The tyrT locus: Termination and processing of a complex transcript

Cell, Vol. 26, 305-314.

November

1961 (Part I), Copyright

0 1961

by MIT

The tyrT Locus: Termination and Processing of a Complex Transcript John Rossi,* James Egan, Lynn Hudson and Arthur Landy Section of Microbiology and Molecular Biology Division of Biology and Medicine Brown University Providence, Rhode Island 02912

Summary The tyrT locus of E. coli contains a 208 bp spacer region that separates two copies of sequence encoding tRNA, lyr . The spacer includes a 120 bp sequence that is homologous to a sequence that is repeated three times in the distal portion of the tyrT locus. The tyrT locus possesses a graded set of transcription termination sites that are spaced at 180 base intervals, corresponding to the distal repeated gene structure. The major termination site occurs within the second repeat unit, 225 bases beyond the mature tRNA sequences. In the presence of a temperature-sensitive rho protein there is increased read-through at this site to a termination site located 180 bases downstream in the third repeat and to several termination sites even further downstream. The primary native transcript, in the region distal to the second tRNA, carries the information for a low molecular weight, extremely basic protein. Although analogous coding sequences are present in the spacer and other repeat units, because of single base substitutions these sequences are pseudogenes. The parallel between the tyrT and tyrfJ gene clusters is discussed in relation to dual function transcripts that specify both tRNA and protein. Introduction Analyses of transcription termination are hampered by the instability of most nascent RNAs. In the case of genes encoding tRNAs and rRNAs, studies on this phase of transcription are further complicated by the existence of nucleolytic processing pathways that generate a number of discrete products, intermediate in size between the native transcript and the stable mature RNA (for recent reviews see Abelson, 1979; Daniel, 1981). Although the rho termination protein has been purified, its mode of action is not understood (Roberts, 1976; Adhya and Gottesman, 1978; Rosenberg and Court, 1979; Bektesh and Richardson, 1980; Galluppi and Richardson, 1980). It appears to be required for termination at some sites (rho-dependent) but it is not obligatory at other sites (rho-independent or rho-enhanced) (for recent reviews see Rosenberg and Court, 1979; Platt, 1981). Whereas the general features of termination at rho-independent l Present address: Department Biology, City of Hope Research

of Molecular Genetics, Division of Institute, Duarte, California 91010.

sites are now being clarified (Rosenberg et al., 1978; Christie et al., 1981), considerably less is known about the relevant structures and mechanisms in rhodependent transcription. Prior to the results reported here, no cellular tRNA transcripts (except for those in tRNA operons) have been found to extend more than a dozen nucleotides beyond the 3’ terminus of any mature tRNA (Altman and Smith, 1971; Smith, 1976; Shimura and Sakano, 1977). A great deal of our knowledge concerning tRNA transcription and processing has come from studies using tRNA?‘, which is encoded by the tyrT gene of E. coli (Altman and Smith, 1971; Schedl and Primakoff, 1973; Ghysen and Celis, 1974; Smith, 1976; Daniel, 1981). The results of in vitro transcription studies with the tyrT gene suggested that the precursors previously characterized in vivo were not the primary transcription products. These studies, however, were not in agreement on the actual size of the transcript or the mechanism of termination (Bikoff and Gefter, 1975; Bikoff et al., 1975; Daniel et al., 1975; Fournier et al., 1977; Grimberg and Daniel, 1977; Kijpper et al., 1978). We present evidence that in vivo transcription of the tyrT gene cluster terminates approximately 225 bases beyond the mature tRNA sequence at a site that is affected by rho factor. Furthermore, the tyrT locus possesses a graded set of termination sites that are spaced at intervals of 180 bp. One particularly interesting feature of the in vivo transcript is that it contains both structural and informational RNA. Within the 225 distal bases of the primary rho-dependent transcript, the RNA contains the information for a low molecular weight, arginine-rich protein that has been identified in an in vitro coupled transcription-translation system (Altman et al., 1981). Derived from the native transcripts are a number of new processing intermediates that may afford, along with the parent molecules, the necessary substrates for identifying and isolating the remaining processing nucleases in the tRNA?” maturation pathway and for studying the implications of transcripts that specify both tRNA and protein. Results The Spacer Region and Distal Repeats The tyrT locus contains two identical tRNA?’ mature structural sequences separated by a spacer. Analyses of specialized transducing phage as well as the E. coli chromosome have demonstrated that the “doublet” structure can give rise by unequal recombination to a “singlet” structure (Russell et al., 1970), which differs from the doublet only in the absence of the spacer region and a single copy of the tRNAiY’ mature sequence (Rossi et al., 1979). The sequence of the 208 bp spacer is shown in Figure 1 along with the remainder of the tyrT gene sequence (note comments on the 5’ precursor sequence in the figure legend). Within

Sequence

of the fyfT Gene Region

Position 1 is the first base of the transcript (Altman and Smith, 1971) and position 44 is the first base of mature tRNATY’ (lower case, boxed) (Goodman et al.. 1970). Previous RNA sequencing Of the 6’ precursor cleaved off by RNAase P indicated a sequence of 41 bases (Altman and Smith, 1971). Our DNA sequencing indicates that there are 43 bp between the start point of transcription and Structural sequence, with an additional A (position 31) and C (position 41) (M. Berman, unpublished results). The distal repeated sequences (Egan and Landy, 1978) are aligned vertically with each other (repeats one to three) and with the homologous portion of the intergenic sequence (positions 184 to 306). (*): Differences between the repeated sequences. The last 19 bp of mature @INA:” sequence are repeated six times (lower case, boxed). The amino acids of the protein specified by the major transcript are shown. Translation initiation can also occur four codons upstream from the start Site shown. as indicated by the in vitro production of both a 29 and a 33 amino acid basic protein that map to the first repeat (Altman et al., 1981). T: Major transcription termination site. t: Minor transcription termination site. (-M-) and (+t): Dyad symmetries. An RNA secondary structure encompassing 109 bases could form in the spacer and each repeat unit from H-bonding between the indicated sequences kc) and additional complementarities not indicated (AGwc = -41 kcal versus AGz5’c = -40 Kcal for tRNA?‘. as calculated according to Tinoco et al.. 1973).

Fig. 1, Nucleotide

8 I t 1 E 17s- 961 TcAcTm G~CCC*-Gkmm&A.~cGcM-T~mTGcc CA2CCGGGW~~m~~SIMOCPTC~CC-~~~~~=~~~=~-~~~~-=~~~~~~ ’ -E I 4t t I t? 0 0 SW- ,019 Ta3mTccTTAMTMTc-~GTT~cGAecT~ TTTTGCCCGATCGCACCACGTTT*CCGG

Termination 307

and Processing

of TyrT

tyrT transcripts against a high background of unrelated RNAs. The tyrT transducing phages +8Opsu3+ (singlet) and #8Opsu3+.(doublet) were used to infect E. coli strains defective in one or more steps of RNA processing or transcription. Following a short period of phage development and expression of the amplified tRNA genes, total cellular RNA was extracted, denatured with glyoxal (M&laster and Carmichael, 1977) and fractionated by gel electrophoresis. A replica of the electropherogram on DBM paper (Alwine et al., 1977) was then probed with radioactively labeled DNA restriction fragments derived from specific regions of the tyrT and tyrU loci. In studying the in vivo expression of a tRNA gene and the fate of its products, it is critical to choose appropriate criteria for distinguishing between a native transcript and a partially processed RNA product. We have addressed this problem by referring to results obtained with a highly purified in vitro transcription system. In the absence of any processing, the promoter-dependent transcript has been characterized and its dependence upon rho-termination factor has been demonstrated (Kiipper et al., 1978). The predicted lengths of the primary in vivo transcripts are approximately 650 bases from the doublet gene and approximately 350 bases from the singlet gene (Kiipper et al., 1978). In RNAase P-deficient E. coli in-

the spacer region the sequence from 128 to 183 is unique in the tyrT region. Surprisingly, the sequence from positions 184 to 306 shares extensive homology with sequences in each of the downstream repeat units (Figure 1). Also included in this homologous region are inverted repeats (positions 99 to 120 and 185 to 207) and direct repeats (positions 102 to 110 and 209 to 217; 110 to 128 and 284 to 302) of the tRNA:Y’ structural sequence. In the region just upstream of the second tRNA?’ structural sequence (307 to 336), short stretches of sequence homologous to the region preceding the first structural sequence (16 to 43) are also present. Within the first distal repeat the sequence from 477 to 575 has the potential to encode a protein that is very rich in arginine; evidence bearing on the function of this region will be discussed below. It is interesting that this is the same sequence that is conserved in the 208 bp spacer (184 to 306). However, in the spacer, as in the second and third distal repeats, the presence of one or more single base substitutions introduces chain termination codons into the coding sequence. Identification of Primary tyrT Transcripts The following protocol was adopted to identify very small amounts of unprocessed and partially processed

rsinglet7

A

B

P’S

P’S rsinglet7rdoublet7

rdoublet,

C singlet

Pts doublet

Figure 2. In Vivo tRNA:” Transcripts Produced after +6Opsu3+ (Singlet) or@Opsu3++ (Doublet) Infection (A, B and C) Replicas of the same filter probed with “P-labeled restriction fragments derived from the indicated segments of the +6Opsu3+ (singlet) fyrTgene and containing the following sequences. (A) 5’ precursor, mature tRNA and part of one downstream repeat. (6) One complete downstream repeat (positions 495 to 673. Figure 1). (0 Sequences found only in the distal repeats (positions 796 to 850. Figure 1). Arrows indicate positions of the 230 and 200 base transcripts that are detected only with tRNATY’ structural probes. The gel composition was 2% agarose and the molecular weight marker was Hae Ill-digested +X1 74 (not shown).

Cell 308

A

B

--

Pts

Ill- P t8

--

P

18

Figure 3. In Vivo tRNA:Y’ Doublet Transcripts Produced in RNAase P” or the Double Mutant RNAase Ill- RNAase P”

III-Pt=

IC1rv-B-

330

fected with singlet or doublet transducing phage, RNAs of the size predicted for primary transcripts were found (Figures 28 and 2C and Figure 3-H). To establish the identity of the 350 singlet and 640 doublet transcripts it is necessary to show that they also contain sequences comprising the 5’ end of the tRNA precursor (Altman and Smith, 1971). One of the restriction fragments used for this purpose contains 22 bases of the 5’ precursor sequence and the first 18 bases of structural sequence. Because of its small size and the stringent hybridization and filter washing conditions, this DNA probe is specific for RNAs containing both the precursor and structural sequences. The 640 base doublet (Figure 3-IA) and the 350 base singlet are among those RNAs that hybridize with this probe. Further confirmation that the transcripts visualized in Figures 2 and 3 initiate at the known in vivo start site is that they also hybridize to a restriction

200

-230

Cl-1

IS0

Probe (A) contains primarily tyrT 5’ precursor sequences (positions 22 to 81, Figure 1). Probe (B), which is derived from the tyrU gene cluster (Rossi et al.. 1979). contains 88 bp of tRNATY’ structural sequence, but no sequences homologous to the tyrT 5’ precursor or downstream repeat units (Rossi and Landy, 1979). In (I). arrows indicate transcripts that contain tRNATY’ structural sequences (B) but do not contain ryrT 5’ precursor sequences (A). (II) and (Ill) are replicas of the same filter probed with either the tRNATY’ structural probe (MB) or the tyrT downstream probe (IIC; position 495 to 873, Figure 1). It should be noted that because of the repeated seequences in the tyrT locus, the full length transcripts hybridize more efficiently with a probe from the distal repeated region than with unique sequence probes (compare II and Ill or Figure 2A, 28 and 20. Arrows in (II) indicate the positions of RNAs that hybridize to DNA containing mature tRNA sequences but not the fyrTdownstream specific probes. The band of hybridization seen at the top of the gel lanes is DNA, which is not removed during the RNA preparations (see Experimental Procedures). Gel composition is 1.75% agarose.

fragment containing only the first 22 bases of the 5’ precursor, but do not hybridize with a restriction fragment derived from the region just upstream of the in vivo transcription start site (data not shown). Final confirmation that the 640 base and 350 base RNAs are primary transcripts whose 3’ termini lie in the downstream repeated sequences is that they also hybridize with a DNA probe specific to this downstream region (Figure 2C). A Graded Set of Transcription Termination Sites In addition to the primary transcripts that terminate in the second downstream repeat, several larger tyrT transcripts are often detected (530, 710 and 1200 RNAs in singlet; 820, 1000 and 1500 RNAs in doublet; Figures 2, 3 and 4). From the DNA sequence a rho-dependent termination site is also predicted in the third distal repeat (Egan and Landy, 1978; Kiipper et

Termination 309

and Processing

of 7yr7

A

B

Doublet

Singlet

Pts 30

P’S

42

-

bx

rhots

t

- 710 - 530

-350

65-160

A Figure

4. Identification

of tyr7 Read-Through

Transcripts

(A) The E. coli RNAase P” strain A49 was infected with +60ps~3~ (doublet) and incubated at either 30’ or 42°C (see Experimental Procedures). The RNA was subjected to electrophoresis in a 1.75% agarose gel for an extended length of time to permit better resolution of the longer transcripts, which can also be seen in Figure 3. The RNA was probed with the ryf7 singlet-derived fragment A, which contains one complete downstream repeat unit (positions 495 to 673. Figure 1). (B) +6Opsu3+ (singlet) was used to infect either the RNAase P’* A49 strain or the rhol5“ mutant AD1600 (Das et al., 1976) at 42’C. RNA prepared from these infections was probed with tyrJ structural sequence (B). The pattern of RNAs after infection at 3O’C was the same as shown here except for the somewhat greater accumulation of “read-through” products at 42°C in the rhol5” mutant.

al., 1978). The 820 base RNA, which by size and hybridization pattern corresponds to termination in the third repeat, is seen in Figures 3-11, 3-M and 4A. Surprisingly, even longer RNAs are also detected. One of these, 1000 bases in length, is again approximately 180 bases longer than the previous transcript and must therefore be terminating beyond the repeated sequence (see Figure 1). The largest detect-

able transcript is approximately 1500 bases long, and its terminus is outside of the known sequence. All of these read-through transcripts are detectable with a probe containing either the distal repeats (Figure 4A) or tRNATy’ structural seqences (data not shown). When an E. coli mutant bearing a temperature-sensitive rho factor (rho75”; Das et al., 1976) is infected at the non-permissive temperature with a singlet tyrT transducing phage, there is an increase in the amount of transcription that reads through the termination site (or sites; Figure 46). Here also the read-through transcripts each are longer than the preceding one by the expected 180 base increment. A 1200 base readthrough product, not visible in this experiment, has also been detected in the singlet infections. Similar strain also are read-through transcripts in the rhol5” obtained in the doublet infection (820, 1000 and 1500 FINAs; data not shown). These effects of the temperature-sensitive rho factor further support the conclusion that these RNA species are native transcripts and not the products of processing enzymes or other nucleases. Processing Intermediates As shown in Figures 2 and 3, a series of discrete RNAs intermediate in size between the native transcript (640 bases in doublet) and mature tRNATY’ (85 bases) is detectable with structural tRNATy’ probes (500,460,330,230,200 and 160 through 85 RNAs). Transcripts smaller than 230 bases, including the previously described 130 and 95 base precursors (Altman and Smith, 1971; Ghysen and Celis, 1974) are resolved on polyacrylamide gels (data not shown). The 200 base RNA is a tyrU transcript that only shows homology with tRNATy’ structural probes (J. Rossi and A. Landy, unpublished results). Several RNAs containing structural tRNATY’ sequence hybridize to 5’ precursor-specific (460, 330, 230 and 130 RNAs) or downstream-specific probes (500 and 330 RNAs) or both. In addition, there is a species of 160 bases that hybridizes strongly only to downstream probes. A processing scheme, which is based on the size and hybridization pattern of each RNA and whether the RNA species is present in singlet or doublet infections or both, is presented in Figure 5. The pattern of RNAs from the singlet infection is much simpler than that of the doublet infection. Of the RNAs that are intermediate in size between mature tRNATY’ and the 350 base native transcript, the major species is a 160 base RNA (Figure 2A) that is analogous to the doublet 460 base species (Figure 5). The pattern of transcripts detected in both singlet and doublet infections was independent of the RNAase III phenotype of the host cell (see Figure 3). The potential endonucleolytic cleavage preceding the second tRNATY’ sequence (which generates the 330 base RNAs shown in Figures 2 and 3) is most probably due to RNAase P, which is known to cleave

Cell 310

DOUBLET

SINGLET

530

Figure

5.

Proposed

flop) Primary and arrangement. The as determined by gels (Figures 2 to peats in the case (-, 4, .--j):

Transcription

and Processing

\ I

710

Map of the E. coli tyrT Genes

processed RNAs from the tyfT doublet gene arrangement. (Bottom) Primary and processed RNAs from the tyrT singlet gene numbers above the doublet and singlet gene arrangements denote the distances in bp from the start point of transcription Altman and Smith (1971). The numbers above the transcripts denote their length in bases as determined on denaturing 4). The 160 base RNA, (160)“. is only detected with probes from the distal region and could also originate from the other re(-): of longer transcripts (see text). Shaded boxes: tRNATY’ structural sequence. Direction and extent of transcription. Processed transcripts. T: Major transcription termination sites. t: Minor termination sites (see text).

at the 5’ end of the proximal tRNA?’ gene (Altman and Smith, 1971; Schedl and Primakoff, 1973). An additional inferred processing site is in a region of dyad symmetry seven bases downstream from the CCA end of the distal tRNA:Y’ gene (Sekiya et al., 1979; Figure 1). Several laboratories have described what might be the relevant endonuclease activity for this site (Schedl et al., 1975; Sakano and Shimura, 1978; Goldfarb and Daniel, 1980; Ray and Apirion, 1981). A similar region of dyad symmetry also follows the first tRNATY’ sequence (see Figure 1). Cleavage at these two sites would generate in vivo products of approximately 430 bases in doublet and 130 to 135 bases in singlet and doublet. The latter size RNA species is observed in both the doublet and singlet infections. It is not clear from the present data whether the observed 460 base RNA from doublet (and the 160 base RNA from singlet) corresponds to the products of this (or some other) nuclease (see Figures 2 to 5) or whether they are the result of termination in the first repeat. In vitro transcription studies with purified restriction fragment templates favor the former interpretation (Kupper et al., 1978). In contrast, studies with intact tyrT-transducing phage DNA as template were interpreted as yielding a rho-independent transcript that terminated in the first repeat (Fournier et al., 1977; Grimberg and Daniel, 1977). Consistent with the existence of a processing cleavage in the first

repeat is the hybridization pattern of the 160 base RNA (see Figures 2 and 3) which could correspond to the distal product of that cleavage (see Figure 5). Discussion Transcription Termination We have used two criteria to define a native (unprocessed) transcript. First, it is the same as that obtained in a purified in vitro system containing only RNA polymerase and rho factor (Kipper et al., 1978). Second, the observed in vitro dependency on rho factor has been demonstrated in vivo by studies with a temperature-sensitive rho strain at non-permissive temperatures. The mechanisms and structures involved in termination at rho-dependent sites have not been characterized to the extent of the rho-independent (or rhoenhanced) sites. Although rho-dependent sites are rich in A + T (Kipper et al., 1978; Rosenberg et al., 1978; Calva and Burgess, 1980; Court et al., 1980; Wu et al., 1980) they lack the stretch of contiguous A residues that distinguishes rho-independent sites. It is less straightforward to determine whether rhoindependent sites require the familiar hairpin structure that generates transcriptional pausing at rho-independent termination sites (Bertrand et al., 1977). While the lambda tR1 terminator has a hairpin struc-

Termination 311

and Processing

of Tyr7

ture that appears to be critical for termination (Rosenberg et al., 1978) the trpt’ and tyrT sites are considerably less clear on this point (tyrTcontains a potential hairpin structure that has only three G:C bp in the stem and a four-base loop). Another feature that may distinguish rho-dependent termination is that of sequence specificity. The tyrT and lambda tR1 terminators contain the sequence CAATCAA and the lambda tR0 site contains the related sequence ATCAACAA. Furthermore, the first fyrT distal repeat unit, which does not appear to contain a rho-dependent termination site (Kipper et al., 1978) differs from the second and third repeats by one base in the termination sequence (CAATTAA instead of CAATCAA). For the read-through transcripts that terminate beyond the third repeat (1000 base transcript of doublet; Figure 3) termination could occur at a site (TAATCAAA; Figure 1) that resembles the rho-dependent terminator in the second repeat (CAATCAAA). One interpretation of the graded termination sites (Figure 48) suggests that the role of structural effects acts over longer distances than previously considered. The results are consistent with a role for dyad symmetries approximately 50 bases upstream of the termination site (Figure 1, boldface arrows). It is of interest that none of the 13 single-base pair differences between the terminal repeat units would disrupt the secondary structure. Although the distance between each secondary structure and the corresponding terminator(s) is considerably longer than the two to five bases characteristic of other terminators (see Rosenberg and Court, 1979) it is well within the 75 bp of DNA protected by RNA polymerase in footprint experiments (Schmitz and Galas, 1979) and the 60 bases of RNA covered by hexameric rho factor (Galluppi and Richardson, 1980). These regions of potential RNA secondary structure may serve as transcriptional pause sites and/or as recognition sites for the entrance of rho factor. The role of RNA structure some distance from the termination point is also suggested by a recent model for rho action (Galluppi and Richardson, 1980) and the importance of RNA secondary structure for rhomediated termination is consistent with available data (Adhya et al., 1979). It is interesting that in lambda cro mRNA a region 180 bases upstream of the RNA terminus is preferentially protected against nuclease digestion by purified rho factor (Bektesh and Richardson, 1980). Of the bacterial genes analyzed thus far, the ends of the trp operon and the tyrT locus are the only two that possess rho-dependent termination sites. Of particular interest is their roughly similar arrangement of repeated termination sites. In the trp operon the two terminators may interact with one another, as deletion of the distal rho-dependent terminator trpt’ disrupts termination at the 260 base proximal trpt site (Guarente et al., 1979; Wu et al., 1980). Although we do

not yet understand the biological significance of the graded termination sites in tyr7, selective pressure may be acting to preserve this genetically unstable arrangement of tandemly repeated sequences. Biological Implications of the tyrT Transcript In addition to the graded transcription termination sites, the most striking feature of the tyrT locus is the unusually long primary transcript. One of the inferences to emerge from the sequence of the transcribed spacer is a model for the evolution of the tyrT locus that is analogous to that proposed by Ghosal and Saedler (1978) for the insertion sequence IS-2. Looping out of a nascent DNA chain during replication to permit limited regions of self-copying or recopying can explain the extensive symmetry and repeated regions that have been observed. Whereas this pathway of aberrant replication seems attractive for evolution of the monomeric repeat element, the generation of the overall tandemly repeated gene structure is most easily attributed to unequal recombination (Russell et al., 1970). Of more immediate interest, however, is the possible function of the primary tyrT transcript, which in addition to specifying tRNA has the potential to encode protein. The transcribed sequence in the first repeat unit contains the information for a low molecular weight, basic protein (Figure 1). Although this sequence is present in the spacer and downstream repeat units, the single base substitutions introduced during the evolution of the region destroy the coding potential of these repeated regions. It has been shown by Altman et al. (1981) that the protein-coding region of the tyrT locus is expressed in an in vitro coupled transcription-translation system. The predicted small basic protein (P protein) is made in response to +8Opsu3+ DNA and not in response to DNA containing a 110 bp deletion of this region (from approximately positions 400 to 500 in Figure 1). Although nothing is presently known about the possible function or functions of this protein in vivo, some inferences might be made from its similarity to the protamines of higher eucaryotes as suggested by Altman et al. (1981). The other locus encoding tRNATy’ in E. coli is fyrlJ, which like tyrT is complex (Rossi and Landy, 1979; Rossi et al., 1979; Hudson et al., 1981). The two share several similarities in structural features (Rossi and Landy, 1979) and transcription patterns (Rossi et al., 1980). The most striking similarity is that in addition to specifying tRNAs, both transcripts have the potential to encode a protein. We have shown that the primary tyrU transcript contains four different tRNAs (tRNA?“, tRNAzY’, tRNAY and tRNA:“‘) plus the mRNA for protein synthesis elongation factor Tu (tuf6) (Hudson et al., 1981). Genetic evidence corroborates the placement of the tufB promoter directly upstream of the tRNA cluster (Lee et al., 1981). Comparison of the tyrT and tyrU transcripts reveals

Cell 312

a similar arrangement of tRNA and protein coding sequences in which the only extensive homology between the transcripts corresponds to the respective tyrosine tRNAs (which differ by only two bases [Goodman et al., 19701). Another similarity between the tyrT and fyrlJ transcripts is particularly interesting in that it may be related to regulation by means of transcription termination. Recall that one of the tyfr gene products (460 base in doublet and 160 base in singlet) was postulated to result from either a processing cut or transcription termination within the first distal repeat unit (Figure 5). In either case the consequence is to separate structural tRNA sequences from protein-coding sequences. An analogous situation exists in the tyrlJ gene cluster, where one of the gene products corresponds to a cleavage or termination that separates tRNA and mRNA sequences (Hudson et al., 1981). In both cases, the relevant regions contain a sequence related to the CAATCAA sequence that is implicated in rho-dependent termination (see above). This raises the intriguing possibility that expression of the distal mRNA sequences may be uncoupled from the proximal tRNA sequences by modulation at a potential transcription termination site between the two functionally distinct regions of the gene cluster. The generality as well as the physiological significance of transcripts containing both structural and informational sequences remains to be determined. Experimental

Procedures

E. coli and Bacteriophage Strains and Growth Media The E. coli strains A49 (RNAase P”) (Schedl and Primakoff, 1973). and ABL-1 (RNAase III- RNAase P’“) (Gegenheimer and Apirion. 1978) were supplied by W. McClain. Strain AD 1500 (rbo75’“) (Das et al., 1976) was supplied by S. Adhya. E. coli strain CA274 (/acam. trp-am, HfrC. tyrTsudoublet; Russell et al., 1970) was the host for transducing bacteriophage preparatjons. The tyrT bacteriophage strains were #30ps~3~ (singlet) and +80psu3++ (doublet: Russell et al., 1970). The growth and preparation of the bacteriophage have been described by Landy et al. (1974). The growth medium for RNA preparations was low phosphate, yeast, tryptone media (LPYT). which was found to be the most suitable for fyrT precursor RNA production and accumulation. To prepare LPYT. the phosphates present in Yl medium (0.5% NaCI. 0.8% bactotryptone and 0.5% yeast extract) were precipitated by the addition of MgSO., to a final concentration of 0.01 M and by NH,OH to a final concentration of 0.14 M. The solution was filtered after 30 min, 5 mM Tris was added and the pH was adjusted to 7.2. Enzymes end Chemicals The sources of supplies other than the following have been described by Egan and Landy (1978) and Rossi et al. (1979): restriction enzymes and Hae Ill-digested $X1 74 DNA (New England Biolabs). aurin tricarboxylic acid (Sigma) and alpha 32P dCTP or alpha 32P dATP (1000-3000 Ci/mmole; Amersham Searle or New England Nuclear). DNA Preparation, Restriction Enzyme Digestions, RNA Preparation and Gal Electrophoresis DNA was prepared from bacteriophage according to the procedure of Landy et al. (1974). Conditions for restriction enzyme digestion, DNA gel electrophoresis and restriction fragment purification have been described by Rossi et al. (1979) and Rossi and Landy (1979). RNA was prepared from bacteriophage-infected cells with the general procedure of Gegenheimer and Apirion (1978). Single colony

inocula of the E. coli strains were grown overnight at 3O’C in 5 ml cultures of LPYT. The cultures were diluted 1:25 in 25 ml of LPYT and shaken at 3O’C until the optical density reached 0.4-0.5 ODseo (approximately 5 x 10’ cells/ml). The cells were pelleted and resuspended to a final concentration of approximately 1 x 1 OS/ml in phage absorption buffer (10 mmole Tris-HCI [pH 7.41, 1 mmole CaC12 and 15 mmole MgSO,). Bacteriophage were allowed to absorb at 37’C for 10 min at a multiplicity of 10-20. Cultures were then diluted tenfold into prewarmed LPYT. aerated vigorously for 30 min, quickchilled with 2.5 vol of -70°C chilled 80% ethanol and pelleted. The cell pellets were resuspended at approximately 5 x 1 O8 cells/ml in lysis buffer (20 mmole Tris-HCI [pH 7.41, 40 mmole EDTA and 0.2 M NaCI) containing 3 mmole aurin tricarboxylic acid (a potent ribonuclease inhibitor [Hallick et al., 19771). The suspended cells were heated at 90°C for 3 min and quick-chilled. The dissolved cellular material was extracted three times with phenol (equilibrated with 20 mmole Tris HCI [PH 7.41 just before use) and ethanol-precipitated. This procedure does not eliminate cellular or phage DNA, which migrated as a large, single band during gel electrophoresis. Prior to gel electrophoresis. the RNA and DNA marker preparations were treated with glyoxal according to the method of M&laster and Carmichael (1977). Vertical gels of 1.75% or 2% agarose (3 mm thick, 18 cm wide and 23 cm long) were run with recirculation of the 10 mmole sodium phosphate (pH 6.5). 2 mmole EDTA buffer. For best results, the smallest possible sample volumes were used (that is, 7-l 5 ~1. corresponding to 30-50 pg nucleic acid, per lane). Tenfold concentrated tracking dyes (0.1% bromophenol blue, 0.1% xylene cyanole) were added to make a 1 X final concentration, and samples were subjected to electrophoresis at 125-150 V. with the current never exceeding 45 mA. Under these conditions, in 1.75% agarose 23s RNA migrated to 6.5 cm, 16s to 9.5 cm, 5s to 20 cm and 4s to 21.5 cm from the origin: bromophenol blue to 20 cm and xylene cyanole to 6 cm from the origin. Blotting and DNA-RNA Hybridization The preparation of diazobenzyloxymethyl (DBM) paper and the treatment of gels prior to transfer by blotting is according to the method of Alwine et al. (1977) with the modifications suggested by Wahl et al. (1979). The restriction fragments used as probes were labeled by nick translation (Rigby et al.. 1977) and repurified by gel electrophoresis (Rossi et al., 1979). Probes were denatured either by heat (5 min. 100°C) or alkali treatment (0.2 M NaOH), and hybridizations were carried out as described by Wahl et al. (1979). The hybridized filters were dried and autoradiographed as described by Rossi and Landy (1979). DNA Sequencing DNA sequence analyses of the tyrT spacer region were performed according to the method of Maxam and Gilbert (1977) with the modifications and gel system described by Egan and Landy (1978). End-labeled restriction fragments were strand-separated and each strand sequenced. Overlapping sequence was obtained with use of a combination of Hae III and Hinf I restriction fragments. The 32Plabeled restriction fragments sequenced from both strands included the following: Hae Ill fragments end-labeled at positions 60, 254 and 353 (see Figure 1) and Hinf I fragments end-labeled at positions 109. 216 and 402. Acknowledgments The authors express their appreciation to J. Vournakis for computer analysis, M. Berman for DNA sequences in the proximal tRNATY’ region, W. McClain and S. Adhya for supplying bacterial strains and P. Smith for technical assistance. We also thank T. Platt. J. Friesen. S. Altman and G. McCorkle for helpful discussions and communication of unpublished results. This work was supported by grants from the National Institutes of Health and the American Cancer Society. J. R. was a National Institutes of Health postdoctoral fellow and A. L. an American Cancer Society professor. The costs of publication of this article were defrayed in part by the

Termination 313

and Processing

of TyrT

payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC. Section 1734 solely to indicate this fact. Received

June 24, 1981;

revised

August

24, 1981

Adhya, nation.

J. (1979). RNA processing and the intervening Ann. Review Biochem. 48, 1035-l 069. S. and Gottesman, M. (1978). Control Ann. Review Biochem. 47, 967-998.

sequence

of transcription

termi-

Adhya, S.. Sarkar, P.. Valenzuela. D. and Maitra, U. (1979). Termination of transcription by Escherichia co/i RNA polymerase: influence of secondary structure of RNA transcripts on rho-independent and rho-dependent termination. Proc. Nat. Acad. Sci. USA 76, 16131617. Altman. S. and Smith, J. (1971). polynucleotide sequence. Nature

Tyrosine tRNA precursor New Biol. 233, 35-39.

molecule

Altman. S.. Model, P.. Dixon, G. H. and Wosnick, M. A. (1981). coli gene coding for a protamine-like protein. Cell 26, 299-304.

An E.

Alwine, J.. Kemp, J. and Stark, G. (1977). Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethylpaper and hybridization with DNA probes. Proc. Nat. Acad. Sci. USA 74, 5350-5354. Bektesh. S. and Richardson, J. (1980). A recognition lambda cro-gene RNA. Nature 283, 102-104.

site on phage

Bertrand, K., Korn, L., Lee, F. and Yanofsky. C. (1977). The attenuator of the tryptophan operon of Escherichia co/i. Heterogenous 3’OH termini in viva and deletion mapping of functions. J. Mol. Biol. 117, 227-247. Bikoff. E. K. and Gefter, M. L. (1975). In vitro synthesis of transfer RNA. I. Purification of required components. J. Biol. Chem. 250, 6240-6247. Bikoff, E. K., LaRue, B. F. and Gefter, M. L. (1975). In vitro synthesis of transfer RNA. II. Identification of required enzymatic activities. J. Biol. Chem. 250, 8248-6255. Calva. E. and Burgess, R. (1980). Characterization of a rho-dependent termination site within the cro gene of bacteriophage lambda. J. Biol. Chem. 255, 11017-l 1022. Christie, G., Farnham, P. and Platt, T. (1981). Synthetic sites for transcription termination and a functional comparison with tryptophan operon termination sites in vitro. Proc. Nat. Acad. Sci. USA 78, 41804184. Court, D.. Bradv. C., Rosenberg, M.. Wulff, D. L., Behr, M.. Mahoney, M. and Izumi. S. (1980). Control of transcription termination: a rhodependent termination site in bacteriophage lambda. J. Mol. Biol. 138, 231-254. Daniel, V. (1981). Biosynthesis in Biochemistry 9. 253-292.

of transfer

Ill mutant

strain

RNA. CRC Critical

Reviews

of E. coli. Cell 15, 527-539.

Ghosal. D. and Saedler, H. (1978). DNA sequence of the mini-insertion IS2-8 and its relation to the sequence of 152. Nature 275, 811817. Ghysen, A. and Celis, genes from Escherichia

References Abelson, problem.

RNAase

J. (1974). Joint transcription co/i. Nature 249, 418-421.

of two tRNA:’

Goldfarb. A. and Daniel, V. (1980). An Escherichia co/i endonuclease responsible for primary cleavage of in vitro transcripts of bacteriophage T4 tRNA gene cluster. Nucl. Acids. Res. 8, 4501-4516. Goodman, H. M.. Abelson, J. N.. Landy, A., Zadrazil, S. and Smith, J. D. (1970). The nucleotide sequences of tyrosine transfer RNAs of Escherichia co/i: sequences of the amber suppressor su$ transfer RNA, the wild type su, transfer RNA and tyrosine transfer RNAs species I and II. Eur. J. Biochem. 13, 461-483. Grimberg. J. and Daniel, tRNA genes. Nucl. Acids. Guarente, L., Beckwith. distal to the messenger nation in the tryptophan 189-197.

V. (1977). In vitro Res. 4, 3743-3752.

transcription

J., Wu. A. and Platt. T. (1979). A mutation RNA end point reduces transcription termioperon of Escherichia co/i. J. Mol. Biol. 733,

Hallick. R.. Chelm, B.. Gray, P. and Orozco. aurintricarboxylic acid as an inhibitor of nuclease isolation. Nucl. Acids Res. 4, 3055-3064.

F. (1977). Use of during nucleic acid

Hudson, L.. Rossi. J. and Landy, A. (1981). Dual function specifying tRNA and mRNA. Nature, in press. Ktipper. (1978). tyrosine

of E. co/i

transcripts

H.. Sekiya. T., Rosenberg, M.. Egan, J. and Landy. A rho-dependent termination site in the gene coding tRNA su3 of Escherichia co/i. Nature 272, 423-428.

A. for

Landy. A., Ruedisueli, E., Robinson, L.. Foeller, C. and Ross, W. (1974). Digestion of deoxyribonucleic acids from bacteriophage T7. lambda, and @Oh with site-specific nucleases from Hemophilus influenzae strain Rc and strain Rd. Biochem. 13, 2134-2142. Lee, J. S., An, G.. Friesen. J. D. and Fiil, N. P. 1981. Location of the tuf8 promoter of E. coli: cotranscription of tufB with four transfer RNA genes. Cell 25. 251-258. Maxam. A. and Gilbert, W. (1977). A new method DNA. Proc. Nat. Acad. Sci. USA 74, 580-564.

for sequencing

McMaster, G. and Carmichael, G. (1977). Analysis of single and double stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange. Proc. Nat. Acad. Sci. USA 74, 4835-4838. Platt. T. (1981). Termination of transcription and its regulation tryptophan operon of E. coli. Cell 24, 1 O-23. Ray, B. K. and Apirion, D. (1981). Transfer accumulated in Escherichia co/i in the absence Biochem. 7 74, 517-524.

in the

RNA precursors are of RNAse E. Eur. J.

Rigby, P.. Dieckmann, M., Rhodes, C. and Berg, P. (1977). Labelling deoxyribonucleic acid to high specific activity in ntro by nick translation with DNA polymerase I. J. Mol. Biol. 7 73, 237-251.

Daniel, V., Grimberg. J. and Zeevi, M. (1975). In vitro synthesis of tRNA precursors and their conversion to mature size tRNA. Nature 257, 193-i 97.

Roberts, J. (1976). In RNA Polymerase, Harbor, New York:

Das, A.. Court, D. and Adhya, S. (1976). Isolation and characterization of conditional lethal mutants of Escherichia co/i defective in transcription termination factor rho. Proc. Nat. Acad. Sci. USA 73, 19591963.

Rosenberg, M. and Court. D. (1979). Regulatory sequences involved in the promotion and termination of RNA transcription. Ann. Rev. Genetics 73. 319-353.

Egan, J. and Landy. A. (1978). Structural analysis of the tRNA?’ Gene of Escherichia co/i. J. Biol. Chem. 253, 3607-3622. Fournier. M., Webb, E. and Tang, S. (1977). In vitro biosynthesis functional Escherichia co/i tyrosine transfer RNA. Biochem. 3608-3618. Galluppi. G. and Richardson, the binding of RNA synthesis Biol. 138. 513-539.

of 76,

J. P. (1980). ATP-induced changes in termination protein rho to RNA. J. Mol.

Gegenheimer, P. and Apirion, D. (1978). Processing of rRNA by RNAase P: spacer tRNAs are linked to 16s rRNA in an RNAase P

Transcription termination and its control in E. co/i. R. Losick and M. Chamberlin, eds. (Cold Spring Cold Spring Harbor Laboratory), pp. 247-271.

Rosenberg, M., Court, (1978). The relationship intercistronic regulatory 423.

D.. Shimatake. H., Brady, C. and Wulff. P. between function and DNA sequence in an region in phage lambda. Nature 2 72, 414-

Rossi. J. and Landy, A. (1979). Structure and organization of the two tRNATY’ gene clusters on the E. coli chromosome. Cell 78, 523-534. Rossi. J., Ross, W.. Egan, J.. Lipman, D. J. and Landy. A. (1979). Structural organization of tRNATY’ gene clusters in four different transducing phages. J. Mol. Biol. 728, 21-47. Rossi, J.. Egan. J., Berman, M. and Landy, A. (1980). The E. co/i tRNATY’ gene clusters: organization, evolution and transcription. In

Cell 314

RNA Polymerase. tRNA and Ribosomes: Their Genetics and Evolution, S. Osawa. H. Oreki, H. Uchida and T. Yura, eds. (Tokyo: Tokyo University Press). pp. 185-208. Russell, R.. Abelson, J., Landy. A., Gefter, M.. Brenner, S. and Smith, J. (1970). Duplicate genes for tyrosine transfer RNA in Escherichia co/i. J. Mol. Biol. 47, 1-13. Sakano. Ii. and Shimura. Y., (I 978). Characterization and in vitro processing of transfer RNA precursors accumulated in a temperature sensitive mutant of Escherichia co/i. J. Mol. Biol. 723, 287-326. Schedl. P. and Primakoff. P. (1973). Mutants of Escherichia co/i thermosensitive for the synthesis of transfer RNA. Proc. Nat. Acad. Sci. USA 70, 2091-2096. Schedl. P., Primakoff. Escherichia co/i tRNA 78.

P. and Roberts, J. (1975). Processing of precursors. Brookhaven Symp. Biol. 28, 53-

Schmitz, A. and Galas, erase and lac repressor 6, 111-137.

D. J. (1979). The interaction of RNA polymwith the lac control region. Nucl. Acids Res.

Sekiya, T.. Contreras, R., Takega. T. and Khorana, l-l. (1979). Total synthesis of a tyrosine suppressor tRNA gene (XVII) transcription, in vitro, of the synthetic gene and processing of the primary transcript to tRNA. J. Biol. Chem. 254, 5802-5818. Shimura, Y. and Sakano, H. (1977). Processing of tRNA precursors in Escherichia co/i. In Nucleic Acid-Protein Recognition, H. J. Vogel, ed. (New York: Academic Press). pp. 293-319. Smith, J. (1976). Transcription and processing of transfer RNA precursors. In Progress in Nucleic Acid Research and Molecular Biology, 16. W.E. Cohn, ed. (New York: Academic Press), pp. 25-73. Tinoco, I.. Borer, P. N., Dengler, B.. Levine, M. D.. Uhlenbeck, 0.. Crothers, D. M. and Gralla. T. (1973). Improved estimation of secondary structure in ribonucleic acids. Nature New Biol. 246, 40-41. Wahl. G. M., Stern, M. and Stark, G. R. (1979). Efficient transfer of large DNA fragments from agarose gels to diazobenzyloxymethylpaper and rapid hybridization by using dextran sulfate. Proc. Nat. Acad. Sci. USA 76, 3683-3687. Wu. A. M.. Chapman, A. B.. Platt. T.. Guarente. L. P. and Beckwith. J. (1980). Deletions of distal sequence affect termination of transcription at the end of the tryptophan operon in E. coli. Cell 19, 829-836.