- Email: [email protected]
The tryptophan hydroxylase (TPH) 2 gene unlike TPH-1 exhibits no association with stress-induced depression
Journal of Affective Disorders 107 (2008) 175 – 179 www.elsevier.com/locate/jad
Brief report
The tryptophan hydroxylase (TPH ) 2 gene unlike TPH-1 exhibits no association with stress-induced depression Rinat Gizatullin a,b , Ghazal Zaboli a,c,⁎, Erik G. Jönsson a , Marie Åsberg a , Rosario Leopardi a,b a
Department of Clinical Neuroscience, Psychiatry Section, Karolinska University Hospital, SE-17176 Stockholm, Sweden b Center for Molecular Medicine, Karolinska Institute, SE-17176 Stockholm, Sweden c Karolinska Biomics Center, Karolinska University Hospital, SE-17176 Stockholm, Sweden Received 10 May 2007; received in revised form 6 July 2007; accepted 7 July 2007 Available online 10 August 2007
Abstract Background: Serotonin (5-HT) has been implicated in the pathophysiology of several psychiatric disorders including major depression (MD). Tryptophan hydroxylase (TPH) is the rate-limiting enzyme in the biosynthesis of serotonin (5-HT), and might be related to the pathogenesis of MD. Two isoforms are known, TPH-1 and TPH-2. Their association with MD is still debated. Methods: A case-control design was used for candidate gene-disease association in 194 patients with stress-induced MD, and 246 healthy controls, all North European Caucasians. Five TPH-2 polymorphisms were analyzed in terms of genotype, allele, and haplotype-based associations. Results: Neither single marker nor haplotype-based analyses showed significant associations between TPH-2 and MD. Limitations: The interpretations are limited by the restricted population size. Conclusions: There was no association between TPH-2 gene variants and MD in the same population that had shown a strong association with TPH-1. Hence, the results suggest that in this particular group of stress-induced depression patients TPH-1 appears to be more relevant to MD pathogenesis than TPH-2. © 2007 Elsevier B.V. All rights reserved. Keywords: Depression; Haplotype; Serotonin; SNP; Stress; TPH-2
1. Introduction Sustained psychosocial stress is an increasingly important factor in the development of illness, physical as well as mental (Kivimaki et al., 1997; Levi, 1997; Tennant, 2001). In Sweden, sick-leave cost has more than doubled in recent years, and in 2003 the number of workers on long-term sick ⁎ Corresponding author. Karolinska University Hospital, KarolinskaBiomic Center, KBC, Z5:01, 17 176 Stockholm, Sweden. Tel.: +46 739 75 74 60 (Mobile); fax: +46 8 517 76 180. E-mail address: [email protected] (G. Zaboli). 0165-0327/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jad.2007.07.005
leaves (more than 30 days) increased to all-time high levels (Statistics Sweden 2004). In a study of over 500 patients on long-term sick leave for an affective disorder, about 80% met DSM-IV criteria for major depression (MD) at some time during their illness (MÅ, unpublished data). Mental and physical exhaustions were the most prominent symptoms, which tended to persist after the depressive symptoms had cleared, with pronounced tendency to recurrence. The cortisol response to corticotropin-releasing hormone (CRH) was recently analyzed in these patients (Rydmark et al., 2006). The results showed an attenuated dexamethasone–CRH response, a feature opposite to that
176
R. Gizatullin et al. / Journal of Affective Disorders 107 (2008) 175–179
observed in patients with MD (Heuser et al., 1994). This suggested that stress-induced MD may differ biologically from other depressions. Alterations in the serotonin (5-HT) system have been related to the origin of depression (Ressler and Nemeroff, 2000). Serotonergic neurotransmission is related to anxiety in animal models as well as in humans (Cloninger, 1987; Griebel, 1995; Handley, 1995). Clinically, reduced 5-HT uptake is associated with depression and anxiety (Faludi et al., 1994; Iny et al., 1994; Owens and Nemeroff, 1994). 5-HT has a role in stress management, as 5-HT turnover is particularly active in cortical and limbic areas involved in emotional aspects of behavior (Westenberg, 1996; Whitaker-Azmitia et al., 1990). Several genes of the serotonergic system have been correlated with depression by gene polymorphism association studies (Malhi et al., 2000). The tryptophan hydroxylase (TPH) gene, coding for the rate-limiting enzyme in the biosynthesis of 5-HT (Cooper and Melcer, 1961), might be involved in pathogenesis events involving dysfunction of the 5-HT system. Thus, TPH is one of the major candidate genes for psychiatric and behavioral disorders, in particular depression and suicidal behavior (Roy et al., 1997). Until recently, only one TPH isoform was known, referred to as TPH-1. Several studies have shown associations between TPH-1 polymorphisms and psychiatric disorders (Courtet et al., 2005). A second TPH isoform, thereby named TPH-2, was recently described (Walther and Bader, 2003). Its gene shows 71% homology to TPH-1 on the amino acid level (Walther and Bader, 2003). Association between TPH-2 polymorphisms and major depression, first reported in Caucasians (Zill et al., 2004b), was confirmed in a larger study including several ethnic groups (Zhou et al., 2005). Both groups reported an association between TPH-2 and suicide (Zhou et al., 2005; Zill et al., 2004b). We have recently reported a haplotype-based study showing strong association between the TPH-1 gene and MD in subjects that had been exposed to prolonged psychosocial stress (Gizatullin et al., 2006). Given the interplay between the TPH-1 and TPH-2 in key brain areas related to MD, and their possible role in MD pathogenesis, we report here the results of a study done on TPH-2 in the same population. 2. Materials and methods 2.1. Human subjects These studies were approved by the Ethics Committee of the Karolinska Hospital. All subjects were unrelated Caucasians of North European descent living
in the Stockholm County. Cases and controls, described earlier (Gizatullin et al., 2006; Gustavsson et al., 1999; Jonsson et al., 2003), were matched for age, ethnicity, and geographical distribution. All subjects were interviewed using the Structured Clinical Interview for DSM-III-R (Spitzer et al., 1992) or DSM-IV (First et al., 2002). The control group included 246 individuals (mean age ± standard deviation: 41.0 ± 11.2 years, 95 women and 151 men). They were healthy individuals, mainly staff, students, or subjects drawn from the general population, from previous biological psychiatric studies performed at the Karolinska Institute. Only those individuals judged to be free from any lifetime psychiatric illness at the time of the interview, performed in conjunction with blood collection for DNA sampling, were included in the present analysis. The MD patient group was composed of 194 subjects (mean age ± standard deviation: 45.5 ± 9.3, 141 women and 53 men). Patients were recruited from a major insurance company while on long-term (over 3 months) sick leave for any affective or stress-related mental disorder. Letters were sent to the patients, who were then approached by telephone, and invited to participate in a clinical study. All patients were ambulatory, and none had received inpatient care for their current illness. Patients meeting DSM-IV criteria for Major Depressive Disorder at any time during the current sick-leave period were included. Patients co-morbid for any other psychiatric or personality disorders were excluded. Likely eliciting factors were: work-related stress (39%), stressful family relationships (9.3%), a combination of work and family stressors (49.3%), or not identified (2.1%). 2.2. Genotyping Venous blood was drawn and immediately frozen in aliquots at −70 ° C or below until analyzed. Genomic DNA was prepared from whole blood as previously described (Geijer et al., 2000; Gizatullin et al., 2006). TPH-2 genotyping was performed by pyrosequencing or by cleavage with restriction enzymes. First, DNA (50 ng/reaction) was amplified by polymerase chain reaction (PCR). Thereafter, for the rs1386495 and rs1386494 polymorphisms the PCR products were digested overnight with appropriate restriction enzymes (listed in Table 1), separated by electrophoresis on 2% agarose gels (Roche Diagnostic GmbH), and visualized after an ethidium bromide staining. The rs10748185, rs2129575, and rs7305115 polymorphisms were analyzed by pyrosequencing, using a Pyrosequencer PSQ 96 and a
R. Gizatullin et al. / Journal of Affective Disorders 107 (2008) 175–179
177
Table 1 Primers for PCR amplification and pyrosequencing Marker SNP ID a
SNP position b Primer sequence
1
rs10748185 33169
2
rs2129575
37386
3
rs1386495
49636
4
rs1386494
49859
5
rs7305115
70176
a b c
Annealing temperature Restriction enzyme Primer position b
AGACTATTGCCAGGTTAGGAG TTCGCAAAAAGATACATTAAGAC CTTAAGTAGCAAGAGCCTGCAA GGTGTTTGAAAAGCCTAGTTA GAAGGTATCATAAGGTGGGTATA GGATCAATGCCTGGACACTA TGGCATTTGTAAAAGTTATTCTCC ACACATCCCTGGCAATTGATTT GCTCACCCAAATTGAATGTGCCT GACACTGCAAACCTGTTTCTCGC AGAAAGGTCTGGCTTCACGGTGAG CGAGCCAGAGCTGGAATATCAGG TGGCTCAGATCCCCTCTACACC
55 °C
Pyr. c
55 °C
Pyr. c
55 °C
Tsp45I
55 °C
MspI
55 °C
Pyr. c
33059–33079 33283–333 33145–33165 37270–37290 37576–37598 37365–37384 49521–49544 49830–49851 50028–50050 49638–49660 70044–70067 70370–70392 70152–70173
SNP ID number from the NCBI SNP database (http://www.ncbi.nlm.nih.gov/SNP/). SNP and primer positions are shown based on NCBI clone AC090109. Pyrosequencing.
Zhou et al. (2005)], respectively. Three more SNPs were added, to cover totally a ca 37 kb gene region spanning up- and downstream of the two SNPs (Table 1). The SNPs were chosen from the NCBI database after a preliminary screening to ascertain that the minor allele was above 10% in the Swedish population. The study population was not tested for any other TPH-2 polymorphisms. All polymorphisms were in Hardy– Weinberg equilibrium. Single locus association tests are summarized in Table 2. No significant association was observed, with the exception of a borderline genotype association between the TPH-2 rs7305115 polymorphism and MD, which did not pass correction for multiple testing. All SNPs were in strong LD with exceptions for rs2129575 paired with rs1386495 and rs1386494 (data not shown). This indicated that all analyzed SNPs except for rs2129575 may belong to the same haplotype block.
PSQ 96 SNP Reagent Kit (Pyrosequencer, Uppsala, Sweden) according to the manufacturer's instructions. 2.3. Statistical analysis For association analyses of individual genotypes, chisquare analysis on 2 × 3 contingency tables was carried out. The significance level for all statistical tests was 0.05. For single marker association statistics, pair wise linkage disequilibrium (LD) and haplotype frequencies, the Haploview program version 3.32 was used, available at http:// www.broad.mit.edu/mpg/haploview (Barrett et al., 2005). 3. Results We centered the haplotype analysis on two SNPs previously reported to associate with MD in Central European [rs1386494; (Zill et al., 2004b)] and U.S. Caucasians, [rs1386495, indicated as C_8872342 in Table 2 TPH-2 allele and genotype association tests SNP a
1 2 3 4 5
Allelic tests
Genotypic tests
Assoc. allele
MD, control frequency
P-value
A T G A A
0.48, 0.45 0.25, 0.24 0.16, 0.14 0.16, 0.12 0.45, 0.44
0.445 0.607 0.378 0.060 0.754
b
P-value b
Allele 1/ allele 2
Controls 1–1
1–2
2–2
1–1
1–2
2–2
A/G A/G G/T A/G A/G
2 176 142 53 62
74 72 93 114 116
175 3 16 84 73
3 144 112 45 30
43 47 68 104 96
148 3 14 45 68
Genotypic tests based on number of individuals carrying each genotype. a Same SNP numbering as in Table 1. b Not corrected for multiple testing.
MD
0.181 0.557 0.877 0.579 0.049
178
R. Gizatullin et al. / Journal of Affective Disorders 107 (2008) 175–179
Table 3 TPH-2 haplotype frequencies in the study population 5-Marker haplotypes
Controls
MD
Chi-square
P-value
AGAGG GTAGA GGGAA GGAGG GGAGA GGAAA GTAGG GGGGA AGAGA AGGGG
0.421 0.207 0.089 0.098 0.079 0.023 0.019 0.023 0.009 0.013
0.399 0.182 0.100 0.083 0.055 0.031 0.023 0.017 0.026 0.013
0.462 0.880 0.347 0.605 2.063 0.624 0.165 0.382 3.835 0.002
2.48 1.74 2.77 2.18 0.75 2.14 3.42 2.68 0.25 4.84
Only haplotypes above 1% are concluded in the analysis as shown by total frequencies which indicate the occurrence rate in the entire population. The P-values are Bonferroni corrected.
The gene-based 5-marker haplotype analysis revealed five common haplotypes, all with a frequency above 5%, which were carried by about 85% of the entire study population. Only haplotypes with a frequency above 1% were included in the Haploview analysis. No significant associations were observed for any of the haplotypes when comparing the MD patients and control frequencies (Table 3).
and are important for the processing of psychosocial stress (Chaouloff, 1993; Graeff, 1993). These data may also explain several association studies supporting a TPH-1 involvement in psychiatric disorders, including but not limited to affective disorders and suicide, (Jokela et al., 2006; Liu et al., 2006; Sun et al., 2004). Studies on the role of genetic susceptibility to stressful life events have implicated the 5-HT system (Caspi et al., 2003). Our results, if confirmed by replica studies, would strengthen the notion that the 5-HT system is also involved in genetic susceptibility to psychosocial stress. Role of funding source Financial support was received from the Swedish Research Council (MA, RL, and EGJ), the Wallenberg foundation (EGJ), the HUBIN project (EGJ), and from the Swedish Labour Market Insurance Company (in Swedish AFA; MA and RL). The above mentioned organisations had no further role in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication. Conflict of interest All authors declare that they have no conflicts of interest.
4. Discussion
References
No association was observed between TPH-2 and MD. The same population had been previously shown to associate strongly with TPH-1 (Gizatullin et al., 2006). While the population size was limited, and small genetic effects may not be captured, TPH-1 seems more important than TPH-2 to MD pathogenesis within this study population. Our results differ from Zill et al. (2004b) and Van Den Bogaert et al. (2006), who reported association between TPH-2 haplotypes and MD in Caucasians. It is tempting to suggest that our patients suffer from a depression biologically different from other forms of MD. This is indicated by the attenuated dex–CRH response in this group (Rydmark et al., 2006), a feature opposite to that described in MD (Heuser et al., 1994). Thus, our data would suggest that TPH-1 is more important than TPH-2 in stress-related depression. Indeed, while TPH-2 is localized in the human brain more specifically than TPH-1 (Zill et al., 2004a) and is expressed in much higher levels in the neurons of raphe nuclei (Bach-Mizrachi et al., 2006), recent post-mortem studies have shown significantly higher TPH-1 mRNA levels in the amygdala, and even more in the hypothalamus (Zill et al., 2007a,b). These regions contain 5-HT nerve terminals and/or 5-HT receptors,
Bach-Mizrachi, H., Underwood, M.D., Kassir, S.A., Bakalian, M.J., Sibille, E., Tamir, H., Mann, J.J., Arango, V., 2006. Neuronal tryptophan hydroxylase mRNA expression in the human dorsal and median raphe nuclei: major depression and suicide. Neuropsychopharmacology 31, 814–824. Barrett, J.C., Fry, B., Maller, J., Daly, M.J., 2005. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21, 263–265. Caspi, A., Sugden, K., Moffitt, T.E., Taylor, A., Craig, I.W., Harrington, H., McClay, J., Mill, J., Martin, J., Braithwaite, A., Poulton, R., 2003. Influence of life stress on depression: moderation by a polymorphism in the 5-HTT gene. Science 301, 386–389. Chaouloff, F., 1993. Physiopharmacological interactions between stress hormones and central serotonergic systems. Brain Res. Brain Res. Rev. 18, 1–32. Cloninger, C.R., 1987. A systematic method for clinical description and classification of personality variants. A proposal. Arch. Gen. Psychiatry 44, 573–588. Cooper, J.R., Melcer, I., 1961. The enzymic oxidation of tryptophan to 5-hydroxytryptophan in the biosynthesis of serotonin. J. Pharmacol. Exp. Ther. 132, 265–268. Courtet, P., Jollant, F., Castelnau, D., Buresi, C., Malafosse, A., 2005. Suicidal behavior: relationship between phenotype and serotonergic genotype. Am. J. Med. Genet. C. Semin Med Genet 133, 25–33. Faludi, G., Tekes, K., Tothfalusi, L., 1994. Comparative study of platelet 3H-paroxetine and 3H-imipramine binding in panic disorder patients and healthy controls. J. Psychiatry Neurosci. 19, 109–113.
R. Gizatullin et al. / Journal of Affective Disorders 107 (2008) 175–179 First, M.B., Spitzer, R.L., Gibbon, M.W., Janet, B.W., 2002. Structured Clinical Interview for DSM-IV-TR Axis I Disorders, Research Version, Non-Patient Edition. SCID-I/NP. Geijer, T., Frisch, A., Persson, M.L., Wasserman, D., Rockah, R., Michaelovsky, E., Apter, A., Jonsson, E.G., Nothen, M.M., Weizman, A., 2000. Search for association between suicide attempt and serotonergic polymorphisms. Psychiatr. Genet. 10, 19–26. Gizatullin, R., Zaboli, G., Jonsson, E.G., Asberg, M., Leopardi, R., 2006. Haplotype analysis reveals tryptophan hydroxylase (TPH) 1 gene variants associated with major depression. Biol. Psychiatry 59, 295–300. Graeff, F.G., 1993. Role of 5-HT in defensive behavior and anxiety. Rev. Neurosci. 4, 181–211. Griebel, G., 1995. 5-Hydroxytryptamine-interacting drugs in animal models of anxiety disorders: more than 30 years of research. Pharmacol. Ther. 65, 319–395. Gustavsson, J.P., Nothen, M.M., Jonsson, E.G., Neidt, H., Forslund, K., Rylander, G., Mattila-Evenden, M., Sedvall, G.C., Propping, P., Asberg, M., 1999. No association between serotonin transporter gene polymorphisms and personality traits. Am. J. Med. Genet. 88, 430–436. Handley, S.L., 1995. 5-Hydroxytryptamine pathways in anxiety and its treatment. Pharmacol. Ther. 66, 103–148. Heuser, I., Yassouridis, A., Holsboer, F., 1994. The combined dexamethasone/CRH test: a refined laboratory test for psychiatric disorders. J. Psychiatr. Res. 28, 341–356. Iny, L.J., Pecknold, J., Suranyi-Cadotte, B.E., Bernier, B., Luthe, L., Nair, N.P., Meaney, M.J., 1994. Studies of a neurochemical link between depression, anxiety, and stress from [3H]imipramine and [3H]paroxetine binding on human platelets. Biol. Psychiatry 36, 281–291. Jokela, M., Raikkonen, K., Lehtimaki, T., Rontu, R., KeltikangasJarvinen, L., 2006. Tryptophan hydroxylase 1 gene (TPH1) moderates the influence of social support on depressive symptoms in adults. J. Affect. Disord. 100, 191–197. Jonsson, E.G., Norton, N., Forslund, K., Mattila-Evenden, M., Rylander, G., Asberg, M., Owen, M.J., Sedvall, G.C., 2003. Association between a promoter variant in the monoamine oxidase A gene and schizophrenia. Schizophr. Res. 61, 31–37. Kivimaki, M., Vahtera, J., Thomson, L., Griffiths, A., Cox, T., Pentti, J., 1997. Psychosocial factors predicting employee sickness absence during economic decline. J. Appl. Psychol. 82, 858–872. Levi, L., 1997. Psychosocial environmental factors and psychosocially mediated effects of physical environmental factors. Scand. J. Work, Environ. & Health 23 (Suppl 3), 47–52. Liu, X., Li, H., Qin, W., He, G., Li, D., Shen, Y., Shen, J., Gu, N., Feng, G., He, L., 2006. Association of TPH1 with suicidal behaviour and psychiatric disorders in the Chinese population. J. Med. Genet. 43, e4. Malhi, G.S., Moore, J., McGuffin, P., 2000. The genetics of major depressive disorder. Curr. Psychiatry Rep. 2, 165–169. Owens, M.J., Nemeroff, C.B., 1994. Role of serotonin in the pathophysiology of depression: focus on the serotonin transporter. Clin. Chem. 40, 288–295.
179
Ressler, K.J., Nemeroff, C.B., 2000. Role of serotonergic and noradrenergic systems in the pathophysiology of depression and anxiety disorders. Depress. Anxiety 12 (Suppl 1), 2–19. Roy, A., Rylander, G., Sarchiapone, M., 1997. Genetic studies of suicidal behavior. Psychiatr. Clin. North Am. 20, 595–611. Rydmark, I., Wahlberg, K., Ghatan, P.H., Modell, S., Nygren, A., Ingvar, M., Asberg, M., Heilig, M., 2006. Neuroendocrine, cognitive and structural imaging characteristics of women on longterm sickleave with job stress-induced depression. Biol. Psychiatry 60, 867–873. Spitzer, R.L., Williams, J.B., Gibbon, M., First, M.B., 1992. The Structured Clinical Interview for DSM-III-R (SCID). I: history, rationale, and description. Arch. Gen. Psychiatry 49, 624–629. Sun, H.S., Tsai, H.W., Ko, H.C., Chang, F.M., Yeh, T.L., 2004. Association of tryptophan hydroxylase gene polymorphism with depression, anxiety and comorbid depression and anxiety in a population-based sample of postpartum Taiwanese women. Genes Brain Behav 3, 328–336. Tennant, C., 2001. Work-related stress and depressive disorders. J. Psychosom. Res. 51, 697–704. Van Den Bogaert, A., Sleegers, K., De Zutter, S., Heyrman, L., Norrback, K.F., Adolfsson, R., Van Broeckhoven, C., Del-Favero, J., 2006. Association of brain-specific tryptophan hydroxylase, TPH2, with unipolar and bipolar disorder in a Northern Swedish, isolated population. Arch. Gen. Psychiatry 63, 1103–1110. Walther, D.J., Bader, M., 2003. A unique central tryptophan hydroxylase isoform. Biochem. Pharmacol. 66, 1673–1680. Westenberg, H.G., 1996. Developments in the drug treatment of panic disorder: what is the place of the selective serotonin reuptake inhibitors? J. Affect. Disord. 40, 85–93. Whitaker-Azmitia, P.M., Shemer, A.V., Caruso, J., Molino, L., Azmitia, E.C., 1990. Role of high affinity serotonin receptors in neuronal growth. Ann. N.Y. Acad. Sci. 600, 315–330. Zhou, Z., Roy, A., Lipsky, R., Kuchipudi, K., Zhu, G., Taubman, J., Enoch, M.A., Virkkunen, M., Goldman, D., 2005. Haplotypebased linkage of tryptophan hydroxylase 2 to suicide attempt, major depression, and cerebrospinal fluid 5-hydroxyindoleacetic acid in 4 populations. Arch. Gen. Psychiatry 62, 1109–1118. Zill, P., Baghai, T.C., Zwanzger, P., Schule, C., Eser, D., Rupprecht, R., Moller, H.J., Bondy, B., Ackenheil, M., 2004a. SNP and haplotype analysis of a novel tryptophan hydroxylase isoform (TPH2) gene provide evidence for association with major depression. Mol. Psychiatry 9, 1030–1036. Zill, P., Buttner, A., Eisenmenger, W., Bondy, B., Ackenheil, M., 2004b. Regional mRNA expression of a second tryptophan hydroxylase isoform in postmortem tissue samples of two human brains. Eur. Neuropsychopharmacol. 14, 282–284. Zill, P., Buttner, A., Eisenmenger, W., Moller, H.J., Ackenheil, M., Bondy, B., 2007a. Analysis of tryptophan hydroxylase I and II mRNA expression in the human brain: a post-mortem study. J. Psychiatr. Res. 41, 168–173. Zill, P., Preuss, U.W., Koller, G., Bondy, B., Soyka, M., 2007b. SNPand haplotype analysis of the tryptophan hydroxylase 2 gene in alcohol-dependent patients and alcohol-related suicide. Neuropsychopharmacology 32, 1687–1694.
Brief report
The tryptophan hydroxylase (TPH ) 2 gene unlike TPH-1 exhibits no association with stress-induced depression Rinat Gizatullin a,b , Ghazal Zaboli a,c,⁎, Erik G. Jönsson a , Marie Åsberg a , Rosario Leopardi a,b a
Department of Clinical Neuroscience, Psychiatry Section, Karolinska University Hospital, SE-17176 Stockholm, Sweden b Center for Molecular Medicine, Karolinska Institute, SE-17176 Stockholm, Sweden c Karolinska Biomics Center, Karolinska University Hospital, SE-17176 Stockholm, Sweden Received 10 May 2007; received in revised form 6 July 2007; accepted 7 July 2007 Available online 10 August 2007
Abstract Background: Serotonin (5-HT) has been implicated in the pathophysiology of several psychiatric disorders including major depression (MD). Tryptophan hydroxylase (TPH) is the rate-limiting enzyme in the biosynthesis of serotonin (5-HT), and might be related to the pathogenesis of MD. Two isoforms are known, TPH-1 and TPH-2. Their association with MD is still debated. Methods: A case-control design was used for candidate gene-disease association in 194 patients with stress-induced MD, and 246 healthy controls, all North European Caucasians. Five TPH-2 polymorphisms were analyzed in terms of genotype, allele, and haplotype-based associations. Results: Neither single marker nor haplotype-based analyses showed significant associations between TPH-2 and MD. Limitations: The interpretations are limited by the restricted population size. Conclusions: There was no association between TPH-2 gene variants and MD in the same population that had shown a strong association with TPH-1. Hence, the results suggest that in this particular group of stress-induced depression patients TPH-1 appears to be more relevant to MD pathogenesis than TPH-2. © 2007 Elsevier B.V. All rights reserved. Keywords: Depression; Haplotype; Serotonin; SNP; Stress; TPH-2
1. Introduction Sustained psychosocial stress is an increasingly important factor in the development of illness, physical as well as mental (Kivimaki et al., 1997; Levi, 1997; Tennant, 2001). In Sweden, sick-leave cost has more than doubled in recent years, and in 2003 the number of workers on long-term sick ⁎ Corresponding author. Karolinska University Hospital, KarolinskaBiomic Center, KBC, Z5:01, 17 176 Stockholm, Sweden. Tel.: +46 739 75 74 60 (Mobile); fax: +46 8 517 76 180. E-mail address: [email protected] (G. Zaboli). 0165-0327/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jad.2007.07.005
leaves (more than 30 days) increased to all-time high levels (Statistics Sweden 2004). In a study of over 500 patients on long-term sick leave for an affective disorder, about 80% met DSM-IV criteria for major depression (MD) at some time during their illness (MÅ, unpublished data). Mental and physical exhaustions were the most prominent symptoms, which tended to persist after the depressive symptoms had cleared, with pronounced tendency to recurrence. The cortisol response to corticotropin-releasing hormone (CRH) was recently analyzed in these patients (Rydmark et al., 2006). The results showed an attenuated dexamethasone–CRH response, a feature opposite to that
176
R. Gizatullin et al. / Journal of Affective Disorders 107 (2008) 175–179
observed in patients with MD (Heuser et al., 1994). This suggested that stress-induced MD may differ biologically from other depressions. Alterations in the serotonin (5-HT) system have been related to the origin of depression (Ressler and Nemeroff, 2000). Serotonergic neurotransmission is related to anxiety in animal models as well as in humans (Cloninger, 1987; Griebel, 1995; Handley, 1995). Clinically, reduced 5-HT uptake is associated with depression and anxiety (Faludi et al., 1994; Iny et al., 1994; Owens and Nemeroff, 1994). 5-HT has a role in stress management, as 5-HT turnover is particularly active in cortical and limbic areas involved in emotional aspects of behavior (Westenberg, 1996; Whitaker-Azmitia et al., 1990). Several genes of the serotonergic system have been correlated with depression by gene polymorphism association studies (Malhi et al., 2000). The tryptophan hydroxylase (TPH) gene, coding for the rate-limiting enzyme in the biosynthesis of 5-HT (Cooper and Melcer, 1961), might be involved in pathogenesis events involving dysfunction of the 5-HT system. Thus, TPH is one of the major candidate genes for psychiatric and behavioral disorders, in particular depression and suicidal behavior (Roy et al., 1997). Until recently, only one TPH isoform was known, referred to as TPH-1. Several studies have shown associations between TPH-1 polymorphisms and psychiatric disorders (Courtet et al., 2005). A second TPH isoform, thereby named TPH-2, was recently described (Walther and Bader, 2003). Its gene shows 71% homology to TPH-1 on the amino acid level (Walther and Bader, 2003). Association between TPH-2 polymorphisms and major depression, first reported in Caucasians (Zill et al., 2004b), was confirmed in a larger study including several ethnic groups (Zhou et al., 2005). Both groups reported an association between TPH-2 and suicide (Zhou et al., 2005; Zill et al., 2004b). We have recently reported a haplotype-based study showing strong association between the TPH-1 gene and MD in subjects that had been exposed to prolonged psychosocial stress (Gizatullin et al., 2006). Given the interplay between the TPH-1 and TPH-2 in key brain areas related to MD, and their possible role in MD pathogenesis, we report here the results of a study done on TPH-2 in the same population. 2. Materials and methods 2.1. Human subjects These studies were approved by the Ethics Committee of the Karolinska Hospital. All subjects were unrelated Caucasians of North European descent living
in the Stockholm County. Cases and controls, described earlier (Gizatullin et al., 2006; Gustavsson et al., 1999; Jonsson et al., 2003), were matched for age, ethnicity, and geographical distribution. All subjects were interviewed using the Structured Clinical Interview for DSM-III-R (Spitzer et al., 1992) or DSM-IV (First et al., 2002). The control group included 246 individuals (mean age ± standard deviation: 41.0 ± 11.2 years, 95 women and 151 men). They were healthy individuals, mainly staff, students, or subjects drawn from the general population, from previous biological psychiatric studies performed at the Karolinska Institute. Only those individuals judged to be free from any lifetime psychiatric illness at the time of the interview, performed in conjunction with blood collection for DNA sampling, were included in the present analysis. The MD patient group was composed of 194 subjects (mean age ± standard deviation: 45.5 ± 9.3, 141 women and 53 men). Patients were recruited from a major insurance company while on long-term (over 3 months) sick leave for any affective or stress-related mental disorder. Letters were sent to the patients, who were then approached by telephone, and invited to participate in a clinical study. All patients were ambulatory, and none had received inpatient care for their current illness. Patients meeting DSM-IV criteria for Major Depressive Disorder at any time during the current sick-leave period were included. Patients co-morbid for any other psychiatric or personality disorders were excluded. Likely eliciting factors were: work-related stress (39%), stressful family relationships (9.3%), a combination of work and family stressors (49.3%), or not identified (2.1%). 2.2. Genotyping Venous blood was drawn and immediately frozen in aliquots at −70 ° C or below until analyzed. Genomic DNA was prepared from whole blood as previously described (Geijer et al., 2000; Gizatullin et al., 2006). TPH-2 genotyping was performed by pyrosequencing or by cleavage with restriction enzymes. First, DNA (50 ng/reaction) was amplified by polymerase chain reaction (PCR). Thereafter, for the rs1386495 and rs1386494 polymorphisms the PCR products were digested overnight with appropriate restriction enzymes (listed in Table 1), separated by electrophoresis on 2% agarose gels (Roche Diagnostic GmbH), and visualized after an ethidium bromide staining. The rs10748185, rs2129575, and rs7305115 polymorphisms were analyzed by pyrosequencing, using a Pyrosequencer PSQ 96 and a
R. Gizatullin et al. / Journal of Affective Disorders 107 (2008) 175–179
177
Table 1 Primers for PCR amplification and pyrosequencing Marker SNP ID a
SNP position b Primer sequence
1
rs10748185 33169
2
rs2129575
37386
3
rs1386495
49636
4
rs1386494
49859
5
rs7305115
70176
a b c
Annealing temperature Restriction enzyme Primer position b
AGACTATTGCCAGGTTAGGAG TTCGCAAAAAGATACATTAAGAC CTTAAGTAGCAAGAGCCTGCAA GGTGTTTGAAAAGCCTAGTTA GAAGGTATCATAAGGTGGGTATA GGATCAATGCCTGGACACTA TGGCATTTGTAAAAGTTATTCTCC ACACATCCCTGGCAATTGATTT GCTCACCCAAATTGAATGTGCCT GACACTGCAAACCTGTTTCTCGC AGAAAGGTCTGGCTTCACGGTGAG CGAGCCAGAGCTGGAATATCAGG TGGCTCAGATCCCCTCTACACC
55 °C
Pyr. c
55 °C
Pyr. c
55 °C
Tsp45I
55 °C
MspI
55 °C
Pyr. c
33059–33079 33283–333 33145–33165 37270–37290 37576–37598 37365–37384 49521–49544 49830–49851 50028–50050 49638–49660 70044–70067 70370–70392 70152–70173
SNP ID number from the NCBI SNP database (http://www.ncbi.nlm.nih.gov/SNP/). SNP and primer positions are shown based on NCBI clone AC090109. Pyrosequencing.
Zhou et al. (2005)], respectively. Three more SNPs were added, to cover totally a ca 37 kb gene region spanning up- and downstream of the two SNPs (Table 1). The SNPs were chosen from the NCBI database after a preliminary screening to ascertain that the minor allele was above 10% in the Swedish population. The study population was not tested for any other TPH-2 polymorphisms. All polymorphisms were in Hardy– Weinberg equilibrium. Single locus association tests are summarized in Table 2. No significant association was observed, with the exception of a borderline genotype association between the TPH-2 rs7305115 polymorphism and MD, which did not pass correction for multiple testing. All SNPs were in strong LD with exceptions for rs2129575 paired with rs1386495 and rs1386494 (data not shown). This indicated that all analyzed SNPs except for rs2129575 may belong to the same haplotype block.
PSQ 96 SNP Reagent Kit (Pyrosequencer, Uppsala, Sweden) according to the manufacturer's instructions. 2.3. Statistical analysis For association analyses of individual genotypes, chisquare analysis on 2 × 3 contingency tables was carried out. The significance level for all statistical tests was 0.05. For single marker association statistics, pair wise linkage disequilibrium (LD) and haplotype frequencies, the Haploview program version 3.32 was used, available at http:// www.broad.mit.edu/mpg/haploview (Barrett et al., 2005). 3. Results We centered the haplotype analysis on two SNPs previously reported to associate with MD in Central European [rs1386494; (Zill et al., 2004b)] and U.S. Caucasians, [rs1386495, indicated as C_8872342 in Table 2 TPH-2 allele and genotype association tests SNP a
1 2 3 4 5
Allelic tests
Genotypic tests
Assoc. allele
MD, control frequency
P-value
A T G A A
0.48, 0.45 0.25, 0.24 0.16, 0.14 0.16, 0.12 0.45, 0.44
0.445 0.607 0.378 0.060 0.754
b
P-value b
Allele 1/ allele 2
Controls 1–1
1–2
2–2
1–1
1–2
2–2
A/G A/G G/T A/G A/G
2 176 142 53 62
74 72 93 114 116
175 3 16 84 73
3 144 112 45 30
43 47 68 104 96
148 3 14 45 68
Genotypic tests based on number of individuals carrying each genotype. a Same SNP numbering as in Table 1. b Not corrected for multiple testing.
MD
0.181 0.557 0.877 0.579 0.049
178
R. Gizatullin et al. / Journal of Affective Disorders 107 (2008) 175–179
Table 3 TPH-2 haplotype frequencies in the study population 5-Marker haplotypes
Controls
MD
Chi-square
P-value
AGAGG GTAGA GGGAA GGAGG GGAGA GGAAA GTAGG GGGGA AGAGA AGGGG
0.421 0.207 0.089 0.098 0.079 0.023 0.019 0.023 0.009 0.013
0.399 0.182 0.100 0.083 0.055 0.031 0.023 0.017 0.026 0.013
0.462 0.880 0.347 0.605 2.063 0.624 0.165 0.382 3.835 0.002
2.48 1.74 2.77 2.18 0.75 2.14 3.42 2.68 0.25 4.84
Only haplotypes above 1% are concluded in the analysis as shown by total frequencies which indicate the occurrence rate in the entire population. The P-values are Bonferroni corrected.
The gene-based 5-marker haplotype analysis revealed five common haplotypes, all with a frequency above 5%, which were carried by about 85% of the entire study population. Only haplotypes with a frequency above 1% were included in the Haploview analysis. No significant associations were observed for any of the haplotypes when comparing the MD patients and control frequencies (Table 3).
and are important for the processing of psychosocial stress (Chaouloff, 1993; Graeff, 1993). These data may also explain several association studies supporting a TPH-1 involvement in psychiatric disorders, including but not limited to affective disorders and suicide, (Jokela et al., 2006; Liu et al., 2006; Sun et al., 2004). Studies on the role of genetic susceptibility to stressful life events have implicated the 5-HT system (Caspi et al., 2003). Our results, if confirmed by replica studies, would strengthen the notion that the 5-HT system is also involved in genetic susceptibility to psychosocial stress. Role of funding source Financial support was received from the Swedish Research Council (MA, RL, and EGJ), the Wallenberg foundation (EGJ), the HUBIN project (EGJ), and from the Swedish Labour Market Insurance Company (in Swedish AFA; MA and RL). The above mentioned organisations had no further role in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication. Conflict of interest All authors declare that they have no conflicts of interest.
4. Discussion
References
No association was observed between TPH-2 and MD. The same population had been previously shown to associate strongly with TPH-1 (Gizatullin et al., 2006). While the population size was limited, and small genetic effects may not be captured, TPH-1 seems more important than TPH-2 to MD pathogenesis within this study population. Our results differ from Zill et al. (2004b) and Van Den Bogaert et al. (2006), who reported association between TPH-2 haplotypes and MD in Caucasians. It is tempting to suggest that our patients suffer from a depression biologically different from other forms of MD. This is indicated by the attenuated dex–CRH response in this group (Rydmark et al., 2006), a feature opposite to that described in MD (Heuser et al., 1994). Thus, our data would suggest that TPH-1 is more important than TPH-2 in stress-related depression. Indeed, while TPH-2 is localized in the human brain more specifically than TPH-1 (Zill et al., 2004a) and is expressed in much higher levels in the neurons of raphe nuclei (Bach-Mizrachi et al., 2006), recent post-mortem studies have shown significantly higher TPH-1 mRNA levels in the amygdala, and even more in the hypothalamus (Zill et al., 2007a,b). These regions contain 5-HT nerve terminals and/or 5-HT receptors,
Bach-Mizrachi, H., Underwood, M.D., Kassir, S.A., Bakalian, M.J., Sibille, E., Tamir, H., Mann, J.J., Arango, V., 2006. Neuronal tryptophan hydroxylase mRNA expression in the human dorsal and median raphe nuclei: major depression and suicide. Neuropsychopharmacology 31, 814–824. Barrett, J.C., Fry, B., Maller, J., Daly, M.J., 2005. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21, 263–265. Caspi, A., Sugden, K., Moffitt, T.E., Taylor, A., Craig, I.W., Harrington, H., McClay, J., Mill, J., Martin, J., Braithwaite, A., Poulton, R., 2003. Influence of life stress on depression: moderation by a polymorphism in the 5-HTT gene. Science 301, 386–389. Chaouloff, F., 1993. Physiopharmacological interactions between stress hormones and central serotonergic systems. Brain Res. Brain Res. Rev. 18, 1–32. Cloninger, C.R., 1987. A systematic method for clinical description and classification of personality variants. A proposal. Arch. Gen. Psychiatry 44, 573–588. Cooper, J.R., Melcer, I., 1961. The enzymic oxidation of tryptophan to 5-hydroxytryptophan in the biosynthesis of serotonin. J. Pharmacol. Exp. Ther. 132, 265–268. Courtet, P., Jollant, F., Castelnau, D., Buresi, C., Malafosse, A., 2005. Suicidal behavior: relationship between phenotype and serotonergic genotype. Am. J. Med. Genet. C. Semin Med Genet 133, 25–33. Faludi, G., Tekes, K., Tothfalusi, L., 1994. Comparative study of platelet 3H-paroxetine and 3H-imipramine binding in panic disorder patients and healthy controls. J. Psychiatry Neurosci. 19, 109–113.
R. Gizatullin et al. / Journal of Affective Disorders 107 (2008) 175–179 First, M.B., Spitzer, R.L., Gibbon, M.W., Janet, B.W., 2002. Structured Clinical Interview for DSM-IV-TR Axis I Disorders, Research Version, Non-Patient Edition. SCID-I/NP. Geijer, T., Frisch, A., Persson, M.L., Wasserman, D., Rockah, R., Michaelovsky, E., Apter, A., Jonsson, E.G., Nothen, M.M., Weizman, A., 2000. Search for association between suicide attempt and serotonergic polymorphisms. Psychiatr. Genet. 10, 19–26. Gizatullin, R., Zaboli, G., Jonsson, E.G., Asberg, M., Leopardi, R., 2006. Haplotype analysis reveals tryptophan hydroxylase (TPH) 1 gene variants associated with major depression. Biol. Psychiatry 59, 295–300. Graeff, F.G., 1993. Role of 5-HT in defensive behavior and anxiety. Rev. Neurosci. 4, 181–211. Griebel, G., 1995. 5-Hydroxytryptamine-interacting drugs in animal models of anxiety disorders: more than 30 years of research. Pharmacol. Ther. 65, 319–395. Gustavsson, J.P., Nothen, M.M., Jonsson, E.G., Neidt, H., Forslund, K., Rylander, G., Mattila-Evenden, M., Sedvall, G.C., Propping, P., Asberg, M., 1999. No association between serotonin transporter gene polymorphisms and personality traits. Am. J. Med. Genet. 88, 430–436. Handley, S.L., 1995. 5-Hydroxytryptamine pathways in anxiety and its treatment. Pharmacol. Ther. 66, 103–148. Heuser, I., Yassouridis, A., Holsboer, F., 1994. The combined dexamethasone/CRH test: a refined laboratory test for psychiatric disorders. J. Psychiatr. Res. 28, 341–356. Iny, L.J., Pecknold, J., Suranyi-Cadotte, B.E., Bernier, B., Luthe, L., Nair, N.P., Meaney, M.J., 1994. Studies of a neurochemical link between depression, anxiety, and stress from [3H]imipramine and [3H]paroxetine binding on human platelets. Biol. Psychiatry 36, 281–291. Jokela, M., Raikkonen, K., Lehtimaki, T., Rontu, R., KeltikangasJarvinen, L., 2006. Tryptophan hydroxylase 1 gene (TPH1) moderates the influence of social support on depressive symptoms in adults. J. Affect. Disord. 100, 191–197. Jonsson, E.G., Norton, N., Forslund, K., Mattila-Evenden, M., Rylander, G., Asberg, M., Owen, M.J., Sedvall, G.C., 2003. Association between a promoter variant in the monoamine oxidase A gene and schizophrenia. Schizophr. Res. 61, 31–37. Kivimaki, M., Vahtera, J., Thomson, L., Griffiths, A., Cox, T., Pentti, J., 1997. Psychosocial factors predicting employee sickness absence during economic decline. J. Appl. Psychol. 82, 858–872. Levi, L., 1997. Psychosocial environmental factors and psychosocially mediated effects of physical environmental factors. Scand. J. Work, Environ. & Health 23 (Suppl 3), 47–52. Liu, X., Li, H., Qin, W., He, G., Li, D., Shen, Y., Shen, J., Gu, N., Feng, G., He, L., 2006. Association of TPH1 with suicidal behaviour and psychiatric disorders in the Chinese population. J. Med. Genet. 43, e4. Malhi, G.S., Moore, J., McGuffin, P., 2000. The genetics of major depressive disorder. Curr. Psychiatry Rep. 2, 165–169. Owens, M.J., Nemeroff, C.B., 1994. Role of serotonin in the pathophysiology of depression: focus on the serotonin transporter. Clin. Chem. 40, 288–295.
179
Ressler, K.J., Nemeroff, C.B., 2000. Role of serotonergic and noradrenergic systems in the pathophysiology of depression and anxiety disorders. Depress. Anxiety 12 (Suppl 1), 2–19. Roy, A., Rylander, G., Sarchiapone, M., 1997. Genetic studies of suicidal behavior. Psychiatr. Clin. North Am. 20, 595–611. Rydmark, I., Wahlberg, K., Ghatan, P.H., Modell, S., Nygren, A., Ingvar, M., Asberg, M., Heilig, M., 2006. Neuroendocrine, cognitive and structural imaging characteristics of women on longterm sickleave with job stress-induced depression. Biol. Psychiatry 60, 867–873. Spitzer, R.L., Williams, J.B., Gibbon, M., First, M.B., 1992. The Structured Clinical Interview for DSM-III-R (SCID). I: history, rationale, and description. Arch. Gen. Psychiatry 49, 624–629. Sun, H.S., Tsai, H.W., Ko, H.C., Chang, F.M., Yeh, T.L., 2004. Association of tryptophan hydroxylase gene polymorphism with depression, anxiety and comorbid depression and anxiety in a population-based sample of postpartum Taiwanese women. Genes Brain Behav 3, 328–336. Tennant, C., 2001. Work-related stress and depressive disorders. J. Psychosom. Res. 51, 697–704. Van Den Bogaert, A., Sleegers, K., De Zutter, S., Heyrman, L., Norrback, K.F., Adolfsson, R., Van Broeckhoven, C., Del-Favero, J., 2006. Association of brain-specific tryptophan hydroxylase, TPH2, with unipolar and bipolar disorder in a Northern Swedish, isolated population. Arch. Gen. Psychiatry 63, 1103–1110. Walther, D.J., Bader, M., 2003. A unique central tryptophan hydroxylase isoform. Biochem. Pharmacol. 66, 1673–1680. Westenberg, H.G., 1996. Developments in the drug treatment of panic disorder: what is the place of the selective serotonin reuptake inhibitors? J. Affect. Disord. 40, 85–93. Whitaker-Azmitia, P.M., Shemer, A.V., Caruso, J., Molino, L., Azmitia, E.C., 1990. Role of high affinity serotonin receptors in neuronal growth. Ann. N.Y. Acad. Sci. 600, 315–330. Zhou, Z., Roy, A., Lipsky, R., Kuchipudi, K., Zhu, G., Taubman, J., Enoch, M.A., Virkkunen, M., Goldman, D., 2005. Haplotypebased linkage of tryptophan hydroxylase 2 to suicide attempt, major depression, and cerebrospinal fluid 5-hydroxyindoleacetic acid in 4 populations. Arch. Gen. Psychiatry 62, 1109–1118. Zill, P., Baghai, T.C., Zwanzger, P., Schule, C., Eser, D., Rupprecht, R., Moller, H.J., Bondy, B., Ackenheil, M., 2004a. SNP and haplotype analysis of a novel tryptophan hydroxylase isoform (TPH2) gene provide evidence for association with major depression. Mol. Psychiatry 9, 1030–1036. Zill, P., Buttner, A., Eisenmenger, W., Bondy, B., Ackenheil, M., 2004b. Regional mRNA expression of a second tryptophan hydroxylase isoform in postmortem tissue samples of two human brains. Eur. Neuropsychopharmacol. 14, 282–284. Zill, P., Buttner, A., Eisenmenger, W., Moller, H.J., Ackenheil, M., Bondy, B., 2007a. Analysis of tryptophan hydroxylase I and II mRNA expression in the human brain: a post-mortem study. J. Psychiatr. Res. 41, 168–173. Zill, P., Preuss, U.W., Koller, G., Bondy, B., Soyka, M., 2007b. SNPand haplotype analysis of the tryptophan hydroxylase 2 gene in alcohol-dependent patients and alcohol-related suicide. Neuropsychopharmacology 32, 1687–1694.