kb

Figure 3. Clones Overlapping the T-DNA in fsl-7 Plants and the Corresponding Region in Wild Type (A) Position of the mutagenic T-DNA insert in tsl-7 plants. The box represents the T-DNA. Triangles represent T-DNA borders. The ampicillin resistance (amp’) gene and origin of replication (ori) are from the pBR322 sequences in the T-DNA. The plasmid pTRB rescued from DNA from &l-l plants containing T-DNA and adjacent plant sequences is shown above. The hatched box represents a 1.4 kb Sacll-Hindlll fragment used to screen a flower cDNA library. E, EcoRI; S, Sacll; H, Hindlll. (B) Wild-type genomic fragment (stippled box) used for complementation of the tsl mutation was subcloned into the Xhol site (X) of the transformation vector, phygA, giving the plasmid pHG17. The arrow represents the position of the T-DNA in the tsl-7 mutation. The hyg gene encodes resistance to hygromycin B. Asterisks marking EcoRl sites represent equivalent positions.

Cdl 944

Figure 4. Nucleotide cDNA

and Deduced

Amino

Acid Sequence

of TSL

The horizontal arrow denotes the start of the putative protein kinase catalytic domain (see Figure 5). Brackets indicate regions predicted to participate in a coiled-coil structure by the prediction algorithm of Lupas et al. (1991) (see Figure 6). Underlined residues are potential nuclear localization signals. Closed triangles represent the position of introns, and the open triangle represents the position of the T-DNA insert in intron 14 in the tsC7 mutant gene. The position of the T-DNA insert was determined by comparing the sequence of pTRS (see Figure 3) with the corresponding wild-type genomic sequence (data not shown). The mutations found in the tsl-2 and tsl-3 alleles are indicated above the wild-type sequence. Nucleotides found in the TSL gene in Colombia ecotype that were different than those found in the Wassilewskija ecotype are indicated above the sequence either by Col-0 or by parentheses; none of these changed the encoded protein sequence.

berg and the Colombia ecotype. This allowed mapping of the fragment using recombinant inbred lines (Lister and Dean, 1993). The EcoRl fragment maps to the top half of chromosome 5, approximately 1 .l CM proximal to the restriction fragment length polymorphism (RFLP) marker 4560 (Nam et al., 1989) and very near the floral homeotic mutation pistillata @3 (Hauge et al., 1993). tsl and pi are not allelic by complementation analysis (data not shown). Characterization of the TSL cDNA To identify the transcription unit disrupted by integration of the mutagenic T-DNA in the tsl-7 allele, a cDNA library was screened using 1.4 kb of plant sequence directly adjacent to the T-DNA border in pTRB (hatched box in Figure

3A). One partial cDNA clone was obtained, which overlapped the site of integration of the T-DNA. This cDNA identified a 2.7 kb mRNA in RNA isolated from wild-type flowers that is absent in fsl-7 flower RNA (see Figure 7). The sequence of the TSL cDNA was assembled using clones derived from cDNA library screenings and polymerase chain reaction (PCR) products (Saiki et al., 1988) derived from a modification of the rapid amplification of cDNA ends (RACE) protocol (Frohman et al., 1988) to recover 5’ sequences. The TSL cDNA is 2629 bp (in agreement with the 2.7 kb transcript size) and contains an open reading frame of 2064 bp from the ATG codon at nucleotide 306 (Figure 4). This likely represents the initiation codon, as it is the first ATG in the longest open reading frame. The open reading frame encodes a 78 kda protein. The TSL gene appears to be a single copy gene in Arabidopsis (data not shown). Sequencing of the wild-type genomic region revealed that there are 15 introns in the TSL transcription unit (Figure 4). By comparing the sequence directly adjacent to the right T-DNA border in pTRB with the corresponding wild-type sequence, it was determined that theT-DNA in the tsl-7 allele was inserted in intron 14. Immediately following the right border of the T-DNA in pTRB was a 139 bp sequence of unknown origin, which was followed by the sequence corresponding to that in intron 14. Rearrangements of genomic sequences around integrated T-DNA borders have previously been found (for example, see Gheysen et al., 1991). Sequencing of the TSL gene in tsl-2 and tsl-3 revealed the presence of a mutation in each of the diepoxybutaneinduced alleles (Figure 4). In the tsl-2 allele, a T to A transversion at nucleotide position 1369 in the cDNA sequence results in the replacement of a valine by aspartic acid at amino acid 355 in the TSL protein. An A to T transversion at nucleotide position 912 was found in the tsC3 allele, which converts the codon for amino acid 203 to a stop codon, truncating the encoded TSL protein by more than two thirds. The C-Terminus of the TSL Gene Product Is Homologous to the Catalytic Domain of Protein Kinases Comparative sequence analysis reveals that the TSL protein contains several domains. The C-terminus shows homology to the catalytic domain of serinelthreonine and tyrosine protein kinases (Figure 5). When aligned to the catalytic domains of protein kinases as described by Hanks and Quinn (1991), the TSL C-terminal domain (amino acids 409-688) contains all of the residues that are conserved in the two families of protein kinases. Furthermore, it contains other residues that are conserved within each family. TSL appears to fall in the serine/threonine class of protein kinases, because it contains sequences that are more closely related to the indicator regions of this family, i.e., the sequences DLKPEN and GTPEYLAPE (amino acids 166-l 71 and 200-208, respectively) in CAMP-dependent protein kinase (Hanks, 1987). When compared with known sequences (Brutlag et al., 1990) the putative catalytic domain of TSL shows between 24% and 33% identity with the catalytic domains of other

TOUSLED Encodes a Putative Protein Kinase 945

Figure 5. Alignment of the C-Terminus of TSL with the Catalytic Domain of Protein Kinases

IX

x

TSL is compared with the prototypical serinel threonine kinase, CAMP-dependent protein kinase a (cAPK-a) (Maldonado and Hanks, 1988) and the prototypical tyrosine kinase, c-sm. (Anderson et al., 1985). The alignment is based on that of Hanks and Quinn (1991). The white letters are the amino acids that are conserved among the protein kinases. Underlined amino acids represent other amino acids that are conserved in this alignment. Numbers represent amino acid numbers of each protein sequence.

IX

protein kinases and does not appear to fall into any known subfamily by homology. It does not show any higher homology to plant protein kinases than to other protein kinases; therefore, it may represent the first member of a novel class.

motif involved in protein dimerization (Landschulz et al., 1988), with Leu-306, Leu-313, lie-320, and Leu-327 found at a spacing of seven amino acids. This region in TSL thus may be important for interactions with other proteins, for homodimerization, or for the tertiary structure of the protein.

The N-Terminal Domain of the TSL Protein May Participate in a Coiled-Coil Structure When analyzed for hydrophobicity, the N-terminus of TSL did not contain any potential membrane-spanning region (data not shown). The extreme N-terminus contains a long stretch of glutamine residues of unknown function, which has also been found outside of the catalytic domain of several yeast protein kinases (McLeod and Beach, 1986; Hoekstra et al., 1991). Secondary structure predictions of the TSL N-terminal domain suggest it forms mostly an a-helical structure from amino acids 195-395 (Figure 6A) (Chou and Fastman, 1978). This a-helical region is highly charged and contains 40.2% acidic plus basic residues, in the region from amino acid 194-407. When the N-terminus of TSL was compared with known sequences, two suggestive features were found. First, it contains three potential nuclear localization signals (see Figure 4) two conforming to the consensus sequence derived by Chelsky et al. (1989) (K-R/K-X-R/K) (amino acids 97-l 00 and 389-392) and one conforming to the consensus sequence of a bipartite signal as first described for nucleoplasmin (Robbins et al., 1991) (amino acids 123-139). Second, a domain between amino acids 90 and 370 shows limited homology with the a-helical tail domain of myosin heavy chain and with intermediate filament proteins (data not shown); both types of proteins contain coiled-coil structures (Cohen and Parry, 1986). The potential for this domain in TSL to form a coiled-coil structure, therefore, was tested using the prediction algorithm of Lupas et al. (1991). Figure 66 shows there are two segments of TSL that have a high probability of participating in a coiled-coil structure (amino acids 194-254 and 298-330). A third segment with lower probability also falls between amino acids 356-394 (data not shown). In these structures, the positions a and d in each group of seven amino acids (i.e., two-helical turns) tend to be hydrophobic. This creates a hydrophobic surface along one face of the a-helix that may potentially interact with other hydrophobic surfaces (Cohen and Parry, 1986). Furthermore, the stretch of amino acids 306327 also contains a potential leucine zipper, a structural

The TSL Gene is Most Highly Expressed in Developing Floral Meristems TSL gene expression was assayed in the major plant organs by Northern blot analysis (Figure 7A). As shown in lane 4 of Figure 7A the 2.7 kb TSL mRNA is most abundant in developing floral meristems. It continues to be present, albeit at a lower level, throughout maturation of the flower and during seed development (Figure 7A, lanes 5 and 6). TSL also is expressed in both roots and mature leaves (Figure 7A, lanes 1 and 2, respectively) and is barely detectable in stems (lane 3). The T-DNA in the tsl-7 allele was inserted into intron 14. which lies between subdomain

Figure 8. Secondary

Structure Predictions

for the N-Terminus of TSL

(A) The predicted secondary structure of amino acids l-407 of TSL based on Chou-Fastman analysis (Chou and Fastman, 1978). The tracing was generated using MacVector software. (6) Segments of TSL predicted to participate in a coiled-coil structure by the prediction algorithm of Lupas et al. (1991). The a-helix is drawn schematically to show the alignment of amino acids in positions a-g of the helix. The boxed amino acids are those in positions a and d in each pair of helical turns that tend to be hydrophobic in a coiled-coil structure. On the left is the segment from amino acid 194-254 and on the right the segment from amino acid 298-330. The segment 308327 may also potentially form a leucine zipper domain (Landschulz et al., 1988) with theamino acids Leu-308, Leu-313,lle-320, and Leu-327 found at each seventh position

Cell 946

A

1

2

3

4

5

6

2.7kb

TSL

TSL

2.7kb

10s

1.7kb

Figure 7. Expression of the TSL Gene in Wild-Type and Mutant Tissues Northern blot analysis was performed on IO pg of total RNA isolated from each plant tissue. To show equal loading of RNA in each lane, blots were reprobed with 18s ribosomal DNA sequences. (A) RNA from wild-type tissues was probed using an antisense RNA probe for TSL mRNA (TSL) that detects a 2.7 kb transcript and then reprobed with an 185 rRNA probe (18s). Lane 1, root; lane 2, leaf; lane 3, stem; lane 4, bud clusters (stages l-1 2, including the inflorescence meristem); lane 5, flowers at anthesis; lane 6, flowers postanthesis with elongating siliques. (6) The same probes as in (A) were hybridized to a blot containing RNA from wild type (lane l), fsl-7 (lane 2) ml-2 (lane 3) fsC3 (lane 4) and floral clusters (stages 1-15, including the inflorescence meristem, lane 4).

VIII and IX of the catalytic domain of TSL. No detectable transcript of any size was detected in RNA isolated from flower clusters from W-7 plants (Figure 78, lane 2). The probe contained 0.5 kb of sequence upstream of the 5’ splice site of intron I4 and would be expected to detect an aberrant transcript synthesized in the mutant. Thus, transcription through intron-I4 into the T-DNA sequences possibly results in an unstable transcript. A transcript of normal size was detected in RNA from flower clusters collected from both W-2 and tsl-3 plants (Figure 78, lanes 3 and 4), and the transcript level in W-2 flowers was more abundant than in wild-type flower RNA (lane 3 versus lane 1). Discussion The tsl Phenotype and Arabidopsis Development The recessive mutation tsl displays a complex phenotype in which most of the organ types of the plant are affected, indicating that the wild-type TSL gene is necessary during various stages of Arabidopsis development, tsl plants flower later and form more rosette leaves and more secondary axes than do wild-type plants grown under the same conditions. Although not as dramatic, this is similar to the changes seen when Arabidopsis plants are grown under short day conditions or carry a mutation in one of

the late flowering genes (Martinez-Zapater and Somerville, 1990; Koornneef et al., 1991; Karlsson et al., 1993) and may reflect a partial defect in the response of tsl plants to floral induction. tsl plants have rosette leaves that are more serrated than wild-type leaves. This may result from a defect in expansion of the leaf blade or a defect in the development of the margin of the leaf. Cauline leaves are curled abnormally as well. The TSL gene is expressed in the leaves in wild-type plants, and it is therefore likely that TSL plays a role during leaf development. tsl plants show no morphological abnormalities in the development of the inflorescence axes, however, and normal numbers of flowers are produced in the correct helical phyllotaxy. Thus, TSL is not a meristem identity gene. TSL mRNA can be detected in wild-type roots, but no overt defects in root morphology were observed in tsl plants (J. L. Ft., unpublished data). The role of TSL expression during root development is unclear. Floral Meristem Development and Control of Floral Organ Number The most dramatic aspect of the tsl phenotype is its aberrant floral development. In wild-type floral meristems, TSL likely is acting in some pathway affecting the overall morphology of the floral meristem. Organ primordia do not initiate in a symmetrical pattern in fslfloral meristems and often are abnormal in shape. The sharp, symmetrical boundaries between primordia of different organ types seen in wild type are not apparent in developing tsl floral meristems. Reduced numbers of organ primordia are found in young &Cl floral meristems, just as reduced numbers of organs are present in mature tsl flowers. The TSL gene is most highly expressed in developing flowers and conceivably may be acting as early as the initial formation of the floral meristems off the inflorescence meristem. TSL may participate in events that determine the sites of primordia initiation within the floral meristem, such as allocating the correct number of cells to the appropriate regions that will result in proper primordia initiation or coordinating cell divisions within either the inflorescence or the floral meristem. It may be significant that the &/phenotype manifests most dramatically during development when there is a switch in pattern formation within the meristem. Both the leaves (with the exception of the cotyledons and the first leaf pair) and the flowers in Arabidopsis are formed in a helical pattern from their respective meristems. The floral organs, however, are formed in an opposite whorled pattern off the floral meristem. The tsl phenotype may result from difficulties encountered in attempting the conversion from one pattern to another. The organs formed in tslflowers appear within the appropriate domains of the flower, at least in relation to the sequential order of appearance and apical/basal patterning of floral organ types; i.e., no homeotic conversions have occurred. Thus, unlike the homeotic genes, TSL is not involved in determining the organ identity of developing primordia. In spite of the asymmetrical postitioning of the organs within their respective domains, correct floral organ types are formed in tsl flowers. This suggests that

TOUSLED Encodes a Putative Protein Kinase 947

the spatially restricted patterns of expression and action of the homeotic genes are not dramatically altered in fsl floral meristems. Organs formed in tsl flowers often are deformed or reduced in size. These abnormalities could result from secondary pleiotropic effects following aberrant primordia initiation. Alternatively, this may reflect a need for continuing TSL function for maintaining the growth and development of organ primordia during differentiation to mature organs. All three fsl alleles exhibit the same phenotype, even though each mutation maps to a different site in the gene. This probably reflects the fact that none can provide TSL function and implies that the fsl phenotype is unlikely to be due to incomplete expressivity. For example, in tsl-7 flowers there is no detectable TSL homologous mRNA. TSL transcript is synthesized in the &l-3 allele, but encodes a truncated protein lacking most of the N- and all of the C-terminal region. In the tsl-2 allele, a presumably fulllength protein can be synthesized, albeit with an amino acid substitution in the N-terminal domain; that the fsl-2 phenotype is identical to rsl-7 and tsC3 implies this protein is inactive. The absence of TSL function results in an apparently random loss of members of each organ type in each flower. Why a mutation should cause this stochastic phenotype is unknown. TSL may have a critical early function and, once aberrant initiation and growth of the floral meristems has occurred, they are sufficiently disrupted to affect the further development of the flower in an unpredictable fashion. How the number and pattern of floral organs is determined is unknown. Mutations like tsl may elucidate the control mechanisms involved. In addition to their homeotic phenotypes, mutations in several of the Arabidopsis and Antirrhinum floral homeotic genes show reduced numbers of some floral organs (Bowman et al., 1989, 1991 b; Kunst et al., 1989; Coen, 1991). Several other mutations in Arabidopsis, for example FI-54, also show reduced numbers of organs (Komaki et al., 1988). In contrast, mutations in other loci can result in extra organs being produced in the flower. These include clavata 7 and clavata 2 (Koornneef et al., 1983; Haughn and Somerville, 1988; Okada et al., 1989; Leyserand Furner, 1992) superman (FLO70)(Schultz et al., 1991; Bowman et al., 1992) and errin (R. A. S. and P. C. Z., unpublished data). Thus, many genes, possibly with overlapping pathways of action, likely are involved in the control of floral organ number.

kinase domain. The mutation in the fsl-2 allele in the N-terminal domain of TSL has revealed an amino acid of critical importance for TSL protein activity. The valine to aspartic acid change in this allele is located adjacent to the third possible coiled-coil segment and may affect proper folding of the protein.

The TSL Gene Encodes a Novel Plant Protein Kinase The TSL gene product is a putative serine/threonine protein kinase. The putative catalytic domain of TSL does not appear to fall into any known subclass of protein kinases and may represent a novel family. The N-terminal domain of TSL contains a highly charged region that potentially adopts a coiled-coil structure. This region presumably is involved in either tertiary structure stabilization or interaction with other proteins. Furthermore, oneof the coiled-coil segments in TSL may function as a leucine zipper. The interaction of other cellular proteins with the N-terminus of TSL may regulate the catalytic activity of the protein

Mutant Stocks The tsC7 mutation was generated by Agrobacterium tumefaciensmediated transformation of A. thaliana seeds of ecotype Wassilewskija (Feldmann and Marks, 1987). The tsl-2 and N-3 mutations were identified and outcrossed from populations of diepoxybutane-mutagenized seeds of ecotype Columbia (provided by Dr. J. Ecker, University of Pennsylvania) during a screen of these mutagenized seeds in the laboratory of Dr. 8. Staskawicz (University of California, Berkeley). When crossed to TSL/t.s/-7 plants, rsl-2 and fsl-3 did not complement the fsl phenotype.

Signaling Pathways in Plant Development That TSL is a protein kinase homolog suggests it participates in a signaling or regulatory pathway during Arabidopsis development. Cell-cell communication events clearly are important in determining cell fate during plant development. Shoot apical meristems in plants are composed of two to three layers of cells that must develop in a coordinated fashion to give rise separately to different tissues in matureorgans(Sussex, 1989). Cell lineage analysis has shown that the ultimate fate of a cell is not completely coupled to cell lineage, but also is dependent on position (reviewed by Poethig, 1989; Dawe and Freeling, 1991; Irish, 1991). Finally, the analysis of genetic chimeras has revealed that some genes behave in a noncellautonomous fashion during development (reviewed by Irish, 1991; Becraft and Freeling, 1992). An intriguing study by Szymkowiak and Sussex (1992) suggests the existence of cell signaling events in the control of floral organ number in the developing flower. Using layerspecific chimeric flowers, the carpel number in the gynoecium was found to be determined by the genotype of the cells in the innermost layer of the meristem, even when the outer two meristem layers were derived from cells of a different genotype. Other types of signaling pathways are used intracellularly throughout the development of the plant, such as in the response of cells to hormonal or light regulation. For example, a protein kinase gene, CTR7, has recently been cloned that participates in the response of cells to the plant hormone ethylene (Kieber et al., 1993). The nature of the pathway in which tslparticipatesduring plant development is not clear, either from its complex phenotype or from the sequence of the putative protein kinase catalytic domain of TSL. How the phenotype of abnormal flower development is related to other aspects of the tsl phenotype may reflect a common pathway used at various times during Arabidopsis development.

Experimental

Procedures

Scanning Etectron Microscopy Samples were fixed in 3% glutaraldehye in 25 m M sodium phosphate buffer (pH 6.8) postfixed in 1% OsOn, dehydrated through a graded series of ethanol, and critical point dried with liquid CO,. Samples

Cdl 948

were mounted, sputter coated with gold, and viewed in an ISI DS130 scanning electron microscope with an accelerating voltage of 10 kV. Plasmid Rescue from the fsf.1 Allele DNA was purified from &l-l plants by the method of Pruitt and Meyerowitz (1988), digested with EcoRI, diluted to 0.5 uglml, ligated with T4 DNA ligase (New England Biolabs), and transformed into the Escherichia coli strain MC1061. Digestion with EcoRl leaves a fragment containing an intact pBR322 sequence and the right T-DNA border, as well as plant DNA adjacent to the T-DNA; self-ligation forms a functional plasmid. Two different clones were obtained, but only one, pTRB, detected a T-DNA insert cosegregating with the tsl phenotype. Screening of Genomic and cDNA Libraries and Contruction of Vectors for Plant Transformation pTRB was used to screen a wild-type Wassilewskija genomic library using standard techniques (Sambrook et al., 1989). The genomic Iibrary was constructed by size-fractionating wild-type Arabidopsis DNA partially digested with Sau3Aand ligating the fraction of approximately 20 kb to 1GEM-11 arms (Promega) with BamHl ends. A 17 kb Xhol fragment was subcloned from one of these genomic phages (13) into phygA to yield pHG17. phygA, a precursor to the plasmid MH856, contains a hygromycin resistance gene and an Xhol site in the polylinker (Honma et al., 1993). pHG17 was introduced into Agrobacterium ASE (Rogerset al., 1987) byelectroporation to yield strain ASE-HG17. The 1.4 kb Sacll-Hindlll fragment containing plant sequences directly adjacent to the right border of the T-DNA from pTRB (see Figure 3) was used to screen a cDNA library in lgtl0 prepared from RNA from flowers and buds (ecotype Landsberg erecta), provided by E. M. Meyerowitz (California Institute of Technology). One positive phage, hFS/H, was isolated. The cDNA in lFS/H was subcloned into pBluescript SK(+) (Stratagene) and sequenced by the dideoxy-chain termination method (Sanger et al., 1977) (nucleotides 1525-2576; see Figure 4) using a Sequenase kit (U. S. Biochemicals) and double-stranded plasmid DNA. Deletion subclones for sequencing were generated using an Erase-A-Base kit (Promega). This cDNA did not contain a poly(A) tail. A second cDNA, containing a poly(A) tail, was isolated from a cDNA library in hZAPll (Stratagene) of RNA from flowers and buds (Landsberg), provided by E. M. Meyerowitz, using the 0.9 kb insert in pMld3-2 (a subclone of LFSIH, nucleotides 1617-2538; see Figure 4) as a probe. The plasmid, pNF4, was recovered by excision asa pBluescript phagemid, and the insert wassequenced (nucleotides 2181-2629; see Figure 4). Recovery of 5’ cDNA Clones 5’ cDNA sequences were obtained by PCR (Saiki et al., 1988) using a modified RACE protocol (Frohman et al., 1988). cDNA was synthesized by reverse transcription of 1 wg of flower poly(A)’ RNA with 10 pmol of the primer 5’-CTTTCCCACTACAATATTCC-3’, using 10 U of murine Moloney reverse transcriptase (New England Biolabs). This primer was chosen because it overlaps the site of an intron-exon junction. PCR was performed using primer pairs chosen from genomic sequence of possible open reading frames and cDNA sequence in the following combinations: 5’-GTCCGAAACCTCTCTATCAGTG-3 and 5’-TTCCCTGTTGGCATGGCGGATG-3’; 5’.AAATTAGGGAGTGAAGTGTC-3’ and 5’-TTTCCTTCCATCATATGCTG-3’; 5’TAAAGAGACTTGTGTTGACG3’and 5’-TTTCCTTCCATCATATGCTG-3’. PCR contained 11100 of the cDNA reaction, 0.2 m M dNTPs, 25 pmol primers, and 2.5 Ulpfu polymerase (Stratagene); reactions were incubated for 5 min at 95%, 1 min at 45’%, and 40 min at 72%, followed by 35 cycles of 95°C (40 s), 48°C (1 min), and 72OC (2 min). PCR products were subcloned into pCRll or pCRlOO(lnvitrogen) using the TAcloning kit (Invitrogen) and sequenced. All PCR-generated clones were derived from cDNA sequences and not from contaminating genomic DNA because intron sequences were not present in the clones. Their sequence was compared with the genomic sequence for accuracy. The position of the introns was determined by sequencing the corresponding region in wild-type genomic DNA using subclones of the 17 kb genomic region from 13 and comparing this with the cDNA sequence. Agrobacterlum-Mediated Transformation of fsl Plants Arabidopsis plants were transformed using the root transformation

protocol of Marton and Browse (1991), with the exception that plants for transformation were grown individually from seed in 50 ml of liquid germination media(Marton and Browse, 1991), with shaking at 80 rpm at 23% for 16-23 days. Roots from these plants were individually transformed by cocultivation with the strain ASE-HG17, and transformants were selected using 15 pglml hygromycin B (Calbiochem). Transformed shoots were moved to rooting media (germination media plus 5 mglml indole-3-butyric acid) and then to soil. In some experiments, supplementation with silver thiosulphate was used to enhance regeneration (Clarke et al., 1992). In one experiment, tsl-2 plants that were used for transformation were obtained from germinating the selfed progeny of a heterozygous (TSLltsl-2) plant segregating for tsl-2 plants. In two other experiments, the selfed progeny of a homozygous (tsl-.2/t&2) plant were used in which all the progeny were t&2. The phenotype of each plant whose roots were used for transformation was checked. Sequencing of fsf.2 and fs1.3 Alleles DNA was isolated from tsC2 and tsC3 mutant plants (Pruitt and Meyerowitz, 1986), and PCR was performed using several different combinations of gene-specific primers covering the TSL gene (Saiki et al., 1988). Reactions were performed as described for cloning of the 5’ cDNA sequences, using 100-500 ng of genomic DNA for the template and the cycling conditions of 1 min at 95OC, 2 min at 45’YZ or 4E°C, and 3 min at 72%. PCR products were subcloned into pCRll (Invitrogen) or pBluescriptll KS(+)(Stratagene) (Marchuketal., 1991), and the inserts were sequenced. Mutations were verified by sequencing the same region from a PCR product obtained using a different set of genespecific primers. Where nucleotide differences were found with the ecotype Wassilewskija genomic sequence that was present in both the tsl-2 and fsl-3 sequences, it was inferred that they represented ecotype Colombia-specific nucleotides. Northern Blot Analysis Total RNA was extracted from plant tissues by the method of Hall et al. (1978), as modified by Condit et al. (1983). Total RNA (10 pg) was electrophoresed in a formaldehyde-agarose gel, transferred to Hybond N (Amersham), and hybridized to 32P-labeled probes under standard conditions (Sambrook et al.. 1989). Single-stranded antisense RNA probe was generated by transcription by T3 RNA polymerase (GIBCO BRL) using [3*P]-UTP (>600 Cilmmol, ICN Pharmaceuticals) from pMld3-2 (see above). As a control, the insert from a clone containing pea 1 ES rDNA sequences (Jorgenson et al., 1987) was labeled with [32P]-dCTP (3000 Cilmmol, ICN Pharmaceuticals) by random hexamer labeling (Feinberg and Vogelstein, 1983) and was hybridized to the same blot. Acknowledgments We sincerely thank C. Lister, R. Schmidt, and C. Dean for RFLP mapping the TSL gene, A. Lupas for the coiled-coil prediction analysis, D. Pardoe and the electron microscope lab for help with scanning electron microscopy, S. Coomber for the genomic library, D. Meinke and B. Kunkel for identifying the tsl alleles, E. Meyerowitz for cDNA libraries, C. Waddell and M. Honma for the transformation vector, X.-W. Deng for the 18s rDNA plasmid, and I. Sussex and K. Serikawa for critical review of the manuscript. This work was supported by Department of Energygrant 88ER13882to P. C. 2.; J. L. R. wassupported by National Institutes of Health Individual Research Service Award (l-F32GM13292-01-81-3) and an American Cancer Society postdoctoral fellowship (PF-3826). Received June 30, 1993; revised September

8, 1993

References Anderson, S. K., Gibbs, C. P., Tanada, A., Kung, H.-J., and Fujita, D. J. (1985). Human cellular src gene: nucleotide sequence and derived amino acid sequence of the region coding for the carboxyterminal two-thirds of pp60”““. Mol. Cell. Biol. 5, 1122-l 129. Becrafl, P. W., and Freeling, M. (1992). Cell interactions Curr. Opin. Genet. Dev. 2, 571-575.

in plants.

Bernier, G. (1988). The control of floral evocation and morphogenesis.

TOUSLED Encodes a Putative Protein Kinase 949

Annu. Rev. Plant Physiol. Plant Mol. Biol. 39, 175-219. Bowman, J. L., Smyth, D. Ft., and Meyerowitz, E. M. (1989). Genes directing flower development in Arabidopsis. Plant Cell I, 37-52.

Hanks, S. K. (1987). Homology probing: identification of cDNA clones encoding members of the protein-serine kinase family. Proc. Natl. Acad. Sci. USA 84, 388-392.

Bowman, J. L., Drews, G. N., and Meyerowitz, E. M. (1991a). Expression of the Arabidopsis floral homeotic gene AGAMOUS is restricted to specific cell types late in flower development. Plant Cell 3, 749758.

Hanks, S. K., and Quinn, A. M. (1991). Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members. Meth. Enzymol. 200, 38-62.

Bowman, J. L., Smyth, D. R., and Meyerowitz, E. M. (1991 b). Genetic interactions among floral homeotic genes of Arabidopsis. Development 712, l-20.

Hauge, B. M., Hanley, S. M., Cartinhour, S., Cherry, J.M.. Goodman, H. M., Koornneef, M., Stam, P., Chang, C., Kempin, S., Medrano, L., and Meyerowitz, E. M. (1993). An integrated genetic/RFLP map of the Arabidopsis thaliana genome. Plant J. 3, 745-754.

Bowman, J. L., Sakai, Ii., Jack, T., Weigel, D., Mayer, U., and Meyerowitz, E. M. (1992). SUPERMAN, a regulator of floral homeotic genes in Arabidopsis. Development 774, 599-615.

Haughn, G. W.. and Somerville, C. R. (1988). Genetic control of morphogenesis in Arabidopsis. Dev. Genet. 9, 73-89.

Bradley, D., Carpenter, R., Sommer, H., Hartley, N., and Coen, E. (1993). Complementary floral homeotic phenotypes result from opposite orientations of a transposon at the plena locus of Antirrhinum. Cell 72, 85-95.

Hoekstra, M. F., Liskay, R. M., Ou, A. C., DeMaggio, A.J., Burbee, D. G., and Heffron, F. (1991). HRR25, a putative protein kinase from budding yeast: association with repair of damaged DNA. Science 253, 1031-1034.

Brutlag, D. L., Dautricourt, J. P., Maulik, S., and Relph, J. (1990). Improved sensitivity of biological sequencedatabase searches. Comp. Appl. Biosci. 6, 237-245.

Honma, M. A., Baker, 6. J., and Waddell, C. S. (1993). High frequency germinal transposition of DsALSin Afabidopsis. Proc. Natl. Acad. Sci. USA 90, 6242-6246.

Chelsky, D., Ralph, R., and Jonak, G. (1989). Sequence requirements for synthetic peptide-mediated translocation to the nucleus. Mol. Ceil. Biol. 9, 2487-2492.

Irish, V. F. (1991). Cell lineage in plant development. Dev. 7, 169-173.

Chou, P. Y., and Fastman, G. D. (1978). Empirical predictions tein conformation. Annu. Rev. Biochem. 47, 251-256.

of pro-

Curr. Opin. Genet.

Jack, T., Brockman, L. L., and Meyerowitz, E. M. (1992). The homeotic gene APETAL of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell 68, 683-697.

Clarke, M. C., Wei, W., and Lindsey, K. (1992). High-frequency transformation of Arabidopsis thaliana by Agrobacrerium tumefaciens. Plant Mol. Biol. Report. 10, 178-189.

Jack, T., Sieburth, L. E., and Meyerowitz, control flower development in Afabidopsis. 63.

Coen, E. S. (1991). The role of homeotic genes in flower development and evolution. Annu. Rev. Plant Phys. and Plant Mol. Biol. 42, 241279.

Jorgenson, R. A., Cuellar, R. E., Thompson, W. F., and Kavanagh. T. A. (1987). Structure and variation in ribosomal RNA genes of pea: characterization of a cloned rDNA repeat and chromosomal rDNA variants. Plant Mol. Biol. 8, 3-12.

Coen, E. S (1992). Flower development, 933. Coen, E. S., and Carpenter, Plant Cell, in press.

Curr. Opin. Cell Biol. 4,929-

R. (1993). The metamorphosis

Coen, E. S., and Meyerowitz, genetic interactions controlling 37.

of flowers.

E. M. (1991). The war of the whorls: flower development. Nature 353, 31-

Cohen, C., and Parry, D. A. D. (1986). a-Helical coiled coils: a widespread motif in proteins. Trends Biochem. Sci. 7 7, 245-248. Condit, C., Hagen, T. J., McKnight, T. D., and Meagher, R. B. (1983). Characterization and preliminary mapping of cauliflower mosaic virus transcripts. Gene 25, 101-108. Dawe, R. K., and Freeling, M. (1991). Cell lineage and its consequences in higher plants. Plant J. 7, 3-8. Drews, G. N., Bowman, J. L., and Meyerowitz, E. M. (1991). Negative regulation of the Arabidopsis homeotic gene AGAMOUS by the APETELAP product. Cell 65, 991-1002. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 732, 6-13. Feldmann, K., and Marks, M. D. (1987). Agrobacterium-mediated transformation of germinating seeds of Arabidopsis thaliana: a nontissue culture approach. Mol. Gen. Genet. 208, 1-9. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988). Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specificoligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998-9002. Gheysen, G., Villarroel, R., and Van Montagu, M. (1991). Illegitimate recombination in plants: a model for T-DNA integration. Genes Dev. 5, 287-297. Goring, D. R., Glavin, T. L., Schafer, U., and Rothstein, S.J. (1993). An S receptor kinase gene in self-compatible Brassica napus has a 1 bp deletion. Plant Cell 5, 531-539. Hall, T. C., Ma, Y., Buchbinder, B. Lt., Pyne, J. W., Sun, S. M., and Bliss, F. A. (1978). Messenger RNA for Gl protein of French bean seeds: cell-free translation and product characterization. Proc. Natl. Acad. Sci. USA 75, 3196-3200.

E. M. (1993). Genes that Semin. Dev. Biol. 4, 51-

Karlsson, B. H., Sills, G. R., and Nienhuis, J. (1993). Effectsof photoperiod and vernalization on the number of leaves at flowering in 32Arabidopsis fhaliana (Bfassicaceae) ecotypes. Am. J. Bot. 80, 646-648. Kieber, J. J., Rothenberg, M., Roman, G., Feldman& K. A., and Ecker, J. R. (1993). CTRl, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72, 427-441. Komaki, M. K., Okada, K., Nishino, E., and Shimura, Y. (1988). Isolation and characterization of novel mutants of Arabidopsis thaliana defective in flower development. Development 704, 195-203. Koornneef. M., van Eden, J., Hanhart, C. J., Stam. P., Braaksma, F. J., and Feenstra, W. J. (1983). Linkage map of Arabidopsis tbaliana. J. Hered. 74, 265-272. Koornneef, M., Hanhart,C. J.,andvanderVeen, and physiological analysis of late flowering thaliana. Mol. Gen. Genet. 229, 57-66.

J. H. (1991)Agenetic mutants in Arabidopsis

Kunst, L., Klenz, J. E., Martinez-Zapater, J., and Haughn, G. W. (1989). AP2 gene determines the identity of perianth organs in flowers of Arabidopsis thaliana. Plant Cell 7, 1195-l 208 Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1988). The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240, 1759-1764. Leyser, H. M. O., and Furner, I. J. (1992). Characterization of the three shoot apical meristem mutants of Arabidopsis thaliana. Development 776, 397-403. Lister, C., and Dean, C. (1993). Recombinant inbred lines for mapping phenotyptic and RFLP markers in Arabidopsis thaliana. Plant J. 4, 745-750. Lupas, A., Van Dyke, M., and Stock, J. (1991). Predicting from protein sequences. Science 252, 1162-l 164.

coiled coils

Ma, H. (1993). Protein phosphorylation in plants: enzymes, substrates, and regulators. Trends Genet. 9, 228-230. Maldonado. F., and Hanks, S. K. (1988). A cDNA clone encoding human CAMP-dependent protein kinase catalytic subunit Cu. Nucl. Acids Res. 16, 8189-8190. Mandel,

M. A., Gustafson-Brown,

C., Savldge.

B., and Yanofsky,

Cell 950

M. F. (1992). Molecular characterization of the Arabidopsis meotic gene APETALAI. Nature 360, 273-277.

floral ho-

Sussex, I. M. (1989). Developmental stem. Cell 56, 225-229.

programming

of the shoot meri-

Marchuk, D., Drumm, M., Saulino, A., and Collins, F. S. (1991). Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucl. Acids Res. 79, 1154.

Szymkowiak, E. J., and Sussex, I. M. (1992). The internal meristem layer (L3) determines floral meristem size and carpel number in tomato periclinal chimeras. Plant Cell 4, 1089-l 100.

Martinez, M. C., Jogensen, J.-E., Lawton, M. A., Lamb, C.J., and Doerner, P. W. (1992). Spatial pattern of cdc2 expression in relation to meristem activity and cell proliferation during plant development. Proc. Natl. Acad. Sci. USA 89, 7360-7364.

Trobner, W., Ramirez, L., Motte, P., Hue, I., Huijser, P., Lonnig, W.-E., Saedler, H., Sommer, H., and Schwarz-Sommer, Z. (1992). GLOBOSA: a homeotic gene which interacts with DEFICIENS in the control of Antirrhinum floral organogenesis. EMBO J. 7 7, 4693-4704.

Martinez-Zapater, J. M., and Somerville, C. Ft. (1990). The effect of light quality and vernalization on late flowering mutants of Arabidopsis thaliana. Plant Physiol. 92, 770-776.

Yanofsky, M. F., Ma, H., Bowman, J. L., Drews, G. N., Feldmann, K. A., and Meyerowitz, E. M. (1990). The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature 346, 35-39.

Marton, L., and Browse, J. (1991). Facile transformation dopsis. Plant Cell 70, 235-239.

of Arabi-

McLeod, M., and Beach, D. (1986). Homology between theranl’gene of fission yeast and protein kinases. EMBO J. 5, 3665- 3671. Medford, J. I., Behringer, F. J., Callos, J. D., and Feldmann, K. A. (1992). Normal and abnormal development in the Arabidopsis vegetative shoot apex. Plant Cell 4, 631-643. Nam. H., Giraudat, J., Den Boer, B., Moonan, F., Loos, W. D. B., Hauge, B., and Goodman, H. M. (1989). Restriction fragment length polymorphism linkage map of Arabidopsis thaliana. Plant Cell 7,699705. Okada, K., Komaki, M. K., and Shimura. Y. (1989). Mutational analysis of pistil structure and development of Arabidopsis fhaliana. Cell Diff. Dev. 28, 27-38. Poethig, R. S. (1989). Genetic mosaics and cell lineage analysis in plants. Trends Genet. 5, 273-277. Pruitt, R. E., and Meyerowitz, E. M. (1986). Characterization genome of Arabidopsis thaliana. J. Mol. Biol. 787, 169-183.

of the

Robbins, J., Dilworth, S. M., Laskey, R. A., and Dingwall, C. (1991). Two interdependent basicdomains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence. Cell 64, 615-623. Rogers, S. G., Klee, H. J., Horsch, R. B., and Fraley, R. T. (1987). Improved vectors for plant transformation: expression cassette vectors and new selectable markers. Meth. Enzymol. 153, 253-277. Saiki. R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullins, K. B., and Ehrlich, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239,487-491, Sambrook, J., Fritsch, E. J., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press). Sanger, F., Niclen, S.. and Coulsen, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74,54635467. Schultz, E. A., Pickett, F. B., and Haughn, G. W. (1991). The FL010 gene product regulates the expression domain of homeotic genes Ap3 and Pi in Arabidopsis flowers, Plant Cell 3, 1221-1237. Schwarz-Sommer, Z., Huijser, P., Nacken, W., Saedler, H., and Sommer, H. (1990). Genetic control of flower development by homeotic genes in Antirrhinum ma@. Science 250, 931-936. Schwarz-Sommer. Z.. Hue, I., Huijser, P., Flor, P. J., Hansen, R., Tetens. F., Lonnig, W., Saedler, H., and Sommer. H. (1992). Characterization of the Antirrhinum floral homeotic MADS box gene deficiens: evidence for DNA binding and autoregulation of its persistent expression through flower development. EMBO J. 77, 251-263. Shannon, S., and Meek+Wagner, D. R. (1993). Genetic interactions that regulate inflorescence development in Arabidopsis. Plant Cell 5, 639-655. Smyth, D. R., Bowman, J. L., and Meyerowitz, E. M. (1990). Early flower development in Arabidopsis. Plant Cell 2, 755-767. Sommer, H., Beltran, J.-P., Huijser, P.. Pape, H., Lonnig, W.-E., Saedler, H., and Schwartz-Sommer, Z. (1990). Deficiens, a homeotic gene involved in the control of flower morphogenesis in Antirrhinum majus: the protein shows homology to transcription factors, EMBO J. 9. 605-613.

GenBank Accession Number The accession number for the sequence L23985.

reported

in this paper is