- Email: [email protected]
The use of DNA probes for confirming enterotoxin production by Staphylococcus aureus and micrococci
International Journal of Food Microbiology, 11 (1990) 251-258 Elsevier
251
FOOD 00336
The use of DNA probes for confirming enterotoxin production by Staphylococcus aureus and micrococci S. Ewald 1, C.J. H e u v e l m a n 2 and S. N o t e r m a n s 2 1
.
.
.
.
.
Department of Food Hygwne, Norwegian College of Veterinary Medtcme, Oslo, Norway, and : National Institute of Public Health and Environmental Protection, Bilthoven, The Netherlands' (Received 27 November 1989; accepted 28 May 1990)
D N A - D N A colony hybridization was employed to evaluate the results obtained by different immunological methods for detection of staphylococcal enterotoxin. Staphylococcus aureus strains tested for staphylococcal enterotoxin production by immuno-assays and micrococci not previously tested for staphylococcal enterotoxin production were examined for presence of the genes encoding for staphylococcal enterotoxin A, B, C and E by using three corresponding DNA probes. The staphylococcal enterotoxin A probe also detected staphylococcal enterotoxin E gene because of 100% homology. The optimal sensitivity plate method showed the best accordance between the immuno-assay and the hybridization reactions. The enzyme-linked immunosorbent assay detected 12.5 to 17% staphylococcal enterotoxin producers without hybridization reactions. The microslide gel double diffusion test and the reversed passive latex agglutination test showed rather poor accordance with the hybridization reactions. All 17 strains of different micrococci investigated were negative in hybridization with all three DNA probes. Key words: Staphylococcal enterotoxin; Immunoassay; D N A - D N A hybridization
1. Introduction Staphylococcus aureus has long been recognized as a major cause of bacterial food poisoning due to ingestion of foods with preformed staphylococcal enterotoxin (SE). A number of serologically different enterotoxins have been identified and designated by the letters A through E (SEA through SEE). The first methods applied for detection of SE were biological assays such as the monkey and kitten feeding test. Thereafter, immunological techniques were elaborated based on the Ouchterlony gel-double-diffusion technique modified as the microslide gel double diffusion test (MS) (Casman et al., 1969) or the optimum sensitivity plate (OSP) method (Robbins et al., 1974). The Ouchterlony technique
Correspondence address." S. Ewald, Department of Food Hygiene, Norwegian College of Veterinary Medicine, P.O. Box 8146 DEP, 0033 Oslo 1, Norway. 0168-1605/90/$03.50 © 1990 Elsevier Science Publishers B.V. (Biomedical Division)
252 employing a positive control system yields positive results of high specificity, but difficulties are often encountered with the MS, as this method demands some training and dexterity. False negative results may occur due to the relative low sensitivity, which is about 100 ng SE per ml culture supernatant for the MS and about 500 ng for the OSP. Low SE production has been detected by OSP negative S. aureus strains (Kokan and Bergdoll, 1987). During the last decade far more sensitive techniques such as the enzyme-linked immunosorbent assay (ELISA) (Notermans et al., 1978; Stiffler-Rosenberg and Fey, 1978) and reversed passive latex agglutination (RPLA) (Shingaki et al., 1981) have been employed for detecting SE. The sensitivity of these techniques is about 1-5 ng per ml culture supernatant and false negative reactions are not likely to occur. On the other hand false positive reactions are possible due to lack of a specific positive control system (Notermans et al., 1989). Several quite surprising reports have been published covering SE production by isolated strains detected by the ELISA technique. Cantoni et al. (1986) found 92% of bovine S. aureus strains producing SE as detected by the ELISA of Stiffler-Rosenberg and Fey (1978). Isigidi et al. (1986), by employing the Notermans et al. (1978) ELISA technique, detected SE production by all of 59 S. aureus strains tested. Olsvik et al. (1982) employing an ELISA technique as developed by Berdal et al. (1981) detected micrococci producing SE. To check such results the D N A - D N A hybridization technique for detecting the genes encoding SE may be useful. This technique has proved to be reliable since it was observed that if the gene encoding SE is present, production of the toxin does occur (Notermans et al., 1988). Thus, it is possible to confirm SE detection by the above mentioned immunological methods by DNA hybridization using DNA-probes encoding the SE genes. In this study the D N A - D N A colony hybridization was employed to evaluate the results obtained by different immunological methods for detection of SE.
Materials and Methods Bacterial strains and detection methods for S E production Human clinical isolates of S. aureus tested for SE production were obtained from
N. v, Leeuwen, Natl. Inst. Publ. Health Environ. Protect., Bilthoven, The Netherlands. They were tested for SE production by inoculation of one colony into 2 ml brain heart infusion broth in 30 ml Erlemeyer flasks, closed with Artiflex ~ and incubated overnight in a Macintosh jar with 10% CO 2 and rotation (150 rpm) at 37 ° C. After centrifugation for 10 min at 10 000 rpm, the supernatant was used for immunological detection of SEB, SEC and toxic shock syndrome toxin (TSST-1) by the OSP technique (Robbins et al., 1974). Supernatant diluted 1 : 10 and 1 : 100 was tested for SEA and SEE by ELISA following the method of Notermans et al. (1978). Food isolates of S. aureus originated from S. Notermans, Natl. Inst. Publ. Health Environ. Protect., Bilthoven, The Netherlands. For production of SE the sac culture method of Donelly et al. (1967) was employed. The presence of SEA through SEE was tested using the ELISA (Notermans et al., 1978) or OSP method (Robbins et
253 al., 1974). Other food isolates of S. aureus, tested for SE production, were obtained from C. Mueller, Dept. Vet. Food Hygiene, Zurich, Switzerland. For production of SE the sac culture method of Donelly et al. (1967) was employed. Detection of SE was carried out with ELISA (Notermans et al., 1978). S. aureus good isolates were obtained from S. Ewald, Dept. Food Hygiene, Norwegian College of Vet. Med., Oslo, Norway. The sac culture method of Donelly et al. (1967) was employed for SE production. Detection of SEA through SEE was carried out by the MS test (Bennett and McClure, 1976). Sera and purified SE were obtained from Serva, Heidelberg, F.R.G. Isolates of S. aureus from foods and human clinical specimens, tested for SE production, were obtained from A.A. Wieneke, Central Public Health Lab., London. For production of SE the cellophane-overlay-agar method (Robbins et al., 1974) was employed. Detection of SEA through SEE was carried out with the OSP method (Robbins et al., 1974). Human, bovine, ovine and avian S. aureus isolates tested for SE production were obtained from B.K. Isigidi, Dept. Hygiene, Univ. of Gent, Belgium. For production of SE the sac culture method of Donelly et al. (1967) was employed. Detection of SEA through SED was carried out with both the SET-RPLA kit (Oxoid) developed from the method described by Shingaki et al. (1981), and the SET-EIA kit (Bommeli, Berne, Switzerland) based on a sandwich ELISA (Stiffler-Rosenberg and Fey, 1978). Thirteen micrococci were obtained from N. v. Leeuwen, Natl. Int. Publ. Health Environ. Protect., Bilthoven, The Netherlands. Four micrococci were obtained from S. Ewald, Dept. Food Hygiene, Norwegian College of Vet. Med., Oslo, Norway. The micrococci were tested by Lysostaphin disc test (Roche) and all were resistant to lysostaphin. D N A probes
The synthesized DNA probes had the following nucleotide sequences: Probe SEA, 5' TTCATTGCCCTAACGTTGACAACAAGTCCACTTGTAAATGGT 3' Probe SEB. 5' TACTTTGACTTAATATATTCTATTAAGGACACTAAGTTAGGG 3' Probe SEC, 5' ATTTTTGGCACATGATTTAATTTATAACATTAGTGATA 3' The probes were synthesized on a Pharmacia Gene Assembler using phosphoramidite chemistry (Sinka et al. 1983). The SEA probe encoded the signal sequence of the 14 amino acids preceding the SEA molecule (Betley and Mekalanos, 1988). This sequence has been demonstrated to occur as well in the signal sequence of SEE (Cough et al., 1988). The SEB probe encoded amino acids 62 through 76 of the SEB molecule (Jones and Khan, 1986). The SEC probe encoded amino acids 109 through 122 of the SEC molecule (Bohach and Schlievert, 1987). This probe gave a positive hybridization result with the reference S. aureus strains FRI 137C, FRI 361 and FRI 230 producing SECt, S E C 2 and SEC 3 respectively. Furthermore it was demonstrated by Bohach and Schlievert (1989) that this nucleotide sequence occurred in both SEC 1 and SEC 2.
254
The DNA probes were labelled with 32p by the method of Maxam and Gilbert (1980). Colony hybridization
For testing the presence of different enterotoxin genes in S. aureus a colony hybridization procedure identical to Notermans et al. (1988) was used. After hybridization of the probes the membranes were washed in a solution containing 30 mM NaC1 and 3 mM sodium citrate for 30 min at 46 ° C.
Results
A summary of the different detection methods for SE production examined in this study is given in Table I. Strains of S. aureus found to produce SE by the different methods, and their hybridization reactions are shown in Table II. The D N A probe encoding amino acids of SEA also detected SEE gene because of 100% homology. The OSP employed in test method la, 2a and 3 showed the best accordance between the immuno-assay and the hybridization reaction. The homology was 100% for method l a and 2a. 8% of the SEC producing strains had no hybridization reaction in test method 3. The ELISA employed in test methods lb and 2b showed more discrepancy. For method lb, 14% SEA producing strains had no hybridization reaction. 17% SEB producers and 12.5% SEC producers had no hybridization reactions in test method 2b. The microslide technique employed in test method 5 had 60% SEB and 33% SEC producers without hybridization reactions. The test method showing most discrepancy between immuno-assay and hybridization reactions was the RPLA test (method 4). The percentage of SEA-, SEB- and
TABLE I Detection methods for staphylococcal enterotoxin (SE) production Method la Inoculation of Erlemeyers containing brain heart infusion (BHI) and incubation for 48 h at 37°C with rotation (150 rpm). SE detection by optimal sensitivity plate (OSP) procedure. (Flask/OSP). lb Inoculation of Erlemeyers containing BHI and incubation for 48 h at 37 °C with rotation (150 rpm). SE detection by sandwich ELISA (Notermans et al. (1978) or SET-EIA). (Flask/ELISA). 2a SE production by the sac culture method. SE detection by OSP procedure. (Sac/OSP). 2b SE production by the sac culture method. SE detection by sandwich ELISA (Notermans et al. (1978) or SET-EIA). (Sac/ELISA). 3 SE production by cellophane-over-agar method. SE detection of OSP procedure. (Cellophane/OSP). 4 SE production by sac culture method. SE detection by RPLA (Oxoid). (Sac/RPLA). 5 SE production by sac culture method. SE detection by microslide gel double diffusion (MS) test. (Sac/MS).
255 T A B L E II Hybridization reactions of three synthetic D N A probes encoding amino acids of SEA (SEE), SEB and SEC, with strains of Staphylococcus aureus found to produce SE by immuno-assays Test method for SE production a
Enterotoxins produced SEA
SEB
SEC
la lb 2a 2b 3 4 5
22/19 c 4/4 4/4 2/2 8/5 5/5
10/10 _ 7/7 18/15 3/2 5/2
14/14 13/13 7/7 16/14 26/24 48/3 9/6
(Flask/OSP) (Flask/ELISA) (Sac/OSP) (Sac/ELISA) (Cellophane/OSP) (Sac/RPLA) (Sac/MS)
SEE b
2/2 1/1 2/2
a For test method applied see Table I. b Strains producing SEE were tested with probe for SEA. c x / y : x = n u m b e r of strains producing SEA; y = number of strains with hybridization reactions with probe for SEA.
T A B L E III Hybridization reactions of three synthetic D N A probes encoding amino acids of SEA (SEE), SEB and SEC, respectively, with strains of S. aureus found not to produce SE by immuno-assays Test method for SE production a
Enterotoxin not produced SEA
SEB
SEC
la lb 5
72/2 b 8/1
86/1 _ 7/1
83/2 _ 8/1
(Flask/OSP) (Flask/ELISA) (Sac/MS)
a See for test methods Table I. x = strains without production of SEA; y = n u m b e r of strains with hybridization reaction with probe for SEA.
b x/y:
SEC-producing strains showing no hybridization reactions were 37.5, 33 and 94, respectively. Forty-eight strains positive for SEC by RPLA were retested by the SET-EIA and only three were then positive. These three strains hybridized with the SEC probe. Hybridization reactions with strains of S. a u r e u s found not to produce SE by immuno-assays are shown in Table III. It appears that these results reveal no significant difference between immuno-assay and hybridization reactions. All 17 strains of different micrococci were negative in hybridization with either SEA, SEB or SEC probe (results not presented). Discussion
In comparison with DNA hybridization none of the immunological methods available for detection of SE production are 100% reliable. The two modifications of
256 the Ouchterlony method, the OSP and the MS method employing a specific control for positive reactions would not be expected to give false positive reactions if carried out correctly. Anyhow, the hybridization results for strains positive by the MS might indicate some false positive results. Reading of weakly positive MS reactions may be difficult, and it is well known that the OSP is more specific, though less sensitive (Kokan and Bergdoll, 1987). In this study the OSP method was indeed in good agreement with the hybridization reactions regarding the SE-positive strains. The hybridization reactions for strains SE-negative by MS and OSP are probably due to the low sensitivity of these methods. The sensitivity of the ELISA is far better than the MS and OSP methods, and false negative results are not likely to occur. In this study two such reactions occurred, and this might be due to technical errors in performing the ELISA technique. Including positive controls in the ELISA can reveal such errors. False positive results have been a problem when detecting SE production by ELISA, and especially weak positive results are difficult to evaluate. The use of anti-idiotype antibodies as specific blocking agent in the ELISA is a useful possibility for testing false positive results (Notermans et al., 1989). In this study 12.5 to 17% of the strains SE-positive by ELISA did not hybridize with the corresponding D N A probe and may thus be considered as false positive reactions. D N A hybridization is not 100% reliable. However, as false negative hybridization results may be due to either a bad colony removal or too small colonies, it is easy to control. The RPLA performed poorly in this study. This was the case both when compared to D N A hybridization and ELISA. A contact with the manufacturer of the SET-RPLA kit revealed that antibody coating of the latex particles had been done with a higher antibody concentration than previously. This error created problems in different laboratories in 1988. It concerned especially SEC detection, as all tests for SEC were positive. In this study a retesting was made by ELISA and these results were in complete agreement with the D N A hybridization. The detection of SE production is not only dependent of the assay employed to detect SE, but also the substrate employed for production of SE. SE synthesis may differ under natural and laboratory conditions used to ascertain SE production (Gomez-Lucia et al., 1989). Such considerations are avoided by employing D N A hybridization.
Acknowledgements The authors are highly indebted to Dr. van Leeuwen, Dr. Mueller, Dr. Wieneke and Dr. Isigidi for placing the different bacterial strains at our proposal.
References Bennett, R.W. and McClure, F. (1976) Collaborative study of the serological identification of staphylococcal enterotoxin by the Microslide Gel Double Diffusion Test. J. Assoc. Off. Anal. Chem. 59, 594-601.
257 Berdal, B.P., Olsvik, O. and Omland, T. (1981) A sandwich ELISA method for detection of Staphylococcus aureus enterotoxins. Acta Path. Microbiol. Scand. Sect. B. 89, 411-415. Betley, M.J. and Mekalanos, J.H. (1988) Nucleotide sequence of the type A staphylococcal enterotoxin gene. J. Bacteriol. 170, 34-41. Bohach, G.A. and Schlievert, P.M. (1987) Nucleotide sequence of the staphylococcal enterotoxin C1 gene and relatedness to other pyrogenic toxins. Mol. Gen. Genet. 209, 15-20. Bohach, G.A. and Schlievert, P.M. (1989) Conservation of the biologically active portions of staphylococcal enterotoxins C 1 and C 2 Infect. Immun. 57, 2249-2252. Cantoni, C., Cattaneo, P. and Balzaretti, C. (1986) Enterotoxigenicity of Staph. aureus strains isolated from foods. Industrie Alimentari 25, 554-556. Casman, E.P., Bennett, R.W., Dorsey, A.E. and Stone, B.S. (1969) The micro slide gel double diffusion test for the detection and assay of staphylococcal enterotoxins. Health Lab. Sci. 6, 185-198. Cough, J.L., Sollis, M.T. and Betley, M.J. (1988) Cloning and nucleotide sequence of the type E staphylococcal enterotoxin gene. J. Bact. 170, 2954-2960. Donelly, C.B., Leslie, J.E., Black, L.A. and Lewis, K.H. (1967) Serological Identification of Enterotoxigenic Staphylococci from Cheese. Appl. Microbiol. 15, 1382-1387. Gomez-Lucia, E., Goyache, J., Orden, J.A., Blanco, J.L., Ruiz-Santa-Quiteria, J.A., Dominguez, L. and Suarez, G. (1989) Production of Enterotoxin A by Supposedly Nonenterotoxigenic Staphylococcus aureus strains. Appl. Environ. Microbiol. 55, 1447-1451. Isigidi, B.K., Devriese, L., Godard, C. and van Hoof, J. (1986) Enterotoxin production in different biotypes and phage groups of S. aureus from raw minced meat. In: Foodborne Infections and Intoxications, Vol. 2, Proc. 2nd World Congr., West-Berlin, Robert v. Ostertag Instr., pp. 1174-1176. Jones, C.L. and Khan, S.A. (1986) Nucleotide sequence of the enterotoxin B gene from Staphylococcus aureus. J. Bacteriol. 166, 29-33. Kokan, N.P. and Bergdoll, M.S. (1987) Detection of low-enterotoxin-producing Staphylococcus aureus strains. Appl. Environ. Microbiol. 53, 2675-2676. Maxam, A.M. and Gilbert, W. (1980) Sequencing end-labelled DNA with base-specific chemical cleavages. Meth. Enzymol. 65, 499-560. Notermans, S., Verjans, H.L., Bol, J. and van Schothorst, M. (1978) Enzyme linked immunosorbent assay (ELISA) for determination of Staphylococcus aureus enterotoxin type B. Health Lab. Sci. 15, 28-31. Notermans, S., Heuvelman, K.J. and Wernars, K. (1988) Synthetic enterotoxin B DNA probes for detection of enterotoxigenic Staphylococcus aureus strains. Appl. Environ. Microbiol. 54, 531-533. Notermans, S., Alber, G., Sailer-Kramer, B. and Hammer, D.K. (1989) The use of an anti-idiotype monoclonal antibody for reliable detection of staphylococcal enterotoxins. Food Agricult. Immunol. 1, 11-17. Olsvik, O., Fossum, K. and Berdal, B.P. (1982) Staphylococcal enterotoxin A, B and C produced by coagulase-negative strains within the family Mierococcaceae. Acta Pathol. Microbiol. Immunol. Scand. Sect. B. 90, 441-444. Robbins, R., Gould, S. and Bergdoll, M.S. (1974) Detecting the enterotoxigenicity of Staphylococcus aureus strains. AppI. Microbiol. 28, 946-950. Shingaki, M., Igarashi, H., Fujikawa, H., Ushioda, H., Erayama, T. and Sakai, S. (1981) Study on reversed passive latex agglutination for the detection of staphylococcal enterotoxins A-C. Annu. Rep. Tokyo Metr. Res. Lab. Publ. Health 32, 128-131. Sinka, N.D., Biernat, J. and KSster, H. (1983) ]~-Cyanoethyl N 1 N - d i a l k y l a m i n o / N monopholinomonochloro phosphoamidites, new phosphorylating agents facilitating ease of deprotection and work-up of synthesized oligo-nucleotides. Tetrahedron Lett. 24, 5843-5846. Stiffler-Rosenberg, G. and Fey, H. (1978) Simple assay for staphylococcal enterotoxins A, B, and C: Modification of enzyme-linked immunosorbent assay. J. Clin. Microbiol. 8, 473-479.
251
FOOD 00336
The use of DNA probes for confirming enterotoxin production by Staphylococcus aureus and micrococci S. Ewald 1, C.J. H e u v e l m a n 2 and S. N o t e r m a n s 2 1
.
.
.
.
.
Department of Food Hygwne, Norwegian College of Veterinary Medtcme, Oslo, Norway, and : National Institute of Public Health and Environmental Protection, Bilthoven, The Netherlands' (Received 27 November 1989; accepted 28 May 1990)
D N A - D N A colony hybridization was employed to evaluate the results obtained by different immunological methods for detection of staphylococcal enterotoxin. Staphylococcus aureus strains tested for staphylococcal enterotoxin production by immuno-assays and micrococci not previously tested for staphylococcal enterotoxin production were examined for presence of the genes encoding for staphylococcal enterotoxin A, B, C and E by using three corresponding DNA probes. The staphylococcal enterotoxin A probe also detected staphylococcal enterotoxin E gene because of 100% homology. The optimal sensitivity plate method showed the best accordance between the immuno-assay and the hybridization reactions. The enzyme-linked immunosorbent assay detected 12.5 to 17% staphylococcal enterotoxin producers without hybridization reactions. The microslide gel double diffusion test and the reversed passive latex agglutination test showed rather poor accordance with the hybridization reactions. All 17 strains of different micrococci investigated were negative in hybridization with all three DNA probes. Key words: Staphylococcal enterotoxin; Immunoassay; D N A - D N A hybridization
1. Introduction Staphylococcus aureus has long been recognized as a major cause of bacterial food poisoning due to ingestion of foods with preformed staphylococcal enterotoxin (SE). A number of serologically different enterotoxins have been identified and designated by the letters A through E (SEA through SEE). The first methods applied for detection of SE were biological assays such as the monkey and kitten feeding test. Thereafter, immunological techniques were elaborated based on the Ouchterlony gel-double-diffusion technique modified as the microslide gel double diffusion test (MS) (Casman et al., 1969) or the optimum sensitivity plate (OSP) method (Robbins et al., 1974). The Ouchterlony technique
Correspondence address." S. Ewald, Department of Food Hygiene, Norwegian College of Veterinary Medicine, P.O. Box 8146 DEP, 0033 Oslo 1, Norway. 0168-1605/90/$03.50 © 1990 Elsevier Science Publishers B.V. (Biomedical Division)
252 employing a positive control system yields positive results of high specificity, but difficulties are often encountered with the MS, as this method demands some training and dexterity. False negative results may occur due to the relative low sensitivity, which is about 100 ng SE per ml culture supernatant for the MS and about 500 ng for the OSP. Low SE production has been detected by OSP negative S. aureus strains (Kokan and Bergdoll, 1987). During the last decade far more sensitive techniques such as the enzyme-linked immunosorbent assay (ELISA) (Notermans et al., 1978; Stiffler-Rosenberg and Fey, 1978) and reversed passive latex agglutination (RPLA) (Shingaki et al., 1981) have been employed for detecting SE. The sensitivity of these techniques is about 1-5 ng per ml culture supernatant and false negative reactions are not likely to occur. On the other hand false positive reactions are possible due to lack of a specific positive control system (Notermans et al., 1989). Several quite surprising reports have been published covering SE production by isolated strains detected by the ELISA technique. Cantoni et al. (1986) found 92% of bovine S. aureus strains producing SE as detected by the ELISA of Stiffler-Rosenberg and Fey (1978). Isigidi et al. (1986), by employing the Notermans et al. (1978) ELISA technique, detected SE production by all of 59 S. aureus strains tested. Olsvik et al. (1982) employing an ELISA technique as developed by Berdal et al. (1981) detected micrococci producing SE. To check such results the D N A - D N A hybridization technique for detecting the genes encoding SE may be useful. This technique has proved to be reliable since it was observed that if the gene encoding SE is present, production of the toxin does occur (Notermans et al., 1988). Thus, it is possible to confirm SE detection by the above mentioned immunological methods by DNA hybridization using DNA-probes encoding the SE genes. In this study the D N A - D N A colony hybridization was employed to evaluate the results obtained by different immunological methods for detection of SE.
Materials and Methods Bacterial strains and detection methods for S E production Human clinical isolates of S. aureus tested for SE production were obtained from
N. v, Leeuwen, Natl. Inst. Publ. Health Environ. Protect., Bilthoven, The Netherlands. They were tested for SE production by inoculation of one colony into 2 ml brain heart infusion broth in 30 ml Erlemeyer flasks, closed with Artiflex ~ and incubated overnight in a Macintosh jar with 10% CO 2 and rotation (150 rpm) at 37 ° C. After centrifugation for 10 min at 10 000 rpm, the supernatant was used for immunological detection of SEB, SEC and toxic shock syndrome toxin (TSST-1) by the OSP technique (Robbins et al., 1974). Supernatant diluted 1 : 10 and 1 : 100 was tested for SEA and SEE by ELISA following the method of Notermans et al. (1978). Food isolates of S. aureus originated from S. Notermans, Natl. Inst. Publ. Health Environ. Protect., Bilthoven, The Netherlands. For production of SE the sac culture method of Donelly et al. (1967) was employed. The presence of SEA through SEE was tested using the ELISA (Notermans et al., 1978) or OSP method (Robbins et
253 al., 1974). Other food isolates of S. aureus, tested for SE production, were obtained from C. Mueller, Dept. Vet. Food Hygiene, Zurich, Switzerland. For production of SE the sac culture method of Donelly et al. (1967) was employed. Detection of SE was carried out with ELISA (Notermans et al., 1978). S. aureus good isolates were obtained from S. Ewald, Dept. Food Hygiene, Norwegian College of Vet. Med., Oslo, Norway. The sac culture method of Donelly et al. (1967) was employed for SE production. Detection of SEA through SEE was carried out by the MS test (Bennett and McClure, 1976). Sera and purified SE were obtained from Serva, Heidelberg, F.R.G. Isolates of S. aureus from foods and human clinical specimens, tested for SE production, were obtained from A.A. Wieneke, Central Public Health Lab., London. For production of SE the cellophane-overlay-agar method (Robbins et al., 1974) was employed. Detection of SEA through SEE was carried out with the OSP method (Robbins et al., 1974). Human, bovine, ovine and avian S. aureus isolates tested for SE production were obtained from B.K. Isigidi, Dept. Hygiene, Univ. of Gent, Belgium. For production of SE the sac culture method of Donelly et al. (1967) was employed. Detection of SEA through SED was carried out with both the SET-RPLA kit (Oxoid) developed from the method described by Shingaki et al. (1981), and the SET-EIA kit (Bommeli, Berne, Switzerland) based on a sandwich ELISA (Stiffler-Rosenberg and Fey, 1978). Thirteen micrococci were obtained from N. v. Leeuwen, Natl. Int. Publ. Health Environ. Protect., Bilthoven, The Netherlands. Four micrococci were obtained from S. Ewald, Dept. Food Hygiene, Norwegian College of Vet. Med., Oslo, Norway. The micrococci were tested by Lysostaphin disc test (Roche) and all were resistant to lysostaphin. D N A probes
The synthesized DNA probes had the following nucleotide sequences: Probe SEA, 5' TTCATTGCCCTAACGTTGACAACAAGTCCACTTGTAAATGGT 3' Probe SEB. 5' TACTTTGACTTAATATATTCTATTAAGGACACTAAGTTAGGG 3' Probe SEC, 5' ATTTTTGGCACATGATTTAATTTATAACATTAGTGATA 3' The probes were synthesized on a Pharmacia Gene Assembler using phosphoramidite chemistry (Sinka et al. 1983). The SEA probe encoded the signal sequence of the 14 amino acids preceding the SEA molecule (Betley and Mekalanos, 1988). This sequence has been demonstrated to occur as well in the signal sequence of SEE (Cough et al., 1988). The SEB probe encoded amino acids 62 through 76 of the SEB molecule (Jones and Khan, 1986). The SEC probe encoded amino acids 109 through 122 of the SEC molecule (Bohach and Schlievert, 1987). This probe gave a positive hybridization result with the reference S. aureus strains FRI 137C, FRI 361 and FRI 230 producing SECt, S E C 2 and SEC 3 respectively. Furthermore it was demonstrated by Bohach and Schlievert (1989) that this nucleotide sequence occurred in both SEC 1 and SEC 2.
254
The DNA probes were labelled with 32p by the method of Maxam and Gilbert (1980). Colony hybridization
For testing the presence of different enterotoxin genes in S. aureus a colony hybridization procedure identical to Notermans et al. (1988) was used. After hybridization of the probes the membranes were washed in a solution containing 30 mM NaC1 and 3 mM sodium citrate for 30 min at 46 ° C.
Results
A summary of the different detection methods for SE production examined in this study is given in Table I. Strains of S. aureus found to produce SE by the different methods, and their hybridization reactions are shown in Table II. The D N A probe encoding amino acids of SEA also detected SEE gene because of 100% homology. The OSP employed in test method la, 2a and 3 showed the best accordance between the immuno-assay and the hybridization reaction. The homology was 100% for method l a and 2a. 8% of the SEC producing strains had no hybridization reaction in test method 3. The ELISA employed in test methods lb and 2b showed more discrepancy. For method lb, 14% SEA producing strains had no hybridization reaction. 17% SEB producers and 12.5% SEC producers had no hybridization reactions in test method 2b. The microslide technique employed in test method 5 had 60% SEB and 33% SEC producers without hybridization reactions. The test method showing most discrepancy between immuno-assay and hybridization reactions was the RPLA test (method 4). The percentage of SEA-, SEB- and
TABLE I Detection methods for staphylococcal enterotoxin (SE) production Method la Inoculation of Erlemeyers containing brain heart infusion (BHI) and incubation for 48 h at 37°C with rotation (150 rpm). SE detection by optimal sensitivity plate (OSP) procedure. (Flask/OSP). lb Inoculation of Erlemeyers containing BHI and incubation for 48 h at 37 °C with rotation (150 rpm). SE detection by sandwich ELISA (Notermans et al. (1978) or SET-EIA). (Flask/ELISA). 2a SE production by the sac culture method. SE detection by OSP procedure. (Sac/OSP). 2b SE production by the sac culture method. SE detection by sandwich ELISA (Notermans et al. (1978) or SET-EIA). (Sac/ELISA). 3 SE production by cellophane-over-agar method. SE detection of OSP procedure. (Cellophane/OSP). 4 SE production by sac culture method. SE detection by RPLA (Oxoid). (Sac/RPLA). 5 SE production by sac culture method. SE detection by microslide gel double diffusion (MS) test. (Sac/MS).
255 T A B L E II Hybridization reactions of three synthetic D N A probes encoding amino acids of SEA (SEE), SEB and SEC, with strains of Staphylococcus aureus found to produce SE by immuno-assays Test method for SE production a
Enterotoxins produced SEA
SEB
SEC
la lb 2a 2b 3 4 5
22/19 c 4/4 4/4 2/2 8/5 5/5
10/10 _ 7/7 18/15 3/2 5/2
14/14 13/13 7/7 16/14 26/24 48/3 9/6
(Flask/OSP) (Flask/ELISA) (Sac/OSP) (Sac/ELISA) (Cellophane/OSP) (Sac/RPLA) (Sac/MS)
SEE b
2/2 1/1 2/2
a For test method applied see Table I. b Strains producing SEE were tested with probe for SEA. c x / y : x = n u m b e r of strains producing SEA; y = number of strains with hybridization reactions with probe for SEA.
T A B L E III Hybridization reactions of three synthetic D N A probes encoding amino acids of SEA (SEE), SEB and SEC, respectively, with strains of S. aureus found not to produce SE by immuno-assays Test method for SE production a
Enterotoxin not produced SEA
SEB
SEC
la lb 5
72/2 b 8/1
86/1 _ 7/1
83/2 _ 8/1
(Flask/OSP) (Flask/ELISA) (Sac/MS)
a See for test methods Table I. x = strains without production of SEA; y = n u m b e r of strains with hybridization reaction with probe for SEA.
b x/y:
SEC-producing strains showing no hybridization reactions were 37.5, 33 and 94, respectively. Forty-eight strains positive for SEC by RPLA were retested by the SET-EIA and only three were then positive. These three strains hybridized with the SEC probe. Hybridization reactions with strains of S. a u r e u s found not to produce SE by immuno-assays are shown in Table III. It appears that these results reveal no significant difference between immuno-assay and hybridization reactions. All 17 strains of different micrococci were negative in hybridization with either SEA, SEB or SEC probe (results not presented). Discussion
In comparison with DNA hybridization none of the immunological methods available for detection of SE production are 100% reliable. The two modifications of
256 the Ouchterlony method, the OSP and the MS method employing a specific control for positive reactions would not be expected to give false positive reactions if carried out correctly. Anyhow, the hybridization results for strains positive by the MS might indicate some false positive results. Reading of weakly positive MS reactions may be difficult, and it is well known that the OSP is more specific, though less sensitive (Kokan and Bergdoll, 1987). In this study the OSP method was indeed in good agreement with the hybridization reactions regarding the SE-positive strains. The hybridization reactions for strains SE-negative by MS and OSP are probably due to the low sensitivity of these methods. The sensitivity of the ELISA is far better than the MS and OSP methods, and false negative results are not likely to occur. In this study two such reactions occurred, and this might be due to technical errors in performing the ELISA technique. Including positive controls in the ELISA can reveal such errors. False positive results have been a problem when detecting SE production by ELISA, and especially weak positive results are difficult to evaluate. The use of anti-idiotype antibodies as specific blocking agent in the ELISA is a useful possibility for testing false positive results (Notermans et al., 1989). In this study 12.5 to 17% of the strains SE-positive by ELISA did not hybridize with the corresponding D N A probe and may thus be considered as false positive reactions. D N A hybridization is not 100% reliable. However, as false negative hybridization results may be due to either a bad colony removal or too small colonies, it is easy to control. The RPLA performed poorly in this study. This was the case both when compared to D N A hybridization and ELISA. A contact with the manufacturer of the SET-RPLA kit revealed that antibody coating of the latex particles had been done with a higher antibody concentration than previously. This error created problems in different laboratories in 1988. It concerned especially SEC detection, as all tests for SEC were positive. In this study a retesting was made by ELISA and these results were in complete agreement with the D N A hybridization. The detection of SE production is not only dependent of the assay employed to detect SE, but also the substrate employed for production of SE. SE synthesis may differ under natural and laboratory conditions used to ascertain SE production (Gomez-Lucia et al., 1989). Such considerations are avoided by employing D N A hybridization.
Acknowledgements The authors are highly indebted to Dr. van Leeuwen, Dr. Mueller, Dr. Wieneke and Dr. Isigidi for placing the different bacterial strains at our proposal.
References Bennett, R.W. and McClure, F. (1976) Collaborative study of the serological identification of staphylococcal enterotoxin by the Microslide Gel Double Diffusion Test. J. Assoc. Off. Anal. Chem. 59, 594-601.
257 Berdal, B.P., Olsvik, O. and Omland, T. (1981) A sandwich ELISA method for detection of Staphylococcus aureus enterotoxins. Acta Path. Microbiol. Scand. Sect. B. 89, 411-415. Betley, M.J. and Mekalanos, J.H. (1988) Nucleotide sequence of the type A staphylococcal enterotoxin gene. J. Bacteriol. 170, 34-41. Bohach, G.A. and Schlievert, P.M. (1987) Nucleotide sequence of the staphylococcal enterotoxin C1 gene and relatedness to other pyrogenic toxins. Mol. Gen. Genet. 209, 15-20. Bohach, G.A. and Schlievert, P.M. (1989) Conservation of the biologically active portions of staphylococcal enterotoxins C 1 and C 2 Infect. Immun. 57, 2249-2252. Cantoni, C., Cattaneo, P. and Balzaretti, C. (1986) Enterotoxigenicity of Staph. aureus strains isolated from foods. Industrie Alimentari 25, 554-556. Casman, E.P., Bennett, R.W., Dorsey, A.E. and Stone, B.S. (1969) The micro slide gel double diffusion test for the detection and assay of staphylococcal enterotoxins. Health Lab. Sci. 6, 185-198. Cough, J.L., Sollis, M.T. and Betley, M.J. (1988) Cloning and nucleotide sequence of the type E staphylococcal enterotoxin gene. J. Bact. 170, 2954-2960. Donelly, C.B., Leslie, J.E., Black, L.A. and Lewis, K.H. (1967) Serological Identification of Enterotoxigenic Staphylococci from Cheese. Appl. Microbiol. 15, 1382-1387. Gomez-Lucia, E., Goyache, J., Orden, J.A., Blanco, J.L., Ruiz-Santa-Quiteria, J.A., Dominguez, L. and Suarez, G. (1989) Production of Enterotoxin A by Supposedly Nonenterotoxigenic Staphylococcus aureus strains. Appl. Environ. Microbiol. 55, 1447-1451. Isigidi, B.K., Devriese, L., Godard, C. and van Hoof, J. (1986) Enterotoxin production in different biotypes and phage groups of S. aureus from raw minced meat. In: Foodborne Infections and Intoxications, Vol. 2, Proc. 2nd World Congr., West-Berlin, Robert v. Ostertag Instr., pp. 1174-1176. Jones, C.L. and Khan, S.A. (1986) Nucleotide sequence of the enterotoxin B gene from Staphylococcus aureus. J. Bacteriol. 166, 29-33. Kokan, N.P. and Bergdoll, M.S. (1987) Detection of low-enterotoxin-producing Staphylococcus aureus strains. Appl. Environ. Microbiol. 53, 2675-2676. Maxam, A.M. and Gilbert, W. (1980) Sequencing end-labelled DNA with base-specific chemical cleavages. Meth. Enzymol. 65, 499-560. Notermans, S., Verjans, H.L., Bol, J. and van Schothorst, M. (1978) Enzyme linked immunosorbent assay (ELISA) for determination of Staphylococcus aureus enterotoxin type B. Health Lab. Sci. 15, 28-31. Notermans, S., Heuvelman, K.J. and Wernars, K. (1988) Synthetic enterotoxin B DNA probes for detection of enterotoxigenic Staphylococcus aureus strains. Appl. Environ. Microbiol. 54, 531-533. Notermans, S., Alber, G., Sailer-Kramer, B. and Hammer, D.K. (1989) The use of an anti-idiotype monoclonal antibody for reliable detection of staphylococcal enterotoxins. Food Agricult. Immunol. 1, 11-17. Olsvik, O., Fossum, K. and Berdal, B.P. (1982) Staphylococcal enterotoxin A, B and C produced by coagulase-negative strains within the family Mierococcaceae. Acta Pathol. Microbiol. Immunol. Scand. Sect. B. 90, 441-444. Robbins, R., Gould, S. and Bergdoll, M.S. (1974) Detecting the enterotoxigenicity of Staphylococcus aureus strains. AppI. Microbiol. 28, 946-950. Shingaki, M., Igarashi, H., Fujikawa, H., Ushioda, H., Erayama, T. and Sakai, S. (1981) Study on reversed passive latex agglutination for the detection of staphylococcal enterotoxins A-C. Annu. Rep. Tokyo Metr. Res. Lab. Publ. Health 32, 128-131. Sinka, N.D., Biernat, J. and KSster, H. (1983) ]~-Cyanoethyl N 1 N - d i a l k y l a m i n o / N monopholinomonochloro phosphoamidites, new phosphorylating agents facilitating ease of deprotection and work-up of synthesized oligo-nucleotides. Tetrahedron Lett. 24, 5843-5846. Stiffler-Rosenberg, G. and Fey, H. (1978) Simple assay for staphylococcal enterotoxins A, B, and C: Modification of enzyme-linked immunosorbent assay. J. Clin. Microbiol. 8, 473-479.