- Email: [email protected]
The vaccine efficacy of recombinant duck enteritis virus expressing secreted E with or without PrM proteins of duck tembusu virus
Vaccine 32 (2014) 5271–5277
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
The vaccine efficacy of recombinant duck enteritis virus expressing secreted E with or without PrM proteins of duck tembusu virus Pucheng Chen 1 , Jinxiong Liu 1 , Yongping Jiang ∗ , Yuhui Zhao, Qimeng Li, Li Wu, Xijun He, Hualan Chen ∗ State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 19 May 2014 Received in revised form 10 July 2014 Accepted 22 July 2014 Available online 1 August 2014 Keywords: Recombinant DEVs Duck tembusu virus Vector vaccine
a b s t r a c t A newly emerged tembusu virus that causes egg-drop has been affecting ducks in China since 2010. Currently, no vaccine is available for this disease. A live attenuated duck enteritis virus (DEV; a herpesvirus) vaccine has been used routinely to control lethal DEV in ducks since the 1960s. Here, we constructed two recombinant DEVs by transfecting overlapping fosmid DNAs. One virus, rDEV-TE, expresses the truncated form of the envelope glycoprotein (TE) of duck tembusu virus (DTMUV), and the other virus, rDEV-PrM/TE, expresses both the TE and pre-membrane proteins (PrM). Animal study demonstrated that both recombinant viruses induced measurable anti-DTMUV neutralizing antibodies in ducks. After two doses of recombinant virus, rDEV-PrM/TE completely protected ducks from DTMUV challenge, whereas rDEV-TE only conferred partial protection. These results demonstrate that recombinant DEV expressing the TE and pre-membrane proteins is protective and can serve as a potential candidate vaccine to prevent DTMUV infection in ducks. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction In 2010, a newly emerged tembusu virus (a flavivirus) related duck disease characterized by egg-drop suddenly struck south eastern China and quickly spread around the major duck-producing regions of the country, causing serious economic losses [1]. The infected ducks show a heavy drop in egg production accompanied by anorexia, antisocial behavior, diarrhea, and paralysis. The morbidity rates are usually high (up to 90%), while mortality rates vary from 0% to 30% [2]. The viruses were frequently isolated from duck farms after the initial outbreak and have since become a major pathogen of ducks in China [3–7]. Duck tembusu virus (DTMUV) is a single-strand positive RNA virus. Its genome has 10,986 nucleotides and the typical flavivirus genome organization, which consists of three structural proteins, named capsid (C), pre-membrane (PrM), envelope glycoprotein (E), as well as seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) [8,9]. The E protein embeds in the
∗ Corresponding authors at: 427 Maduan Street, Harbin 150001, People’s Republic of China. Tel.: +86 451 51997168; fax: +86 451 82733132. E-mail addresses: [email protected] (Y. Jiang), [email protected] (H. Chen). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.vaccine.2014.07.082 0264-410X/© 2014 Elsevier Ltd. All rights reserved.
virus surface and has important functions in several aspects of the viral life cycle. The PrM protein stabilizes the conformation of E and protects it from degradation [10,11]. The E protein is the major target for neutralizing antibodies, which play a critical role in the clearance of flavivirus inflection [12]. Vaccine studies on Japanese encephalitis virus, West Nile virus, and tick-borne encephalitis virus have shown that a DNA plasmid expressing both PrM and E is more effective than E expression alone [13–16]. The co-expression of PrM/E leads to the formation of virus-like particles (VLPs); these structures are the optimal way to present antigens to the immune system [17]. However, other studies on West Nile virus and dengue virus have shown that co-expression of prM and the formation of VLPs are not prerequisites for the induction of an efficient immune response upon DNA vaccination [18,19]. Therefore, it remains unclear whether the PrM protein is essential to induce immunity against DTMUV. Duck viral enteritis, also called duck plague, is an acute contagious disease among Anseriformes (ducks, geese, and swans) that is caused by the herpesvirus duck enteritis virus (DEV). DEV infection can cause 100% mortality in ducks. A live attenuated DEV vaccine has been developed and used to control duck viral enteritis since the 1960s, and billions of doses of DEV live vaccines are used in China every year [20]. We previously established a system for generating rDEV by transfecting overlapping fosmid DNAs and generated recombinant DEV expressing the hemagglutinin (HA)
5272
P. Chen et al. / Vaccine 32 (2014) 5271–5277
Fig. 1. Insertion of foreign genes into the DEV genome. (A) Genomic structure of DEV and the five fosmid DNAs used for DEV regeneration. Numbers show the location of each fosmid fragment in the DEV genome. (B) Construction of the fosmid with TE inserted within the us7 and us8 genes. (C) Construction of the fosmid with PrM/TE inserted between the us7 and us8 genes.
gene of an H5N1 influenza virus [21]. We demonstrated that the recombinant vaccine provided solid protection against both H5N1 avian influenza and DEV in ducks [21]. In this study, we generated two recombinant DEVs, rDEV-TE and rDEV-PrM/TE, to express the truncated form of the envelope glycoprotein of DTMUV alone or with the PrM protein, and evaluated their protective efficacy against DTMUV challenge in ducks.
and 1% antibiotics. Baby hamster kidney cells (BHK-21) were grown by using Dulbecco’s modified minimal essential media (DMEM) supplemented with 10% FBS and appropriate amounts of antibiotics (Gibco).
2. Materials and methods
We previously established a system to regenerate DEV by transfecting overlapping fosmid DNAs (Fig. 1A) and proved that the insertion of a foreign gene between the us7 and us8 genes of DEV was stable and did not affect the replication and immunogenicity of DEV [21]. In this study, we therefore inserted the foreign genes of interest between the us7 and us8 genes of DEV. First, we constructed a C-terminal truncated E protein (TE) gene expression cassette and a PrM plus TE (PrM/TE) gene expression cassette. In these cassettes, the targeted genes were in-frame fused to a secretory signal sequence derived from chicken tissue plasminogen activator (tPAS) by PCR using two pairs of primers: TPAME-sense (TTAACGCGTACCatgtggaaaacactcagaatgaaaggcaagctcctgagtctcctcc tgctggtgggagtaatcaagactgcccaatgccagggcacacacGCCGCCACCATGCT GAAGCTTG) and TPA-antisense (CCGGCGGCCGCTTATTTTCCAATTGTGCT) (for the PrM/TE gene), or TPAE-sense (ATAACGC GTACCatgtggaaaacactcagaatgaaaggcaagctcctgagtctcctcctgctggtggg agtaatcaagactgcccaatgccagggcacacacTTCAGCTGTCTGGGGATGC) and TPA-antisense (CCGGCGGCCGCTTATTTTCCAATTGTGCT) (for the TE gene). The TPA sequences in these primers are underlined. The resulted PCR products, tPAS-TE and tPAS-PrM/TE, were then introduced into a Gateway entry vector (pEntrySV40), in which the expression of recombinant proteins was regulated by the SV40 promoter. The insertion of tPAS-TE and tPAS-PrM/TE into the fosmid T that contained the us7 and us8 genes was performed as
2.1. Ethics statements The animal experiment was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China. The protocol was approved by the Committee on the Ethics of Animal Experiments of the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (JQ-YA-2012). 2.2. Viruses and cells DEV vaccine strains were obtained from the China Veterinary Culture Collection and propagated in primary chicken embryo fibroblasts (CEFs). Duck tembusu virus (strain: PTD2010) was isolated from a duck in southern China, propagated in the allantoic cavities of 10-day-old specific pathogen-free (SPF) embryonated duck eggs, and kept in a 70 ◦ C freezer before RNA extraction or the challenge study. All recombinant duck enteritis virus was propagated in CEFs. CEFs and duck embryo fibroblasts (DEFs) were prepared from 10-day-old embryonated SPF eggs and maintained in M199 medium (Gibco) supplemented with 5% fetal bovine serum
2.3. Construction of recombinant fosmids bearing the TE protein alone or PrM/TE together
P. Chen et al. / Vaccine 32 (2014) 5271–5277
described previously [21], and the resultant fosmids were designated as T-us78 tPAS-TE and T-us78 tPAS-PrM/TE, respectively (Fig. 1B and C). 2.4. Generation and characterization of recombinant DEVs expressing DTMUV PrM/TE or TE Five fosmid combinations, with or without foreign insertions that covered the entire DEV genome, were used for virus rescue. Viral DNA inserts were released from purified fosmids by digestion with SbfI or FseI enzymes and purified by phenol-chloroform extraction and ethanol precipitation. Five micrograms of DNA was used to transfect primary CEFs in 60-mm dishes by using the calcium phosphate procedure described by Morgan et al. [22]. Cells were observed for cytopathic effects (CPE) for 7 days after transfection, and CPE-positive samples were harvested for further characterization. Recombinant viruses were identified by use of PCR and the insertion of the target genes was confirmed by sequence analysis. 2.5. Confirmation of the expression of the TE and PrM genes in cells infected with the recombinant DEVs Gene expression in the recombinant DEVs was confirmed by using Western blotting and immunofluorescence. Western blotting was performed as described previously [23]. Rabbit polyclonal antiserum against the PrM and E proteins of DTMUV, and a mouse monoclonal anti--actin antibody (Sigma) were used as primary antibodies; IRDye 700DXconjugated goat anti-rabbit IgGs (for PrM and E detection), and donkey anti-mouse IgGs (for actin detection) (Rockland) were used as secondary antibodies. For immunofluorescence studies, CEFs in 60-mm dishes were infected with the rescued virus at a multiplicity of infection (MOI) of 1. Specific rabbit polyclonal antiserum against the E of DTMUV served as the primary antibody source; the secondary antibodies were fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Millipore). 2.6. Vaccine efficacy in ducks Groups of 24 2-week-old SPF ducks were immunized by subcutaneous injection with 106 TCID50 of recombinant DEV viruses or with the parent DEV as a control. Three weeks after inoculation, eight birds from each group were randomly chosen and challenged with a 100-fold DID50 of the DTMUV by intramuscular injection. The remaining sixteen ducks in each group received a second dose of the inoculum. Eight ducks from each group were then challenged at three weeks post-boost and the remaining eight ducks in each group were challenged at 15 weeks post-boost. After each challenge, ducks were checked daily for clinical signs and viremia. Oropharyngeal and cloacal swabs were collected from ducks on day 5 post-challenge for virus titration. Three ducks in each group were euthanized on 7 days post-challenge and their organs were collected for pathologic studies and virus titration in primary DEFs. 2.7. Neutralization assay Sera from immunized ducks were pooled, heat inactivated (30 min at 56 ◦ C) and serially diluted (1:2) in 96-well plates with culture medium. Then, 20 TCID50 of DTMUV was added to each dilution (in triplicates) and the mixtures were incubated for 1 h at 37 ◦ C. BHK-21cells were seeded into 96-well plates immediately after the incubation and propagated for an additional 6 days. Titers of neutralizing antibodies were determined by monitoring the CPE. Each sample was independently tested twice. Neutralizing activity was recorded until two out of three wells of infected cells showed no CPE.
5273
2.8. Detection of viremia Ducks were bled by using a sterile needle and syringe daily for five days. The 0.5-mL blood samples were immediately mixed with 0.5 mL of medium (M199 with 2% fetal bovine serum and penicillinstreptomycin) in a labeled polystyrene centrifuge tube, allowed to sit in the shade at 4 ◦ C for 1 h, and then centrifuged for 10 min (at approximately 500 × g) to separate the serum and medium mixture from the red blood cells. Serially diluted (1:10) serum and medium mixture were added to freshly seeded DEFs and cultured for 4 days. Titers were determined according to the method of Reed and Muench by monitoring the CPE. 2.9. Statistical analysis Viral titers of ducks were compared by use of multiple t-test (GraphPad Prizm). Results are expressed as mean ± standard deviation. 3. Results 3.1. Generation and characterization of recombinant DEVs expressing the TE and PrM/TE genes of DTMUV Previously, we established a system for generating DEV by transfecting overlapping fosmid DNAs and generated recombinant DEVs expressing the HA gene of H5N1 avian influenza viruses [21]. By using the similar strategy, here we generated two recombinant DEV viruses to express the TE gene of DTMUV alone or both the TE and PrM genes of DTMUV. We designated the two viruses as rDEV-TE and rDEV-PrM/TE, respectively. TE protein expression was detected by using Western blotting analysis of cell lysates and supernatants prepared from CEFs infected with rDEV-PrM/TE or rDEV-TE and from DTMUV-infected DEFs (Fig. 2A and B). PrM was detected in the lysates of CEFs infected with rDEV-PrM/TE and DTMUV (Fig. 2A), but was not detected in the supernatant (data not shown). The expression of TE in the CEFs infected with rDEV-TE and rDEV-PrM/TE was further confirmed by immunologically staining with antiserum derived from a rabbit immunized with the recombinant E protein of DTMUV (Fig. 2C). These results confirm that both TE and PrM can be expressed in cells infected with recombinant DEVs. 3.2. Anti-DTMUV neutralizing antibody induced by recombinant DEVs in ducks To investigate the antibody response induced by the recombinant viruses, groups of 24 ducks were inoculated with 106 TCID50 of rDEV-PrM/TE or rDEV-TE or with DEV as a control. Second doses of the vaccines were delivered at three weeks after the first inoculation. Anti-DTMUV antibodies were detected from all ducks immunized with rDEV-PrM/TE or rDEV-TE as early as two weeks post-inoculation and showed an obvious ascent after the boost vaccination (Fig. 3). The rise in neutralizing antibody titers in ducks inoculated with rDEV-PrM/TE was faster than that with rDEV-TE; the titers increased by about 8-fold (from 16 to 128) after the boost. The peak titer induced by rDEV-PrM/TE was higher than that induced by rDEV-TE (128 vs. 64). The neutralizing antibodies against DTMUV were detectable at 15 weeks after the boost vaccination (the end of the observation period) in ducks inoculated with either virus. These results demonstrate that the recombinant DEVs induced specific anti-DTMUV neutralizing antibodies in ducks and that the second dose of the virus inoculum promoted an antibody response.
5274
P. Chen et al. / Vaccine 32 (2014) 5271–5277
Fig. 2. Detection of E expression by recombinant DEVs in infected CEFs. CEFs were infected with the recombinant viruses rDEV-PrM/TE or rDEV-TE, or with the parent DEV virus at an MOI of 1 and cultured for two days. Cell lysates (A) or cell culture supernatants (B) were subjected to 10% SDS-PAGE. Separated proteins were transferred to nitrocellulose membranes and incubated with the appropriate antibodies. (C) Cells were fixed and plaques were observed under a light microscope or incubated with rabbit anti-E serum and stained with FITC-conjugated goat anti-rabbit IgG and observed under a fluorescent microscope. CEFs infected with DTMUV, DEV, or mock-infected CEF, were used as controls.
3.3. Vaccine efficacy against DTMUV challenge in ducks
Fig. 3. Induction of anti-DTMUV neutralizing antibodies by recombinant DEVs in ducks. Groups of 24 ducks were inoculated with one or two doses of 106 TCID50 of rDEV-PrM/TE, rDEV-TE, or DEV with a 3-week interval. Sera were collected at the indicated time points and pooled for detection of NT antibodies against DTMUV in BHK21 cells. Each sample was independently tested twice. The dashed line shows the detection limit for a positive response.
To test the effectiveness of the recombinant DEVs as protective vaccines, we performed viral challenge experiments. Three groups of 24 2-week-old SPF ducks were immunized with 106 TCID50 of rDEV-PrM/TE, rDEV-TE, or DEV, respectively. Three weeks later, eight ducks were randomly chosen from each group and challenged by intramuscular injection with a 100-fold DID50 of the duck tembusu virus. The recombinant virus-vaccinated animals had mild clinical signs post-challenge (p.c.), including mild anorexia, but recovered quickly. In contrast, the DEV-vaccinated animals exhibited severe clinical signs including a high degree of anorexia, lethargy, and diarrhea. Viremia was detected in two ducks on day 1 p.c. and in all of the ducks on days 2, 3, and 4 p.c. in the DEVvaccinated group, whereas it was only detected in some of the ducks that received the recombinant virus vaccines (Fig. 4A). DTMUV shedding was detected from the oropharyngeal swabs of seven, four, and one duck(s), and from the cloacal swabs of seven, six, and two ducks in the DEV-, rDEV-TE-, and rDEV-PrM/TE-vaccinated
Fig. 4. Viremia, virus replication in organs, and virus shedding of ducks after challenge with duck tembusu virus. Groups of eight ducks were intramuscularly challenged with 100-fold DID50 of the duck tembusu virus at 3 weeks post-vaccination. Viremia was tested independently for each duck from day 1 to day 5 post-challenge (A). Oropharyngeal and cloacal swabs were collected from ducks for virus titrations on day 5 after each challenge (B). Seven days after challenge, three ducks were euthanized and their organs were harvested for virus titration in primary duck embryo fibroblasts (C). *p < 0.01 when the value of rDEV-PrM/TE vaccinated group was compared with the corresponding value for the DEV-inoculated group. **p < 0.01 when the value of rDEV-TE vaccinated group was compared with the corresponding value for the DEV-inoculated group. The dashed lines show the limits of detection. Error bars represent the standard deviation.
P. Chen et al. / Vaccine 32 (2014) 5271–5277
5275
Fig. 5. Viremia, virus replication in organs, and virus shedding of ducks after challenge with duck tembusu virus. Groups of eight ducks were intramuscularly challenged with 100-fold DID50 of the duck tembusu virus at 3 weeks (A–C), 15 weeks (D–F), post boost vaccination. Viremia was tested independently for each duck from day 1 to day 5 post-challenge (A and D). Oropharyngeal and cloacal swabs were collected from ducks for virus titrations on day 5 after each challenge (B and E). Seven days after challenge, three ducks were euthanized and their organs were harvested for virus titration in primary duck embryo fibroblasts (C and F). *p < 0.01 when the value of rDEV-PrM/TE vaccinated group was compared with the corresponding value for the DEV-inoculated group. **p < 0.01 when the value of rDEV-TE vaccinated group was compared with the corresponding value for the DEV-inoculated group. The dashed lines show the limits of detection. Error bars represent the standard deviation.
groups, respectively (Fig. 4B). DTMUV replication was detected in the spleens and kidneys of all three ducks in the DEV-vaccinated group, and in the spleens of two ducks in the rDEV-TE-vaccinated group; however, it was not detected in any organ of any of the ducks in the rDEV-PrM/TE-vaccinated group (Fig. 4C). These results indicated that a single inoculation with the recombinant DEVs did not completely inhibit DTMUV replication in the ducks; therefore we asked whether a second dose would improve
the protective efficacy of the recombinant DEVs against DTMUV challenge in ducks. The challenge study was performed at three weeks post-boost and fifteen weeks post-boost (the time that ducks start to lay eggs). In the rDEV-TE-vaccinated group, DTMUV viremia was detected in two ducks and DTMUV shedding was detected from the oropharyngeal swabs of one duck and from the cloacal swabs of two ducks, but virus replication was not detected in any organ when the
Fig. 6. Histopathologic study of duck ovary. Groups of eight ducks were intramuscularly challenged with 100-fold DID50 of the DTMUV at 15 weeks after the second dose of recombinant DEV virus vaccine. Seven days after challenge, three ducks were euthanized and their ovaries were collected for histopathologic examination. (A) Normal ducks; (B) rDEV-PrM/TE-vaccinated ducks; (C) rDEV-TE-vaccinated ducks; and (D) DEV-vaccinated ducks.
5276
P. Chen et al. / Vaccine 32 (2014) 5271–5277
challenge was performed at three weeks post-boost (Fig. 5A–C). When the challenge was performed at fifteen weeks post-boost, viremia was detected in three ducks on day 3 p.c., but DTMUV shedding and replication were not detected from any ducks (Fig. 5D–F). Viremia, virus shedding, and replication were not detected in any ducks at either challenge time point in the rDEV-PrM/TE-vaccinated group, but were detected in all of the ducks in the DEV-vaccinated group (Fig. 5A–F). These results indicate that two doses of the recombinant virus rDEV-PrM/TE vaccine could provide completely protection against DTMUV challenge in ducks, but that two doses of rDEV-TE only provided partial protection in ducks against DTMUV challenge. Since DTMUV mainly affects adult female ducks by destroying their reproductive organs (mainly the ovaries) and causing severe egg drop [1], we performed a histologic study of the ovaries of ducks that were challenged with DTMUV at fifteen weeks post the two doses of the recombinant DEV virus vaccines. Like the ovaries of normal ducks (Fig. 6A), the ovaries of the ducks in the two recombinant DEV virus-vaccinated groups showed no histologic lesions (Fig. 6B and C); however, the ovaries of the DEV-vaccinated ducks exhibited severe hemorrhage, follicle atresia, and rupture with lymphocyte infiltration (Fig. 6D). These results indicate that two vaccine doses of the recombinant DEVs could prevent the damage caused by DTMUV in the ovaries of ducks, therefore preventing egg drop in vaccinated ducks.
4. Discussion In this study, recombinant DEVs were constructed by inserting the TE gene, with or without the PrM gene, into the nonessential regions between us7 and us8 of the DEV genome. Both constructs, rDEV-PrM/TE and rDEV-TE, expressed high levels of the secreted form of the DTMUV E antigen into the cell culture and induced measurable humoral immune responses in ducks. Challenge studies revealed that rDEV-PrM/TE and rDEV-TE could provide protection against DTMUV, and rDEV-PrM/TE was more effective than rDEVTE. These results demonstrate that the DEV vector-based vaccine is protective and can serve as a potential candidate vaccine to prevent DTMUV infection in ducks. Flavivirus envelope glycoprotein is the major protective antigen targeted by neutralizing antibodies. Although several studies have demonstrated that the C-terminally truncated, anchor-free form of the E protein (in the absence of PrM) can be used to protect animals against West Nile virus [18,24,25], studies on Japanese encephalitis virus and tick-borne encephalitis virus indicate that PrM also plays an essential role in the development of protective immunity [14,15,17,26]. Expression of E with PrM leading to the formation of virus like particles (VLPs), which simulate native virus infection, is the best mechanism for antigen presentation; without PrM, only partial protection is conferred [13,27,28]. Our results indicate that PrM is important in the development of sterile immunity, because rDEV-PrM/TE completely inhibit DTMUV replication in ducks, whereas rDEV-TE only conferred partial protection when vaccinated ducks were challenged at three weeks after the boost vaccination. The difference was minimal when the ducks were challenged at fifteen week after the boost vaccination. In this study, we did not test if the truncated E protein could form VLPs when co-expressed with the PrM protein, and we do not know the mechanisms that contributed to the better protective efficacy of the recombinant DEV expressing both the PrM and E proteins. Perhaps the rapid production of neutralizing antibodies in rDEV-PrM/TEvaccinated ducks contributes to this complete protection, but other factors, such as cellular immunity, may also play an important role. The proper expression and secretion of E glycoprotein requires a signal sequence. Expression of E without the signal sequence would
lead to the accumulation of E in the endoplasmic reticulum and decrease expression levels [29,30]. A previous study of the WNV DNA vaccine reported that fusion of the TPA leader sequence to the ectodomain of WNV E leads to a significant increase in expression levels compared with the wild-type version and to the generation of protective immune responses. In contrast, the plasmid without the TPA sequence did not induce measurable anti-WNV IgG or neutralizing activity, although a minor cellular immune response was observed [18]. In our preliminary experiments, when we constructed two recombinants that did not include any fused signal sequences and expressed full-length DTMUV E with or without PrM, the expression level was weak in vitro and did not induce measurable anti-DTMUV neutralizing activity (data not show). These results suggest that the secretion signal may be necessary to achieve high level expression of the DTMUV E antigen. DTMUV is a member of the genus Flavivirus. This genus includes many vertebrate pathogens, such as Japanese encephalitis virus and West Nile virus, which are important both for public health and animal production. Most of these viruses are transmitted by mosquitoes (mainly Culex spp.) and use birds as their amplifying hosts [31]. Virus isolation from mosquitoes indicates that flavivirus are very active, and some of these viruses, which previously were identified as non or low pathogenic to vertebrates, are now becoming major pathogens [32]. Therefore, to protect both public health and the duck industry, vaccine development to guard against DTMUV is necessary. Given that our recombinant DEV vaccine could be easily adapted to replace the regular DEV live vaccine in routine vaccination programs in ducks, it has great potential as a preventive measure against DTMUV infection.
Acknowledgments We thank Susan Watson for editing the manuscript. This work was supported by the Major Animal Disease Control Program of Ministry of Agriculture of China (Project number 2012ZX).
References [1] Su J, Li S, Hu X, Yu X, Wang Y, Liu P, et al. Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus. PLoS ONE 2011;6:e18106. [2] Yan P, Zhao Y, Zhang X, Xu D, Dai X, Teng Q, et al. An infectious disease of ducks caused by a newly emerged Tembusu virus strain in mainland China. Virology 2011;417:1–8. [3] Wan C, Huang Y, Fu G, Shi S, Cheng L, Chen H. Complete genome sequence of avian Tembusu-related virus strain WR isolated from White Kaiya ducks in Fujian, China. J Virol 2012;86:10912. [4] Wang Y, Yuan X, Li Y, Yu K, Yang J, Xu H, et al. Rapid detection of newly isolated Tembusu-related Flavivirus by reverse-transcription loop-mediated isothermal amplification assay. Virol J 2011;8:553. [5] Yun T, Ye W, Ni Z, Zhang D, Zhang C. Identification and molecular characterization of a novel flavivirus isolated from Pekin ducklings in China. Vet Microbiol 2012;157:311–9. [6] Yun T, Zhang D, Ma X, Cao Z, Chen L, Ni Z, et al. Complete genome sequence of a novel flavivirus, duck tembusu virus, isolated from ducks and geese in China. J Virol 2012;86:3406–7. [7] Liu P, Lu H, Li S, Wu Y, Gao GF, Su J. Duck egg drop syndrome virus: an emerging Tembusu-related flavivirus in China. Sci China Life Sci 2013;56:701–10. [8] Liu M, Liu C, Li G, Li X, Yin X, Chen Y, et al. Complete genomic sequence of duck flavivirus from china. J Virol 2012;86:3398–9. [9] Liu P, Lu H, Li S, Moureau G, Deng YQ, Wang Y, et al. Genomic and antigenic characterization of the newly emerging Chinese duck egg-drop syndrome flavivirus: genomic comparison with Tembusu and Sitiawan viruses. J Gen Virol 2012;93:2158–70. [10] Vazquez S, Guzman MG, Guillen G, Chinea G, Perez AB, Pupo M, et al. Immune response to synthetic peptides of dengue prM protein. Vaccine 2002;20:1823–30. [11] Beasley DW, Barrett AD. Identification of neutralizing epitopes within structural domain III of the West Nile virus envelope protein. J Virol 2002;76:13097–100. [12] Roehrig JT. Antigenic structure of flavivirus proteins. Adv Virus Res 2003;59:141–75. [13] Davis BS, Chang GJ, Cropp B, Roehrig JT, Martin DA, Mitchell CJ, et al. West Nile virus recombinant DNA vaccine protects mouse and horse from virus challenge
P. Chen et al. / Vaccine 32 (2014) 5271–5277
[14]
[15]
[16]
[17]
[18]
[19]
[20] [21]
[22] [23]
and expresses in vitro a noninfectious recombinant antigen that can be used in enzyme-linked immunosorbent assays. J Virol 2001;75:4040–7. Aberle JH, Aberle SW, Allison SL, Stiasny K, Ecker M, Mandl CW, et al. A DNA immunization model study with constructs expressing the tick-borne encephalitis virus envelope protein E in different physical forms. J Immunol 1999;163:6756–61. Konishi E, Pincus S, Paoletti E, Shope RE, Burrage T, Mason PW. Mice immunized with a subviral particle containing the Japanese encephalitis virus prM/M and E proteins are protected from lethal JEV infection. Virology 1992;188:714–20. Konishi E, Ajiro N, Nukuzuma C, Mason PW, Kurane I. Comparison of protective efficacies of plasmid DNAs encoding Japanese encephalitis virus proteins that induce neutralizing antibody or cytotoxic T lymphocytes in mice. Vaccine 2003;21:3675–83. Allison SL, Stadler K, Mandl CW, Kunz C, Heinz FX. Synthesis and secretion of recombinant tick-borne encephalitis virus protein E in soluble and particulate form. J Virol 1995;69:5816–20. Schneeweiss A, Chabierski S, Salomo M, Delaroque N, Al-Robaiy S, Grunwald T, et al. A DNA vaccine encoding the E protein of West Nile Virus is protective and can be boosted by recombinant domain DIII. Vaccine 2011;29:6352–7. Khanam S, Pilankatta R, Khanna N, Swaminathan S. An adenovirus type 5 (AdV5) vector encoding an envelope domain III-based tetravalent antigen elicits immune responses against all four dengue viruses in the presence of prior AdV5 immunity. Vaccine 2009;27:6011–21. Lin WQ, Lam KM, Clark WE. Active and passive immunization of ducks against duck viral enteritis. Avian Dis 1984;28:968–73. Liu J, Chen P, Jiang Y, Wu L, Zeng X, Tian G, et al. A duck enteritis virus-vectored bivalent live vaccine provides fast and complete protection against H5N1 avian influenza virus infection in ducks. J Virol 2011;85:10989–98. Morgan RW, Cantello JL, McDermott CH. Transfection of chicken embryo fibroblasts with Marek’s disease virus DNA. Avian Dis 1990;34:345–51. Ge J, Deng G, Wen Z, Tian G, Wang Y, Shi J, et al. Newcastle disease virus-based live attenuated vaccine completely protects chickens and mice from lethal challenge of homologous and heterologous H5N1 avian influenza viruses. J Virol 2007;81:150–8.
5277
[24] Despres P, Combredet C, Frenkiel MP, Lorin C, Brahic M, Tangy F. Live measles vaccine expressing the secreted form of the West Nile virus envelope glycoprotein protects against West Nile virus encephalitis. J Infect Dis 2005;191: 207–14. [25] Iyer AV, Pahar B, Boudreaux MJ, Wakamatsu N, Roy AF, Chouljenko VN, et al. Recombinant vesicular stomatitis virus-based west Nile vaccine elicits strong humoral and cellular immune responses and protects mice against lethal challenge with the virulent west Nile virus strain LSU-AR01. Vaccine 2009;27:893–903. [26] Yoshii K, Igarashi M, Ichii O, Yokozawa K, Ito K, Kariwa H, et al. A conserved region in the prM protein is a critical determinant in the assembly of flavivirus particles. J Gen Virol 2012;93:27–38. [27] Rosas CT, Tischer BK, Perkins GA, Wagner B, Goodman LB, Osterrieder N. Live-attenuated recombinant equine herpesvirus type 1 (EHV-1) induces a neutralizing antibody response against West Nile virus (WNV). Virus Res 2007;125:69–78. [28] Zhang S, Liang M, Gu W, Li C, Miao F, Wang X, et al. Vaccination with dengue virus-like particles induces humoral and cellular immune responses in mice. Virol J 2011;8:333. [29] Ashok MS, Rangarajan PN. Protective efficacy of a plasmid DNA encoding Japanese encephalitis virus envelope protein fused to tissue plasminogen activator signal sequences: studies in a murine intracerebral virus challenge model. Vaccine 2002;20:1563–70. [30] Appaiahgari MB, Saini M, Rauthan M, Jyoti Vrati S. Immunization with recombinant adenovirus synthesizing the secretory form of Japanese encephalitis virus envelope protein protects adenovirus-exposed mice against lethal encephalitis. Microbes Infect 2006;8:92–104. [31] Peterson AT, Vieglais DA, Andreasen JK. Migratory birds modeled as critical transport agents for West Nile Virus in North America. Vector Borne Zoonotic Dis 2003;3:27–37. [32] Sang RC, Gichogo A, Gachoya J, Dunster MD, Ofula V, Hunt AR, et al. Isolation of a new flavivirus related to cell fusing agent virus (CFAV) from field-collected flood-water Aedes mosquitoes sampled from a dambo in central Kenya. Arch Virol 2003;148:1085–93.
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
The vaccine efficacy of recombinant duck enteritis virus expressing secreted E with or without PrM proteins of duck tembusu virus Pucheng Chen 1 , Jinxiong Liu 1 , Yongping Jiang ∗ , Yuhui Zhao, Qimeng Li, Li Wu, Xijun He, Hualan Chen ∗ State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 19 May 2014 Received in revised form 10 July 2014 Accepted 22 July 2014 Available online 1 August 2014 Keywords: Recombinant DEVs Duck tembusu virus Vector vaccine
a b s t r a c t A newly emerged tembusu virus that causes egg-drop has been affecting ducks in China since 2010. Currently, no vaccine is available for this disease. A live attenuated duck enteritis virus (DEV; a herpesvirus) vaccine has been used routinely to control lethal DEV in ducks since the 1960s. Here, we constructed two recombinant DEVs by transfecting overlapping fosmid DNAs. One virus, rDEV-TE, expresses the truncated form of the envelope glycoprotein (TE) of duck tembusu virus (DTMUV), and the other virus, rDEV-PrM/TE, expresses both the TE and pre-membrane proteins (PrM). Animal study demonstrated that both recombinant viruses induced measurable anti-DTMUV neutralizing antibodies in ducks. After two doses of recombinant virus, rDEV-PrM/TE completely protected ducks from DTMUV challenge, whereas rDEV-TE only conferred partial protection. These results demonstrate that recombinant DEV expressing the TE and pre-membrane proteins is protective and can serve as a potential candidate vaccine to prevent DTMUV infection in ducks. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction In 2010, a newly emerged tembusu virus (a flavivirus) related duck disease characterized by egg-drop suddenly struck south eastern China and quickly spread around the major duck-producing regions of the country, causing serious economic losses [1]. The infected ducks show a heavy drop in egg production accompanied by anorexia, antisocial behavior, diarrhea, and paralysis. The morbidity rates are usually high (up to 90%), while mortality rates vary from 0% to 30% [2]. The viruses were frequently isolated from duck farms after the initial outbreak and have since become a major pathogen of ducks in China [3–7]. Duck tembusu virus (DTMUV) is a single-strand positive RNA virus. Its genome has 10,986 nucleotides and the typical flavivirus genome organization, which consists of three structural proteins, named capsid (C), pre-membrane (PrM), envelope glycoprotein (E), as well as seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) [8,9]. The E protein embeds in the
∗ Corresponding authors at: 427 Maduan Street, Harbin 150001, People’s Republic of China. Tel.: +86 451 51997168; fax: +86 451 82733132. E-mail addresses: [email protected] (Y. Jiang), [email protected] (H. Chen). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.vaccine.2014.07.082 0264-410X/© 2014 Elsevier Ltd. All rights reserved.
virus surface and has important functions in several aspects of the viral life cycle. The PrM protein stabilizes the conformation of E and protects it from degradation [10,11]. The E protein is the major target for neutralizing antibodies, which play a critical role in the clearance of flavivirus inflection [12]. Vaccine studies on Japanese encephalitis virus, West Nile virus, and tick-borne encephalitis virus have shown that a DNA plasmid expressing both PrM and E is more effective than E expression alone [13–16]. The co-expression of PrM/E leads to the formation of virus-like particles (VLPs); these structures are the optimal way to present antigens to the immune system [17]. However, other studies on West Nile virus and dengue virus have shown that co-expression of prM and the formation of VLPs are not prerequisites for the induction of an efficient immune response upon DNA vaccination [18,19]. Therefore, it remains unclear whether the PrM protein is essential to induce immunity against DTMUV. Duck viral enteritis, also called duck plague, is an acute contagious disease among Anseriformes (ducks, geese, and swans) that is caused by the herpesvirus duck enteritis virus (DEV). DEV infection can cause 100% mortality in ducks. A live attenuated DEV vaccine has been developed and used to control duck viral enteritis since the 1960s, and billions of doses of DEV live vaccines are used in China every year [20]. We previously established a system for generating rDEV by transfecting overlapping fosmid DNAs and generated recombinant DEV expressing the hemagglutinin (HA)
5272
P. Chen et al. / Vaccine 32 (2014) 5271–5277
Fig. 1. Insertion of foreign genes into the DEV genome. (A) Genomic structure of DEV and the five fosmid DNAs used for DEV regeneration. Numbers show the location of each fosmid fragment in the DEV genome. (B) Construction of the fosmid with TE inserted within the us7 and us8 genes. (C) Construction of the fosmid with PrM/TE inserted between the us7 and us8 genes.
gene of an H5N1 influenza virus [21]. We demonstrated that the recombinant vaccine provided solid protection against both H5N1 avian influenza and DEV in ducks [21]. In this study, we generated two recombinant DEVs, rDEV-TE and rDEV-PrM/TE, to express the truncated form of the envelope glycoprotein of DTMUV alone or with the PrM protein, and evaluated their protective efficacy against DTMUV challenge in ducks.
and 1% antibiotics. Baby hamster kidney cells (BHK-21) were grown by using Dulbecco’s modified minimal essential media (DMEM) supplemented with 10% FBS and appropriate amounts of antibiotics (Gibco).
2. Materials and methods
We previously established a system to regenerate DEV by transfecting overlapping fosmid DNAs (Fig. 1A) and proved that the insertion of a foreign gene between the us7 and us8 genes of DEV was stable and did not affect the replication and immunogenicity of DEV [21]. In this study, we therefore inserted the foreign genes of interest between the us7 and us8 genes of DEV. First, we constructed a C-terminal truncated E protein (TE) gene expression cassette and a PrM plus TE (PrM/TE) gene expression cassette. In these cassettes, the targeted genes were in-frame fused to a secretory signal sequence derived from chicken tissue plasminogen activator (tPAS) by PCR using two pairs of primers: TPAME-sense (TTAACGCGTACCatgtggaaaacactcagaatgaaaggcaagctcctgagtctcctcc tgctggtgggagtaatcaagactgcccaatgccagggcacacacGCCGCCACCATGCT GAAGCTTG) and TPA-antisense (CCGGCGGCCGCTTATTTTCCAATTGTGCT) (for the PrM/TE gene), or TPAE-sense (ATAACGC GTACCatgtggaaaacactcagaatgaaaggcaagctcctgagtctcctcctgctggtggg agtaatcaagactgcccaatgccagggcacacacTTCAGCTGTCTGGGGATGC) and TPA-antisense (CCGGCGGCCGCTTATTTTCCAATTGTGCT) (for the TE gene). The TPA sequences in these primers are underlined. The resulted PCR products, tPAS-TE and tPAS-PrM/TE, were then introduced into a Gateway entry vector (pEntrySV40), in which the expression of recombinant proteins was regulated by the SV40 promoter. The insertion of tPAS-TE and tPAS-PrM/TE into the fosmid T that contained the us7 and us8 genes was performed as
2.1. Ethics statements The animal experiment was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China. The protocol was approved by the Committee on the Ethics of Animal Experiments of the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (JQ-YA-2012). 2.2. Viruses and cells DEV vaccine strains were obtained from the China Veterinary Culture Collection and propagated in primary chicken embryo fibroblasts (CEFs). Duck tembusu virus (strain: PTD2010) was isolated from a duck in southern China, propagated in the allantoic cavities of 10-day-old specific pathogen-free (SPF) embryonated duck eggs, and kept in a 70 ◦ C freezer before RNA extraction or the challenge study. All recombinant duck enteritis virus was propagated in CEFs. CEFs and duck embryo fibroblasts (DEFs) were prepared from 10-day-old embryonated SPF eggs and maintained in M199 medium (Gibco) supplemented with 5% fetal bovine serum
2.3. Construction of recombinant fosmids bearing the TE protein alone or PrM/TE together
P. Chen et al. / Vaccine 32 (2014) 5271–5277
described previously [21], and the resultant fosmids were designated as T-us78 tPAS-TE and T-us78 tPAS-PrM/TE, respectively (Fig. 1B and C). 2.4. Generation and characterization of recombinant DEVs expressing DTMUV PrM/TE or TE Five fosmid combinations, with or without foreign insertions that covered the entire DEV genome, were used for virus rescue. Viral DNA inserts were released from purified fosmids by digestion with SbfI or FseI enzymes and purified by phenol-chloroform extraction and ethanol precipitation. Five micrograms of DNA was used to transfect primary CEFs in 60-mm dishes by using the calcium phosphate procedure described by Morgan et al. [22]. Cells were observed for cytopathic effects (CPE) for 7 days after transfection, and CPE-positive samples were harvested for further characterization. Recombinant viruses were identified by use of PCR and the insertion of the target genes was confirmed by sequence analysis. 2.5. Confirmation of the expression of the TE and PrM genes in cells infected with the recombinant DEVs Gene expression in the recombinant DEVs was confirmed by using Western blotting and immunofluorescence. Western blotting was performed as described previously [23]. Rabbit polyclonal antiserum against the PrM and E proteins of DTMUV, and a mouse monoclonal anti--actin antibody (Sigma) were used as primary antibodies; IRDye 700DXconjugated goat anti-rabbit IgGs (for PrM and E detection), and donkey anti-mouse IgGs (for actin detection) (Rockland) were used as secondary antibodies. For immunofluorescence studies, CEFs in 60-mm dishes were infected with the rescued virus at a multiplicity of infection (MOI) of 1. Specific rabbit polyclonal antiserum against the E of DTMUV served as the primary antibody source; the secondary antibodies were fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Millipore). 2.6. Vaccine efficacy in ducks Groups of 24 2-week-old SPF ducks were immunized by subcutaneous injection with 106 TCID50 of recombinant DEV viruses or with the parent DEV as a control. Three weeks after inoculation, eight birds from each group were randomly chosen and challenged with a 100-fold DID50 of the DTMUV by intramuscular injection. The remaining sixteen ducks in each group received a second dose of the inoculum. Eight ducks from each group were then challenged at three weeks post-boost and the remaining eight ducks in each group were challenged at 15 weeks post-boost. After each challenge, ducks were checked daily for clinical signs and viremia. Oropharyngeal and cloacal swabs were collected from ducks on day 5 post-challenge for virus titration. Three ducks in each group were euthanized on 7 days post-challenge and their organs were collected for pathologic studies and virus titration in primary DEFs. 2.7. Neutralization assay Sera from immunized ducks were pooled, heat inactivated (30 min at 56 ◦ C) and serially diluted (1:2) in 96-well plates with culture medium. Then, 20 TCID50 of DTMUV was added to each dilution (in triplicates) and the mixtures were incubated for 1 h at 37 ◦ C. BHK-21cells were seeded into 96-well plates immediately after the incubation and propagated for an additional 6 days. Titers of neutralizing antibodies were determined by monitoring the CPE. Each sample was independently tested twice. Neutralizing activity was recorded until two out of three wells of infected cells showed no CPE.
5273
2.8. Detection of viremia Ducks were bled by using a sterile needle and syringe daily for five days. The 0.5-mL blood samples were immediately mixed with 0.5 mL of medium (M199 with 2% fetal bovine serum and penicillinstreptomycin) in a labeled polystyrene centrifuge tube, allowed to sit in the shade at 4 ◦ C for 1 h, and then centrifuged for 10 min (at approximately 500 × g) to separate the serum and medium mixture from the red blood cells. Serially diluted (1:10) serum and medium mixture were added to freshly seeded DEFs and cultured for 4 days. Titers were determined according to the method of Reed and Muench by monitoring the CPE. 2.9. Statistical analysis Viral titers of ducks were compared by use of multiple t-test (GraphPad Prizm). Results are expressed as mean ± standard deviation. 3. Results 3.1. Generation and characterization of recombinant DEVs expressing the TE and PrM/TE genes of DTMUV Previously, we established a system for generating DEV by transfecting overlapping fosmid DNAs and generated recombinant DEVs expressing the HA gene of H5N1 avian influenza viruses [21]. By using the similar strategy, here we generated two recombinant DEV viruses to express the TE gene of DTMUV alone or both the TE and PrM genes of DTMUV. We designated the two viruses as rDEV-TE and rDEV-PrM/TE, respectively. TE protein expression was detected by using Western blotting analysis of cell lysates and supernatants prepared from CEFs infected with rDEV-PrM/TE or rDEV-TE and from DTMUV-infected DEFs (Fig. 2A and B). PrM was detected in the lysates of CEFs infected with rDEV-PrM/TE and DTMUV (Fig. 2A), but was not detected in the supernatant (data not shown). The expression of TE in the CEFs infected with rDEV-TE and rDEV-PrM/TE was further confirmed by immunologically staining with antiserum derived from a rabbit immunized with the recombinant E protein of DTMUV (Fig. 2C). These results confirm that both TE and PrM can be expressed in cells infected with recombinant DEVs. 3.2. Anti-DTMUV neutralizing antibody induced by recombinant DEVs in ducks To investigate the antibody response induced by the recombinant viruses, groups of 24 ducks were inoculated with 106 TCID50 of rDEV-PrM/TE or rDEV-TE or with DEV as a control. Second doses of the vaccines were delivered at three weeks after the first inoculation. Anti-DTMUV antibodies were detected from all ducks immunized with rDEV-PrM/TE or rDEV-TE as early as two weeks post-inoculation and showed an obvious ascent after the boost vaccination (Fig. 3). The rise in neutralizing antibody titers in ducks inoculated with rDEV-PrM/TE was faster than that with rDEV-TE; the titers increased by about 8-fold (from 16 to 128) after the boost. The peak titer induced by rDEV-PrM/TE was higher than that induced by rDEV-TE (128 vs. 64). The neutralizing antibodies against DTMUV were detectable at 15 weeks after the boost vaccination (the end of the observation period) in ducks inoculated with either virus. These results demonstrate that the recombinant DEVs induced specific anti-DTMUV neutralizing antibodies in ducks and that the second dose of the virus inoculum promoted an antibody response.
5274
P. Chen et al. / Vaccine 32 (2014) 5271–5277
Fig. 2. Detection of E expression by recombinant DEVs in infected CEFs. CEFs were infected with the recombinant viruses rDEV-PrM/TE or rDEV-TE, or with the parent DEV virus at an MOI of 1 and cultured for two days. Cell lysates (A) or cell culture supernatants (B) were subjected to 10% SDS-PAGE. Separated proteins were transferred to nitrocellulose membranes and incubated with the appropriate antibodies. (C) Cells were fixed and plaques were observed under a light microscope or incubated with rabbit anti-E serum and stained with FITC-conjugated goat anti-rabbit IgG and observed under a fluorescent microscope. CEFs infected with DTMUV, DEV, or mock-infected CEF, were used as controls.
3.3. Vaccine efficacy against DTMUV challenge in ducks
Fig. 3. Induction of anti-DTMUV neutralizing antibodies by recombinant DEVs in ducks. Groups of 24 ducks were inoculated with one or two doses of 106 TCID50 of rDEV-PrM/TE, rDEV-TE, or DEV with a 3-week interval. Sera were collected at the indicated time points and pooled for detection of NT antibodies against DTMUV in BHK21 cells. Each sample was independently tested twice. The dashed line shows the detection limit for a positive response.
To test the effectiveness of the recombinant DEVs as protective vaccines, we performed viral challenge experiments. Three groups of 24 2-week-old SPF ducks were immunized with 106 TCID50 of rDEV-PrM/TE, rDEV-TE, or DEV, respectively. Three weeks later, eight ducks were randomly chosen from each group and challenged by intramuscular injection with a 100-fold DID50 of the duck tembusu virus. The recombinant virus-vaccinated animals had mild clinical signs post-challenge (p.c.), including mild anorexia, but recovered quickly. In contrast, the DEV-vaccinated animals exhibited severe clinical signs including a high degree of anorexia, lethargy, and diarrhea. Viremia was detected in two ducks on day 1 p.c. and in all of the ducks on days 2, 3, and 4 p.c. in the DEVvaccinated group, whereas it was only detected in some of the ducks that received the recombinant virus vaccines (Fig. 4A). DTMUV shedding was detected from the oropharyngeal swabs of seven, four, and one duck(s), and from the cloacal swabs of seven, six, and two ducks in the DEV-, rDEV-TE-, and rDEV-PrM/TE-vaccinated
Fig. 4. Viremia, virus replication in organs, and virus shedding of ducks after challenge with duck tembusu virus. Groups of eight ducks were intramuscularly challenged with 100-fold DID50 of the duck tembusu virus at 3 weeks post-vaccination. Viremia was tested independently for each duck from day 1 to day 5 post-challenge (A). Oropharyngeal and cloacal swabs were collected from ducks for virus titrations on day 5 after each challenge (B). Seven days after challenge, three ducks were euthanized and their organs were harvested for virus titration in primary duck embryo fibroblasts (C). *p < 0.01 when the value of rDEV-PrM/TE vaccinated group was compared with the corresponding value for the DEV-inoculated group. **p < 0.01 when the value of rDEV-TE vaccinated group was compared with the corresponding value for the DEV-inoculated group. The dashed lines show the limits of detection. Error bars represent the standard deviation.
P. Chen et al. / Vaccine 32 (2014) 5271–5277
5275
Fig. 5. Viremia, virus replication in organs, and virus shedding of ducks after challenge with duck tembusu virus. Groups of eight ducks were intramuscularly challenged with 100-fold DID50 of the duck tembusu virus at 3 weeks (A–C), 15 weeks (D–F), post boost vaccination. Viremia was tested independently for each duck from day 1 to day 5 post-challenge (A and D). Oropharyngeal and cloacal swabs were collected from ducks for virus titrations on day 5 after each challenge (B and E). Seven days after challenge, three ducks were euthanized and their organs were harvested for virus titration in primary duck embryo fibroblasts (C and F). *p < 0.01 when the value of rDEV-PrM/TE vaccinated group was compared with the corresponding value for the DEV-inoculated group. **p < 0.01 when the value of rDEV-TE vaccinated group was compared with the corresponding value for the DEV-inoculated group. The dashed lines show the limits of detection. Error bars represent the standard deviation.
groups, respectively (Fig. 4B). DTMUV replication was detected in the spleens and kidneys of all three ducks in the DEV-vaccinated group, and in the spleens of two ducks in the rDEV-TE-vaccinated group; however, it was not detected in any organ of any of the ducks in the rDEV-PrM/TE-vaccinated group (Fig. 4C). These results indicated that a single inoculation with the recombinant DEVs did not completely inhibit DTMUV replication in the ducks; therefore we asked whether a second dose would improve
the protective efficacy of the recombinant DEVs against DTMUV challenge in ducks. The challenge study was performed at three weeks post-boost and fifteen weeks post-boost (the time that ducks start to lay eggs). In the rDEV-TE-vaccinated group, DTMUV viremia was detected in two ducks and DTMUV shedding was detected from the oropharyngeal swabs of one duck and from the cloacal swabs of two ducks, but virus replication was not detected in any organ when the
Fig. 6. Histopathologic study of duck ovary. Groups of eight ducks were intramuscularly challenged with 100-fold DID50 of the DTMUV at 15 weeks after the second dose of recombinant DEV virus vaccine. Seven days after challenge, three ducks were euthanized and their ovaries were collected for histopathologic examination. (A) Normal ducks; (B) rDEV-PrM/TE-vaccinated ducks; (C) rDEV-TE-vaccinated ducks; and (D) DEV-vaccinated ducks.
5276
P. Chen et al. / Vaccine 32 (2014) 5271–5277
challenge was performed at three weeks post-boost (Fig. 5A–C). When the challenge was performed at fifteen weeks post-boost, viremia was detected in three ducks on day 3 p.c., but DTMUV shedding and replication were not detected from any ducks (Fig. 5D–F). Viremia, virus shedding, and replication were not detected in any ducks at either challenge time point in the rDEV-PrM/TE-vaccinated group, but were detected in all of the ducks in the DEV-vaccinated group (Fig. 5A–F). These results indicate that two doses of the recombinant virus rDEV-PrM/TE vaccine could provide completely protection against DTMUV challenge in ducks, but that two doses of rDEV-TE only provided partial protection in ducks against DTMUV challenge. Since DTMUV mainly affects adult female ducks by destroying their reproductive organs (mainly the ovaries) and causing severe egg drop [1], we performed a histologic study of the ovaries of ducks that were challenged with DTMUV at fifteen weeks post the two doses of the recombinant DEV virus vaccines. Like the ovaries of normal ducks (Fig. 6A), the ovaries of the ducks in the two recombinant DEV virus-vaccinated groups showed no histologic lesions (Fig. 6B and C); however, the ovaries of the DEV-vaccinated ducks exhibited severe hemorrhage, follicle atresia, and rupture with lymphocyte infiltration (Fig. 6D). These results indicate that two vaccine doses of the recombinant DEVs could prevent the damage caused by DTMUV in the ovaries of ducks, therefore preventing egg drop in vaccinated ducks.
4. Discussion In this study, recombinant DEVs were constructed by inserting the TE gene, with or without the PrM gene, into the nonessential regions between us7 and us8 of the DEV genome. Both constructs, rDEV-PrM/TE and rDEV-TE, expressed high levels of the secreted form of the DTMUV E antigen into the cell culture and induced measurable humoral immune responses in ducks. Challenge studies revealed that rDEV-PrM/TE and rDEV-TE could provide protection against DTMUV, and rDEV-PrM/TE was more effective than rDEVTE. These results demonstrate that the DEV vector-based vaccine is protective and can serve as a potential candidate vaccine to prevent DTMUV infection in ducks. Flavivirus envelope glycoprotein is the major protective antigen targeted by neutralizing antibodies. Although several studies have demonstrated that the C-terminally truncated, anchor-free form of the E protein (in the absence of PrM) can be used to protect animals against West Nile virus [18,24,25], studies on Japanese encephalitis virus and tick-borne encephalitis virus indicate that PrM also plays an essential role in the development of protective immunity [14,15,17,26]. Expression of E with PrM leading to the formation of virus like particles (VLPs), which simulate native virus infection, is the best mechanism for antigen presentation; without PrM, only partial protection is conferred [13,27,28]. Our results indicate that PrM is important in the development of sterile immunity, because rDEV-PrM/TE completely inhibit DTMUV replication in ducks, whereas rDEV-TE only conferred partial protection when vaccinated ducks were challenged at three weeks after the boost vaccination. The difference was minimal when the ducks were challenged at fifteen week after the boost vaccination. In this study, we did not test if the truncated E protein could form VLPs when co-expressed with the PrM protein, and we do not know the mechanisms that contributed to the better protective efficacy of the recombinant DEV expressing both the PrM and E proteins. Perhaps the rapid production of neutralizing antibodies in rDEV-PrM/TEvaccinated ducks contributes to this complete protection, but other factors, such as cellular immunity, may also play an important role. The proper expression and secretion of E glycoprotein requires a signal sequence. Expression of E without the signal sequence would
lead to the accumulation of E in the endoplasmic reticulum and decrease expression levels [29,30]. A previous study of the WNV DNA vaccine reported that fusion of the TPA leader sequence to the ectodomain of WNV E leads to a significant increase in expression levels compared with the wild-type version and to the generation of protective immune responses. In contrast, the plasmid without the TPA sequence did not induce measurable anti-WNV IgG or neutralizing activity, although a minor cellular immune response was observed [18]. In our preliminary experiments, when we constructed two recombinants that did not include any fused signal sequences and expressed full-length DTMUV E with or without PrM, the expression level was weak in vitro and did not induce measurable anti-DTMUV neutralizing activity (data not show). These results suggest that the secretion signal may be necessary to achieve high level expression of the DTMUV E antigen. DTMUV is a member of the genus Flavivirus. This genus includes many vertebrate pathogens, such as Japanese encephalitis virus and West Nile virus, which are important both for public health and animal production. Most of these viruses are transmitted by mosquitoes (mainly Culex spp.) and use birds as their amplifying hosts [31]. Virus isolation from mosquitoes indicates that flavivirus are very active, and some of these viruses, which previously were identified as non or low pathogenic to vertebrates, are now becoming major pathogens [32]. Therefore, to protect both public health and the duck industry, vaccine development to guard against DTMUV is necessary. Given that our recombinant DEV vaccine could be easily adapted to replace the regular DEV live vaccine in routine vaccination programs in ducks, it has great potential as a preventive measure against DTMUV infection.
Acknowledgments We thank Susan Watson for editing the manuscript. This work was supported by the Major Animal Disease Control Program of Ministry of Agriculture of China (Project number 2012ZX).
References [1] Su J, Li S, Hu X, Yu X, Wang Y, Liu P, et al. Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus. PLoS ONE 2011;6:e18106. [2] Yan P, Zhao Y, Zhang X, Xu D, Dai X, Teng Q, et al. An infectious disease of ducks caused by a newly emerged Tembusu virus strain in mainland China. Virology 2011;417:1–8. [3] Wan C, Huang Y, Fu G, Shi S, Cheng L, Chen H. Complete genome sequence of avian Tembusu-related virus strain WR isolated from White Kaiya ducks in Fujian, China. J Virol 2012;86:10912. [4] Wang Y, Yuan X, Li Y, Yu K, Yang J, Xu H, et al. Rapid detection of newly isolated Tembusu-related Flavivirus by reverse-transcription loop-mediated isothermal amplification assay. Virol J 2011;8:553. [5] Yun T, Ye W, Ni Z, Zhang D, Zhang C. Identification and molecular characterization of a novel flavivirus isolated from Pekin ducklings in China. Vet Microbiol 2012;157:311–9. [6] Yun T, Zhang D, Ma X, Cao Z, Chen L, Ni Z, et al. Complete genome sequence of a novel flavivirus, duck tembusu virus, isolated from ducks and geese in China. J Virol 2012;86:3406–7. [7] Liu P, Lu H, Li S, Wu Y, Gao GF, Su J. Duck egg drop syndrome virus: an emerging Tembusu-related flavivirus in China. Sci China Life Sci 2013;56:701–10. [8] Liu M, Liu C, Li G, Li X, Yin X, Chen Y, et al. Complete genomic sequence of duck flavivirus from china. J Virol 2012;86:3398–9. [9] Liu P, Lu H, Li S, Moureau G, Deng YQ, Wang Y, et al. Genomic and antigenic characterization of the newly emerging Chinese duck egg-drop syndrome flavivirus: genomic comparison with Tembusu and Sitiawan viruses. J Gen Virol 2012;93:2158–70. [10] Vazquez S, Guzman MG, Guillen G, Chinea G, Perez AB, Pupo M, et al. Immune response to synthetic peptides of dengue prM protein. Vaccine 2002;20:1823–30. [11] Beasley DW, Barrett AD. Identification of neutralizing epitopes within structural domain III of the West Nile virus envelope protein. J Virol 2002;76:13097–100. [12] Roehrig JT. Antigenic structure of flavivirus proteins. Adv Virus Res 2003;59:141–75. [13] Davis BS, Chang GJ, Cropp B, Roehrig JT, Martin DA, Mitchell CJ, et al. West Nile virus recombinant DNA vaccine protects mouse and horse from virus challenge
P. Chen et al. / Vaccine 32 (2014) 5271–5277
[14]
[15]
[16]
[17]
[18]
[19]
[20] [21]
[22] [23]
and expresses in vitro a noninfectious recombinant antigen that can be used in enzyme-linked immunosorbent assays. J Virol 2001;75:4040–7. Aberle JH, Aberle SW, Allison SL, Stiasny K, Ecker M, Mandl CW, et al. A DNA immunization model study with constructs expressing the tick-borne encephalitis virus envelope protein E in different physical forms. J Immunol 1999;163:6756–61. Konishi E, Pincus S, Paoletti E, Shope RE, Burrage T, Mason PW. Mice immunized with a subviral particle containing the Japanese encephalitis virus prM/M and E proteins are protected from lethal JEV infection. Virology 1992;188:714–20. Konishi E, Ajiro N, Nukuzuma C, Mason PW, Kurane I. Comparison of protective efficacies of plasmid DNAs encoding Japanese encephalitis virus proteins that induce neutralizing antibody or cytotoxic T lymphocytes in mice. Vaccine 2003;21:3675–83. Allison SL, Stadler K, Mandl CW, Kunz C, Heinz FX. Synthesis and secretion of recombinant tick-borne encephalitis virus protein E in soluble and particulate form. J Virol 1995;69:5816–20. Schneeweiss A, Chabierski S, Salomo M, Delaroque N, Al-Robaiy S, Grunwald T, et al. A DNA vaccine encoding the E protein of West Nile Virus is protective and can be boosted by recombinant domain DIII. Vaccine 2011;29:6352–7. Khanam S, Pilankatta R, Khanna N, Swaminathan S. An adenovirus type 5 (AdV5) vector encoding an envelope domain III-based tetravalent antigen elicits immune responses against all four dengue viruses in the presence of prior AdV5 immunity. Vaccine 2009;27:6011–21. Lin WQ, Lam KM, Clark WE. Active and passive immunization of ducks against duck viral enteritis. Avian Dis 1984;28:968–73. Liu J, Chen P, Jiang Y, Wu L, Zeng X, Tian G, et al. A duck enteritis virus-vectored bivalent live vaccine provides fast and complete protection against H5N1 avian influenza virus infection in ducks. J Virol 2011;85:10989–98. Morgan RW, Cantello JL, McDermott CH. Transfection of chicken embryo fibroblasts with Marek’s disease virus DNA. Avian Dis 1990;34:345–51. Ge J, Deng G, Wen Z, Tian G, Wang Y, Shi J, et al. Newcastle disease virus-based live attenuated vaccine completely protects chickens and mice from lethal challenge of homologous and heterologous H5N1 avian influenza viruses. J Virol 2007;81:150–8.
5277
[24] Despres P, Combredet C, Frenkiel MP, Lorin C, Brahic M, Tangy F. Live measles vaccine expressing the secreted form of the West Nile virus envelope glycoprotein protects against West Nile virus encephalitis. J Infect Dis 2005;191: 207–14. [25] Iyer AV, Pahar B, Boudreaux MJ, Wakamatsu N, Roy AF, Chouljenko VN, et al. Recombinant vesicular stomatitis virus-based west Nile vaccine elicits strong humoral and cellular immune responses and protects mice against lethal challenge with the virulent west Nile virus strain LSU-AR01. Vaccine 2009;27:893–903. [26] Yoshii K, Igarashi M, Ichii O, Yokozawa K, Ito K, Kariwa H, et al. A conserved region in the prM protein is a critical determinant in the assembly of flavivirus particles. J Gen Virol 2012;93:27–38. [27] Rosas CT, Tischer BK, Perkins GA, Wagner B, Goodman LB, Osterrieder N. Live-attenuated recombinant equine herpesvirus type 1 (EHV-1) induces a neutralizing antibody response against West Nile virus (WNV). Virus Res 2007;125:69–78. [28] Zhang S, Liang M, Gu W, Li C, Miao F, Wang X, et al. Vaccination with dengue virus-like particles induces humoral and cellular immune responses in mice. Virol J 2011;8:333. [29] Ashok MS, Rangarajan PN. Protective efficacy of a plasmid DNA encoding Japanese encephalitis virus envelope protein fused to tissue plasminogen activator signal sequences: studies in a murine intracerebral virus challenge model. Vaccine 2002;20:1563–70. [30] Appaiahgari MB, Saini M, Rauthan M, Jyoti Vrati S. Immunization with recombinant adenovirus synthesizing the secretory form of Japanese encephalitis virus envelope protein protects adenovirus-exposed mice against lethal encephalitis. Microbes Infect 2006;8:92–104. [31] Peterson AT, Vieglais DA, Andreasen JK. Migratory birds modeled as critical transport agents for West Nile Virus in North America. Vector Borne Zoonotic Dis 2003;3:27–37. [32] Sang RC, Gichogo A, Gachoya J, Dunster MD, Ofula V, Hunt AR, et al. Isolation of a new flavivirus related to cell fusing agent virus (CFAV) from field-collected flood-water Aedes mosquitoes sampled from a dambo in central Kenya. Arch Virol 2003;148:1085–93.