- Email: [email protected]
The X1 box of HLA-G promoter is a target site for RFX and Sp1 factors
The X1 Box of HLA-G Promoter is a Target Site for RFX and Sp1 Factors Philippe Rousseau, Pascale Paul, Margaret O’Brien, Jean Dausset, Edgardo D. Carosella, and Philippe Moreau ABSTRACT: HLA-G gene regulation was investigated with regards to homologies among the pathways regulating both classical MHC class I and MHC class II gene expression. They include four conserved cis-acting regulatory elements located in the proximal promoter region referred to as the W/S/Z box, the X box that is comprised of the X1 and X2 halves, and the Y box with an inverted CCAAT site. The X1 box is the binding site for the ubiquitous RFX complex consisting of three subunits; the X2 box is bound by the X2BP/ATF/CREB family factors. The basic S-X-Y regulatory module interacts with CIITA, which is expressed constitutively in APCs, but may be inducible in others cell types by IFN-␥. Within HLA-G gene promoter the only conserved motifs are S and X1 boxes. We thus investigated the binding capacity of the
ABBREVIATIONS CIITA class II transactivator ds double strand EMSA electrophoretic mobility shift assays
INTRODUCTION The nonclassical human leukocyte antigen-G (HLA-G) molecule inhibits natural killer (NK) cells either directly through interaction with killing inhibitory receptor (KIR) or indirectly through stabilization of the HLA-E molecule with a nonamer peptide derived from HLA-G signal sequence [1, 2]. HLA-G also impairs T-cell cytolysis and, thus, appears to have an extensive role in immune tolerance processes [3]. Further evidence of this role is suggested by the expression of the HLA-G molFrom the CEA, Service de Recherche en He´mato-Immunologie (P.R., P.P., M.O’B., E.D.C., P.M), DSV/DRM, Hoˆpital Saint-Louis, Institut d’He´matologie, Paris; and the Fondation Jean Dausset (J.D.), Paris, France. Address reprint requests to: Dr. Philippe Moreau, CEA-SRHI, Hoˆpital Saint-Louis, Institut d’He´matologie, 1 avenue Claude-Vellefaux, 75475 Paris Cedex 10, France; Tel: ⫹33 (0)1 53 72 21 40; Fax: ⫹33 (0) 1 48 03 19 60; E-Mail: [email protected]. Received August 1, 2000; accepted September 13, 2000. Human Immunology 61, 1132–1137 (2000) © American Society for Histocompatibility and Immunogenetics, 2000 Published by Elsevier Science Inc.
HLA-G X box in comparison to that of HLA-DRA and HLA-E. We demonstrate that X2 box mutations in HLA-G promoter affect the binding of ATF/CREB family factors and may privilege the X2 box to access by other shared factors. The X1 box is the target for RFX complex and an additional factor we identified as Sp1. We propose that the X region in the HLA-G gene promoter might participate to the combination of factors which play a role in HLA-G gene activation. Human Immunology 61, 1132–1137 (2000). © American Society for Histocompatibility and Immunogenetics, 2000. Published by Elsevier Science Inc. KEYWORDS: HLA-G; regulation; X box
ISRE NFB
interferon-stimulated response element nuclear factor B
ecule in different placental cell subpopulations such as extravillous cytotrophoblasts and amniotic cells [4 – 6] and may account for the pathologic expression in some melanoma tumors [7]. The HLA-G molecule is also detected in thymic medullary epithelial cells [8] and was demonstrated to be induced by IFN-␥ [9] and IL-10 [10] on blood monocytes. The highest levels of HLA-G transcripts are observed in tissues exhibiting constitutive HLA-G expression, while only low levels of HLA-G transcripts are detected in other tissues. The lack of HLA-G transcription has been reported in fetal liver from first trimester of gestation, NK and CD34⫹ cells [11–13], and thus argue for a tight transcriptional control of HLA-G expression. The molecular mechanisms that control HLA-G transcriptional regulation are poorly understood. Analysis of the HLA-G promoter in transgenic mice pointed out the 0198-8859/00/$–see front matter PII S0198-8859(00)00199-3
RFX, Sp1, and HLA-G Gene Promoter
importance of the region covering 0.25 kb at 1.2 kb from the gene in the tissue specific expression of HLA-G in vivo [14]. We showed in vitro the differential binding of nuclear factors from cells expressing or not HLA-G to this region and proposed that it could be a target for negative regulatory elements [11, 15]. Moreover, the alignment of the proximal region of the HLA-G and the classical HLA class I promoters reveal that cis-acting regulatory elements including enhancer A (NF-B/Rel family of DNA-binding protein), IFN-stimulated response element (ISRE) and site ␣ (ATF/CREB family of DNA-binding protein) are disrupted in the HLA-G promoter. In particular, investigation of both the binding properties of two putative B sites of enhancer A (B1, B2) and also their contribution to NF-B induced transactivation showed that HLA-G promoter mutations only permit affinity for the p50 subunit of NF-B [16]. Recently, new data concerning HLA class I gene expression derived both from the alignement of HLA class I and HLA-class II promoters, and the observation of a reduced level of MHC class I expression in addition to the lack of HLA class II expression in the type III bare lymphocyte syndrome (BLS) [17]. The regulation of HLA class II genes is principally mediated by a set of conserved cis-acting regulatory elements located in the proximal promoter region consisting of four sequence elements termed the W/S/Z box, the X box that is comprised of the X1 and X2 halves, and the Y box with an inverted CCAAT site [18]. The X1 box is the binding site for ubiquitous RFX complex consisting of the three subunits RFX5, RFXB/ANK, and RFXAP; the X2 box is bound by the X2BP/CREB factor and the Y box by NF-Y factor [19, 20]. The basic S-X-Y regulatory module interacts with the coactivator CIITA that is expressed constitutively only in APCs of the immune system, but it may be inducible in others cell types by IFN-␥ [21]. Similar to HLA class II genes, the promoter of HLA class I genes exhibits the S-X-Y module, X2 corresponding to ␣ site and Y to enhancer B. Homologies have also been identified in the pathways regulating both HLA class II and HLA class I genes as the RFX complex was demonstrated as crucial for the constitutive and CIITA-mediated transactivation of HLA class I genes [22]. Interestingly, the absence of an intact S-X-Y module in the HLA-G promoter justifies the lack of CIITA mediated activation [23]. The S and X1 boxes are the only conserved motifs suggesting they may have a role in the regulation of HLA-G gene expression. Thus, in this work we assessed the binding capacity of the X box from HLA-G in comparison to that of HLA-DRA and HLA-E. X2 box mutations in HLA-G promoter affect the binding of ATF/CREB family of factors whereas the X1 box in HLA-DR, HLA-E, and HLA-G is the target for RFX and Sp1 factors.
1133
MATERIALS AND METHODS Cell Lines and Primary Cultures The choriocarcinoma cell line JEG-3 was purchased from ATCC (Rockville, MD, USA). JEG-3 and B.EBV cell lines were, respectively, cultured in DMEM or RPMI medium (Life Technologies, Paisley, Scotland) supplemented with 10% of Fetal Calf Serum and 2 mM of L-glutamine and incubated at 37°C in humidified atmosphere containing 5% CO2 . Primary TEC cultures were established using normal thymus obtained from children undergoing cardiac surgery (Marie-Lannelongue Hospital, Le Plessis Robinson, France). Small thymus pieces were washed and incubated in RPMI, 20% horse serum for 10 to 12 days. Adherent thymic epithelial cells were collected by trypsinization and subcultured. Nuclear Extracts and Elecrophoretic Mobility Shift Assay Nuclear proteins were prepared as previously described [15]. Before extraction, cells (2 to 5 ⫻ 107) were washed twice with 1 ⫻ TBS pH7.6 (20 mM Tris and 137 mM NaCl) supplemented with 0.1 mM PMSF. Then, 2 l nuclear extracts were incubated with ␥-32P doublestrand oligonucleotide probe (1 to 2 ng, 105 cpm) encompassing the X1X2 box of either HLA-G, HLA-DRA, or HLA-E, 2 g poly [dI-dC] (Pharmacia, Orsay, France) in binding buffer containing 40 mM KCL, 20 mM Hepes pH7.5, 0.1 mM EGTA, 1 mM MgCl2, 0.5 mM DTT, and 0.4% Ficoll. Sense oligonucleotides (ESGS, Saint-Malo, France) for probes were: X1X2-G (5⬘-CTTCT TCCTGGATACTCACCGGGCGGCCCCA); X1X2-DR (5⬘- CTTCCCCTAGCAACAGATGCGTCATCTCAT) [22]; and X1X2-E (5⬘-CTTCTTCCTGGATACTCAT GACGCAGACTCA). Competition experiments were performed using 200-fold molar excess of cold X1X2-G, X1X2-DR, X1X2-E fragments, and double unlabeled fragments with the following top sequences: X1X2-F (5⬘-CTTCATCCTGGATACTCATAACGCG GCCCCA); X1X2-A11 (5⬘-CTTCATCCTGGATACT CACGACGCGGACCCA; X1 cons (5⬘- CTTCTTCCT GGATACTCAT); ⫺129 G (5⬘-CTCACCGGGCGGC CCCAGTTCTCACTCCCATTAGGTGACAGGTTTT TAGA); and IRR (5⬘-GCTCCTTCTGAGTATCTTT ACA). Complexes were separated by electrophoresis for 2 h and 30 min at 200V in 5% polyacrylamide gel (29:1 acrylamide-bisacrylamide ratio). For supershift experiments, 1 g antibodies were added to the binding reaction mixture and incubated for 1 h at room temperature. Antibodies directed against Sp1 (sc-420 X) and ATF-1 (sc-270 X) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
1134
FIGURE 1 Binding of RFX to the X box of HLA-G gene promoter. EMSA of nuclear factors from JEG-3 and B.EBV cell lines incubated with X1X2 probes of HLA-DR (X1X2DR) and HLA-G (X1X2-G) promoters. The complexes obtained with X1X2-DR probe were previously described [22] as indicated on the left. To assess specificity of binding, competition experiments were carried out using cold irrelevant dsoligonucleotide (IRR) and an excess of unlabelled fragments corresponding to each probe. Note that X2BP/ATF/CREB complexes obtained with X1X2-DR probe are not displaced by addition of 200 fold molar excess of X1X2-G fragments.
A mouse monoclonal IgG was used as a nonspecific control (Sigma-Aldrich, Saint-Quentin Fallavier, France). RESULTS The X Box of HLA-G Gene Promoter Sequence is a Target for RFX Factors The binding capacity of the partly conserved X box from the HLA-G promoter sequence was examined by electrophoretic mobility shift assays (EMSA) first using nuclear extracts from the HLA-DR positive B.EBV cell line and the HLA-G positive JEG-3 cell line. Nuclear extracts were incubated with oligonucleotide probes corresponding to the X1X2 box region either from HLA-DR (X1X2-DR) or HLA-G (X1X2-G) promoter sequences (Figure 1). As previously described [22], the binding to the X1X2-DR oligonucleotide gave rise to strong retarded complexes corresponding to RFX and X2BP/ ATF/CREB factors that were observed with both cell lines. The complexes were displaced by addition of an excess of X1X2-DR unlabeled ds-fragment whereas competition performed with an excess of cold X1X2-G ds-
P. Rousseau et al.
FIGURE 2 A Sp1 containing complex bind to the HLA-G X1 box. EMSA and supershift analysis of nuclear factors from thymic epithelial cells (TEC) incubated with X1X2-G probe. Antibodies are anti-Sp1 (Sp1), anti-ATF-1 (ATF) and control (IgG). The supershifted complex is indicated by an asterisk.
fragment only displaced RFX complexes. The binding of RFX was confirmed using labeled X1X2-G probe, which gave X1 box complexes thus correlating with the conserved X1 sequence and the disrupted X2 sequence in HLA-G gene promoter. This result was also observed using thymic epithelial cells (TEC) expressing both HLA-G and HLA-DR molecules (Figure 2). In particular, supershift analysis using an anti-ATF antibody clearly demonstrated the lack of binding of ATF factor family to the HLA-G X2 box. According to previous results the presence of the evolutionnary conserved X1 box among classical and nonclassical HLA class I and HLA class II gene promoters may explain why RFX complexes, revealed with the X1X2-G probe and B.EBV extracts, were displaced whether the excess X1X2 cold competitor was from either HLA-E, -F, A11, or HLA-DRA promoter sequence (Figure 3). Moreover, an additional complex with a higher rate of migration was strongly displaced by the X1X2-G competitor and a HLA-G promoter fragment covering the X2 box (⫺129G), but was not displaced by adding an excess of cold consensus X1 ds-oligonucleotide suggesting that the X2 box might be the binding site.
RFX, Sp1, and HLA-G Gene Promoter
1135
FIGURE 4 Shared nuclear complexes associate X1X2-DR and X1X2-E probes. EMSA and supershift analysis of nuclear factors from thymic epithelial cells (TEC) incubated with either X1X2-DR (a) or X1X2-E probe (b). Sp1 factor is revealed with both probes by supershift analysis is indicated by one asterisk (*). The use of an antibody directed against ATF factor generates a supershifted complex indicated by two asterisks (**).
FIGURE 3 Binding of RFX factors to the X box of HLA class I and HLA class II gene promoters and evidence for the binding of an original B.EBV nuclear complex to the X1X2-G probe with high rate of gel migration. The X1X2-E, X1X2-F, X1X2-G, X1X2-A11, and X1X2-DR are unlabeled competitor fragments corresponding to X1X2 boxes within HLA-E, HLA-F, HLA-G, HLA-A11, and HLA-DRA promoters, respectively. X1 cons is a double-stranded consensus oligonucleotide for HLA class I X1 site that only displaces RFX complex. The high rate complex is displaced by a ds-oligonucleotide encompassing X2 site and four nucleotides of 3⬘ half of X1 site (⫺129 G).
The X Box of HLA-E Promoter Sequence is a Target for Both RFX and X2BP/ATF/CREB Factors EMSA using nuclear extracts from TEC cells that had previously been incubated with the X1X2-DR oligonucleotide probe revealed strong retarded RFX and X2BP/ ATF/CREB complexes. These complexes were displaced by competition assays using an excess of both cold X1X2-DR and X1X2-E ds-oligonucleotide (Figure 4A). The binding of RFX and X2BP/ATF/CREB factors to the conserved X box of the HLA-E promoter sequence was confirmed using labeled X1X2-E ds-oligonucleotide incubated with TEC nuclear extracts (Figure 4B). One of the X1 Box Associated Factors is Sp1 To further investigate HLA-G X box specificities, we analyzed the HLA-G promoter sequence for known transcription factor binding sites and revealed the presence of a putative binding site for the ubiquitious transcription factor Sp1 located in the X box. We thus investigated the possible binding of Sp1 factor to this region by
1136
supershift analysis a using anti-Sp1 antibody and EMSA experiments with TEC nuclear extracts and labeled X1X2-G probe. One of the complexes formed with the X1X2 probe of HLA-G could clearly be supershifted with the anti-Sp1 antibody (Figure 2). To evaluate if the observed Sp1 binding was restricted to HLA-G, we also used a X1X2 probe from either HLA-DR (Figure 4A) or HLA-E (Figure 4B) promoter sequence. This revealed the presence of the Sp1 factor in one of the complexes binding to the X1 box of both probes. DISCUSSION The tissue specific activation of HLA-G gene is not mediated by pathways involving the upstream module consisting of the enhancer A and ISRE [23]. In order to investigate molecular mechanisms that could account for specific HLA-G gene activation, the aim of this work was to examine the region encompassing the downstream regulatory module, namely S-X-Y, which exhibits similarities between MHC class I and class II genes and shared regulatory pathways [17]. This ancestral regulatory module interacts with a multiprotein complex including RFX, X2BP/ATF/CREB, NF-Y factors, and CIITA that are involved in constitutive and inducible MHC class I gene expression. In the promoter sequence of nonclassical HLA class I gene HLA-E, S-X-Y boxes are homologous to those found in classical HLA class I genes suggesting closed regulatory mechanisms. In contrast, HLA-G appears as the “odd one out gene” because the S box and X1 box, consisting of the 5⬘ half of the X box, are the only conserved sequences [23]. Accordingly, the present work demonstrated for the first time the differential binding of nuclear factors to the X box within the HLA-G promoter in comparison to HLA-E. RFX factors bind indifferently to the X1 box of both gene promoters, whereas X2BP/ATF/CREB factors only bind the X2 box (3⬘ half of the X box) from HLA-E promoter sequence. These results agree with those from Gobin and collegues (HLA-G 2000 conference), which showed that CIITAinduced transactivation was restricted to HLA-E and HLA-F where the X-Y-Z module is also conserved. The presence of an intact X1 site in HLA-G gene promoter and the demonstration of its ability to associate the RFX complex may be of functional significance. In effect, we propose that RFX could be a component of a HLA-G specific multiprotein complex involved in an activation pathway that evolved independantly of the pathway involving CIITA-transactivation. This may have given rise to tissue restricted HLA-G gene activation in relation to the highly specialized function of HLA-G in immune tolerance. In agreement with this hypothesis it is very interesting to note that in addition to the X1 box, the only conserved regulatory sequence in
P. Rousseau et al.
the HLA-G gene promoter is S box, which has been shown to interact with RFX proteins [24]. On the other hand, the lack of X2BP/ATF/CREB binding to the mutated HLA-G X2 box should provide priviledged access to other factors. In support of this assumption are results in Figure 3 using B.EBV cell line extracts, which identify factors we are currently analyzing that associate to this region with a higher affinity in comparison to other sequences. Using supershift approaches, this study also provides the first evidence for association of Sp1 factor to the X1 box within HLA-G, HLA-DR, HLA-E, and promoter sequences. Sp1 is a ubiquitously expressed transcription factor that plays a primary role in the regulation of a large number of gene promoters and consists of multiple functional domains including zinc-finger DNA binding region and four transcriptional activation domains [25– 27]. In particular, the binding of Sp1 to both kB sites and their flanking sequences of the HLA-G promoter was recently reported [28]. To further investigate Sp1 association to HLA-G X box, we performed competition experiments using an excess of cold target DNA corresponding to the Sp1 consensus binding site [25] and did not observe any band shift suggesting that Sp1 DNA binding to the X1 box was faint or absent (data not shown). Thus, it is possible that the Sp1 factor is involved in protein–protein interactions with one factor of the RFX complex and, therefore, may interact with DNA at another locus that may be one of the two Sp1 binding site described within HLA-G gene promoter. In such a model mutations in both X2 and Y boxes of HLA-G will disrupt DNA binding of X2BP/ATF/CREB and NFY factors, which are required for CIITA transactivation, thus allowing specific Sp1 interactions with possible implications for chromatin remodeling. This hypothesis is currently under investigation using in vivo analysis approaches. ACKNOWLEDGMENTS
We are grateful to Sonia Berrih-Aknin and the whole team at the Marie Lannelongue Hospital for thymus. We thank Walter Reith for helpful discussion and the “Service Photographique de l’Institut d’He´matologie” for photographic work. This study was funded by the French Commissariat a` l’Energie Atomique (C.E.A.). M.O’B. is a recipient of a fellowship from the Socie´te´ de Secours des Amis des Sciences.
REFERENCES 1. Carosella ED, Rouas-Freiss N, Paul P, Dausset J : HLA-G: a tolerance molecule from the major histocompatibility complex. Immunol Today 20:60, 1999. 2. Llano M, Lee N, Navarro F, Garcia P, Albar JP, Geraghty DE, Lopez-Botet M: HLA-E-bound peptides influence
RFX, Sp1, and HLA-G Gene Promoter
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
recognition by inhibitory and triggering CD94/NKG2 receptors: preferential response to an HLA-G-derived nonamer. Eur J Immunol 28:2854, 1998. Le Gal FA, Riteau B, Sedlik C, Khalil-Daher I, Menier C, Dausset J, Guillet JG, Carosella ED, Rouas-Freiss N: HLA-G-mediated inhibition of antigen-specific cytotoxic T lymphocytes. Int Immunol 11:1351, 1999. Kovats S, Main EK, Librach C, Stubblebine M, Fisher SJ, DeMars R: A class I antigen, HLA-G, expressed in human trophoblasts. Science 248:220, 1990. McMaster MT, Librach CL, Zhou Y, Lim KH, Janatpour MJ, DeMars R, Kovats S, Damsky C, Fisher SJ: Human placental HLA-G expression is restricted to differentiated cytotrophoblasts. J Immunol 154:3771, 1995. Hammer A, Hutter H, Blaschitz A, Mahnert W, Hartmann M, Uchanska-Ziegler B, Ziegler A, Dohr G: Amnion epithelial cells, in contrast to trophoblast cells, express all classical HLA class I molecules together with HLA-G. Am J Reprod Immunol 37:161, 1997. Paul P, Cabestre FA, Le Gal FA, Khalil-Daher I, Le Danff C, Schmid M, Mercier S, Avril MF, Dausset J, Guillet JG, Carosella ED: Heterogeneity of HLA-G gene transcription and protein expression in malignant melanoma biopsies. Cancer Res 59:1954, 1999. Crisa L, McMaster MT, Ishii JK, Fisher SJ, Salomon DR: Identification of a thymic epithelial cell subset sharing expression of the class Ib HLA-G molecule with fetal trophoblasts. J Exp Med 186:289, 1997. Yang Y, Chu W, Geraghty DE, Hunt JS: Expression of HLA-G in human mononuclear phagocytes and selective induction by IFN-gamma. J Immunol 156:4224, 1996. Moreau P, Adrian-Cabestre F, Menier C, Guiard V, Gourand L, Dausset J, Carosella ED, Paul P: IL-10 selectively induces HLA-G expression in human trophoblasts and monocytes. Int Immunol 11:803, 1999. Moreau P, Lefebvre S, Gourand L, Dausset J, Carosella ED, Paul P: Specific binding of nuclear factors to the HLA-G gene promoter correlates with a lack of HLA-G transcripts in first trimester human fetal liver. Hum Immunol 59:751, 1998. Teyssier M, Bensussan A, Kirszenbaum M, Moreau P, Gluckman E, Dausset J, Carosella E: Natural killer cells are the unique lymphocyte cell subset which do not express HLA-G. Nat Immun 14:262, 1995. Onno M, Amiot L, Bertho N, Drenou B, Fauchet R: CpG methylation patterns in the 5⬘ part of the nonclassical HLA-G gene in peripheral blood CD34⫹ cells and CD2⫹ lymphocytes. Tissue Antigens 49:356, 1997. Schmidt CM, Ehlenfeldt RG, Athanasiou MC, Duvick LA, Heinrichs H, David CS, Orr HT: Extraembryonic expression of the human MHC class I gene HLA-G in transgenic mice. Evidence for a positive regulatory region located 1 kilobase 5⬘ to the start site of transcription. J Immunol 151:2633, 1993.
1137
15. Moreau P, Paul P, Gourand L, Prost S, Dausset J, Carosella E, Kirszenbaum M: HLA-G gene transcriptional regulation in trophoblasts and blood cells: differential binding of nuclear factors to a regulatory element located 1.1 kb from exon 1. Hum Immunol 52:41, 1997. 16. Gobin SJ, Keijsers V, van Zutphen M, van den Elsen PJ: The role of enhancer A in the locus-specific transactivation of classical and nonclassical HLA class I genes by nuclear factor kappa B. J Immunol 161:2276, 1998. 17. van den Elsen PJ, Peijnenburg A, van Eggermond MC, Gobin SJ: Shared regulatory elements in the promoters of MHC class I and class II genes. Immunol Today 19:308, 1998. 18. Mach B, Steimle V, Martinez-Soria E, Reith W: Regulation of MHC class II genes: lessons from a disease. Annu Rev Immunol 14:301, 1996. 19. Louis-Plence P, Moreno CS, Boss JM: Formation of a regulatory factor X/X2 box-binding protein/nuclear factor-Y multiprotein complex on the conserved regulatory regions of HLA class II genes. J Immunol 159:3899, 1997. 20. Nagarajan UM, Louis-Plence P, DeSandro A, Nilsen R, Bushey A, Boss JM: RFX-B is the gene responsible for the most common cause of the bare lymphocyte syndrome, an MHC class II immunodeficiency. Immunity 10:153, 1999. 21. Mach B: Perspectives in immunology. Regulating the regulator. Science 285:1367, 1999. 22. Gobin SJ, Peijnenburg A, van Eggermond M, van Zutphen M, van den Berg R, van den Elsen PJ: The RFX complex is crucial for the constitutive and CIITA-mediated transactivation of MHC class I and beta2-microglobulin genes. Immunity 9:531, 1998. 23. Gobin SJ, van den Elsen PJ: The regulation of HLA class I expression: is HLA-G the odd one out? Semin Cancer Biol 9:55, 1999. 24. Briggs MR, Kadonaga JT, Bell SP, Tjian R: Purification and biochemical characterization of the promoter-specific transcription factor, Sp1. Science 234:47, 1986. 25. Jabrane-Ferrat N, Fontes JD, Boss JM, Peterlin BM: Complex architecture of major histocompatibility complex class II promoters: reiterated motifs and conserved protein-protein interactions. Mol Cell Biol 16:4683, 1996. 26. Courey AJ, Tjian R: Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55:887, 1988. 27. Pascal E, Tjian R: Different activation domains of Sp1 govern formation of multimers and mediate transcriptional synergism. Genes Dev 5:1646, 1991. 28. Gobin SJ, van Zutphen M, Woltman AM, van den Elsen PJ: Transactivation of classical and nonclassical HLA class I genes through the IFN-stimulated response element. J Immunol 163:1428, 1999.
ABBREVIATIONS CIITA class II transactivator ds double strand EMSA electrophoretic mobility shift assays
INTRODUCTION The nonclassical human leukocyte antigen-G (HLA-G) molecule inhibits natural killer (NK) cells either directly through interaction with killing inhibitory receptor (KIR) or indirectly through stabilization of the HLA-E molecule with a nonamer peptide derived from HLA-G signal sequence [1, 2]. HLA-G also impairs T-cell cytolysis and, thus, appears to have an extensive role in immune tolerance processes [3]. Further evidence of this role is suggested by the expression of the HLA-G molFrom the CEA, Service de Recherche en He´mato-Immunologie (P.R., P.P., M.O’B., E.D.C., P.M), DSV/DRM, Hoˆpital Saint-Louis, Institut d’He´matologie, Paris; and the Fondation Jean Dausset (J.D.), Paris, France. Address reprint requests to: Dr. Philippe Moreau, CEA-SRHI, Hoˆpital Saint-Louis, Institut d’He´matologie, 1 avenue Claude-Vellefaux, 75475 Paris Cedex 10, France; Tel: ⫹33 (0)1 53 72 21 40; Fax: ⫹33 (0) 1 48 03 19 60; E-Mail: [email protected]. Received August 1, 2000; accepted September 13, 2000. Human Immunology 61, 1132–1137 (2000) © American Society for Histocompatibility and Immunogenetics, 2000 Published by Elsevier Science Inc.
HLA-G X box in comparison to that of HLA-DRA and HLA-E. We demonstrate that X2 box mutations in HLA-G promoter affect the binding of ATF/CREB family factors and may privilege the X2 box to access by other shared factors. The X1 box is the target for RFX complex and an additional factor we identified as Sp1. We propose that the X region in the HLA-G gene promoter might participate to the combination of factors which play a role in HLA-G gene activation. Human Immunology 61, 1132–1137 (2000). © American Society for Histocompatibility and Immunogenetics, 2000. Published by Elsevier Science Inc. KEYWORDS: HLA-G; regulation; X box
ISRE NFB
interferon-stimulated response element nuclear factor B
ecule in different placental cell subpopulations such as extravillous cytotrophoblasts and amniotic cells [4 – 6] and may account for the pathologic expression in some melanoma tumors [7]. The HLA-G molecule is also detected in thymic medullary epithelial cells [8] and was demonstrated to be induced by IFN-␥ [9] and IL-10 [10] on blood monocytes. The highest levels of HLA-G transcripts are observed in tissues exhibiting constitutive HLA-G expression, while only low levels of HLA-G transcripts are detected in other tissues. The lack of HLA-G transcription has been reported in fetal liver from first trimester of gestation, NK and CD34⫹ cells [11–13], and thus argue for a tight transcriptional control of HLA-G expression. The molecular mechanisms that control HLA-G transcriptional regulation are poorly understood. Analysis of the HLA-G promoter in transgenic mice pointed out the 0198-8859/00/$–see front matter PII S0198-8859(00)00199-3
RFX, Sp1, and HLA-G Gene Promoter
importance of the region covering 0.25 kb at 1.2 kb from the gene in the tissue specific expression of HLA-G in vivo [14]. We showed in vitro the differential binding of nuclear factors from cells expressing or not HLA-G to this region and proposed that it could be a target for negative regulatory elements [11, 15]. Moreover, the alignment of the proximal region of the HLA-G and the classical HLA class I promoters reveal that cis-acting regulatory elements including enhancer A (NF-B/Rel family of DNA-binding protein), IFN-stimulated response element (ISRE) and site ␣ (ATF/CREB family of DNA-binding protein) are disrupted in the HLA-G promoter. In particular, investigation of both the binding properties of two putative B sites of enhancer A (B1, B2) and also their contribution to NF-B induced transactivation showed that HLA-G promoter mutations only permit affinity for the p50 subunit of NF-B [16]. Recently, new data concerning HLA class I gene expression derived both from the alignement of HLA class I and HLA-class II promoters, and the observation of a reduced level of MHC class I expression in addition to the lack of HLA class II expression in the type III bare lymphocyte syndrome (BLS) [17]. The regulation of HLA class II genes is principally mediated by a set of conserved cis-acting regulatory elements located in the proximal promoter region consisting of four sequence elements termed the W/S/Z box, the X box that is comprised of the X1 and X2 halves, and the Y box with an inverted CCAAT site [18]. The X1 box is the binding site for ubiquitous RFX complex consisting of the three subunits RFX5, RFXB/ANK, and RFXAP; the X2 box is bound by the X2BP/CREB factor and the Y box by NF-Y factor [19, 20]. The basic S-X-Y regulatory module interacts with the coactivator CIITA that is expressed constitutively only in APCs of the immune system, but it may be inducible in others cell types by IFN-␥ [21]. Similar to HLA class II genes, the promoter of HLA class I genes exhibits the S-X-Y module, X2 corresponding to ␣ site and Y to enhancer B. Homologies have also been identified in the pathways regulating both HLA class II and HLA class I genes as the RFX complex was demonstrated as crucial for the constitutive and CIITA-mediated transactivation of HLA class I genes [22]. Interestingly, the absence of an intact S-X-Y module in the HLA-G promoter justifies the lack of CIITA mediated activation [23]. The S and X1 boxes are the only conserved motifs suggesting they may have a role in the regulation of HLA-G gene expression. Thus, in this work we assessed the binding capacity of the X box from HLA-G in comparison to that of HLA-DRA and HLA-E. X2 box mutations in HLA-G promoter affect the binding of ATF/CREB family of factors whereas the X1 box in HLA-DR, HLA-E, and HLA-G is the target for RFX and Sp1 factors.
1133
MATERIALS AND METHODS Cell Lines and Primary Cultures The choriocarcinoma cell line JEG-3 was purchased from ATCC (Rockville, MD, USA). JEG-3 and B.EBV cell lines were, respectively, cultured in DMEM or RPMI medium (Life Technologies, Paisley, Scotland) supplemented with 10% of Fetal Calf Serum and 2 mM of L-glutamine and incubated at 37°C in humidified atmosphere containing 5% CO2 . Primary TEC cultures were established using normal thymus obtained from children undergoing cardiac surgery (Marie-Lannelongue Hospital, Le Plessis Robinson, France). Small thymus pieces were washed and incubated in RPMI, 20% horse serum for 10 to 12 days. Adherent thymic epithelial cells were collected by trypsinization and subcultured. Nuclear Extracts and Elecrophoretic Mobility Shift Assay Nuclear proteins were prepared as previously described [15]. Before extraction, cells (2 to 5 ⫻ 107) were washed twice with 1 ⫻ TBS pH7.6 (20 mM Tris and 137 mM NaCl) supplemented with 0.1 mM PMSF. Then, 2 l nuclear extracts were incubated with ␥-32P doublestrand oligonucleotide probe (1 to 2 ng, 105 cpm) encompassing the X1X2 box of either HLA-G, HLA-DRA, or HLA-E, 2 g poly [dI-dC] (Pharmacia, Orsay, France) in binding buffer containing 40 mM KCL, 20 mM Hepes pH7.5, 0.1 mM EGTA, 1 mM MgCl2, 0.5 mM DTT, and 0.4% Ficoll. Sense oligonucleotides (ESGS, Saint-Malo, France) for probes were: X1X2-G (5⬘-CTTCT TCCTGGATACTCACCGGGCGGCCCCA); X1X2-DR (5⬘- CTTCCCCTAGCAACAGATGCGTCATCTCAT) [22]; and X1X2-E (5⬘-CTTCTTCCTGGATACTCAT GACGCAGACTCA). Competition experiments were performed using 200-fold molar excess of cold X1X2-G, X1X2-DR, X1X2-E fragments, and double unlabeled fragments with the following top sequences: X1X2-F (5⬘-CTTCATCCTGGATACTCATAACGCG GCCCCA); X1X2-A11 (5⬘-CTTCATCCTGGATACT CACGACGCGGACCCA; X1 cons (5⬘- CTTCTTCCT GGATACTCAT); ⫺129 G (5⬘-CTCACCGGGCGGC CCCAGTTCTCACTCCCATTAGGTGACAGGTTTT TAGA); and IRR (5⬘-GCTCCTTCTGAGTATCTTT ACA). Complexes were separated by electrophoresis for 2 h and 30 min at 200V in 5% polyacrylamide gel (29:1 acrylamide-bisacrylamide ratio). For supershift experiments, 1 g antibodies were added to the binding reaction mixture and incubated for 1 h at room temperature. Antibodies directed against Sp1 (sc-420 X) and ATF-1 (sc-270 X) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
1134
FIGURE 1 Binding of RFX to the X box of HLA-G gene promoter. EMSA of nuclear factors from JEG-3 and B.EBV cell lines incubated with X1X2 probes of HLA-DR (X1X2DR) and HLA-G (X1X2-G) promoters. The complexes obtained with X1X2-DR probe were previously described [22] as indicated on the left. To assess specificity of binding, competition experiments were carried out using cold irrelevant dsoligonucleotide (IRR) and an excess of unlabelled fragments corresponding to each probe. Note that X2BP/ATF/CREB complexes obtained with X1X2-DR probe are not displaced by addition of 200 fold molar excess of X1X2-G fragments.
A mouse monoclonal IgG was used as a nonspecific control (Sigma-Aldrich, Saint-Quentin Fallavier, France). RESULTS The X Box of HLA-G Gene Promoter Sequence is a Target for RFX Factors The binding capacity of the partly conserved X box from the HLA-G promoter sequence was examined by electrophoretic mobility shift assays (EMSA) first using nuclear extracts from the HLA-DR positive B.EBV cell line and the HLA-G positive JEG-3 cell line. Nuclear extracts were incubated with oligonucleotide probes corresponding to the X1X2 box region either from HLA-DR (X1X2-DR) or HLA-G (X1X2-G) promoter sequences (Figure 1). As previously described [22], the binding to the X1X2-DR oligonucleotide gave rise to strong retarded complexes corresponding to RFX and X2BP/ ATF/CREB factors that were observed with both cell lines. The complexes were displaced by addition of an excess of X1X2-DR unlabeled ds-fragment whereas competition performed with an excess of cold X1X2-G ds-
P. Rousseau et al.
FIGURE 2 A Sp1 containing complex bind to the HLA-G X1 box. EMSA and supershift analysis of nuclear factors from thymic epithelial cells (TEC) incubated with X1X2-G probe. Antibodies are anti-Sp1 (Sp1), anti-ATF-1 (ATF) and control (IgG). The supershifted complex is indicated by an asterisk.
fragment only displaced RFX complexes. The binding of RFX was confirmed using labeled X1X2-G probe, which gave X1 box complexes thus correlating with the conserved X1 sequence and the disrupted X2 sequence in HLA-G gene promoter. This result was also observed using thymic epithelial cells (TEC) expressing both HLA-G and HLA-DR molecules (Figure 2). In particular, supershift analysis using an anti-ATF antibody clearly demonstrated the lack of binding of ATF factor family to the HLA-G X2 box. According to previous results the presence of the evolutionnary conserved X1 box among classical and nonclassical HLA class I and HLA class II gene promoters may explain why RFX complexes, revealed with the X1X2-G probe and B.EBV extracts, were displaced whether the excess X1X2 cold competitor was from either HLA-E, -F, A11, or HLA-DRA promoter sequence (Figure 3). Moreover, an additional complex with a higher rate of migration was strongly displaced by the X1X2-G competitor and a HLA-G promoter fragment covering the X2 box (⫺129G), but was not displaced by adding an excess of cold consensus X1 ds-oligonucleotide suggesting that the X2 box might be the binding site.
RFX, Sp1, and HLA-G Gene Promoter
1135
FIGURE 4 Shared nuclear complexes associate X1X2-DR and X1X2-E probes. EMSA and supershift analysis of nuclear factors from thymic epithelial cells (TEC) incubated with either X1X2-DR (a) or X1X2-E probe (b). Sp1 factor is revealed with both probes by supershift analysis is indicated by one asterisk (*). The use of an antibody directed against ATF factor generates a supershifted complex indicated by two asterisks (**).
FIGURE 3 Binding of RFX factors to the X box of HLA class I and HLA class II gene promoters and evidence for the binding of an original B.EBV nuclear complex to the X1X2-G probe with high rate of gel migration. The X1X2-E, X1X2-F, X1X2-G, X1X2-A11, and X1X2-DR are unlabeled competitor fragments corresponding to X1X2 boxes within HLA-E, HLA-F, HLA-G, HLA-A11, and HLA-DRA promoters, respectively. X1 cons is a double-stranded consensus oligonucleotide for HLA class I X1 site that only displaces RFX complex. The high rate complex is displaced by a ds-oligonucleotide encompassing X2 site and four nucleotides of 3⬘ half of X1 site (⫺129 G).
The X Box of HLA-E Promoter Sequence is a Target for Both RFX and X2BP/ATF/CREB Factors EMSA using nuclear extracts from TEC cells that had previously been incubated with the X1X2-DR oligonucleotide probe revealed strong retarded RFX and X2BP/ ATF/CREB complexes. These complexes were displaced by competition assays using an excess of both cold X1X2-DR and X1X2-E ds-oligonucleotide (Figure 4A). The binding of RFX and X2BP/ATF/CREB factors to the conserved X box of the HLA-E promoter sequence was confirmed using labeled X1X2-E ds-oligonucleotide incubated with TEC nuclear extracts (Figure 4B). One of the X1 Box Associated Factors is Sp1 To further investigate HLA-G X box specificities, we analyzed the HLA-G promoter sequence for known transcription factor binding sites and revealed the presence of a putative binding site for the ubiquitious transcription factor Sp1 located in the X box. We thus investigated the possible binding of Sp1 factor to this region by
1136
supershift analysis a using anti-Sp1 antibody and EMSA experiments with TEC nuclear extracts and labeled X1X2-G probe. One of the complexes formed with the X1X2 probe of HLA-G could clearly be supershifted with the anti-Sp1 antibody (Figure 2). To evaluate if the observed Sp1 binding was restricted to HLA-G, we also used a X1X2 probe from either HLA-DR (Figure 4A) or HLA-E (Figure 4B) promoter sequence. This revealed the presence of the Sp1 factor in one of the complexes binding to the X1 box of both probes. DISCUSSION The tissue specific activation of HLA-G gene is not mediated by pathways involving the upstream module consisting of the enhancer A and ISRE [23]. In order to investigate molecular mechanisms that could account for specific HLA-G gene activation, the aim of this work was to examine the region encompassing the downstream regulatory module, namely S-X-Y, which exhibits similarities between MHC class I and class II genes and shared regulatory pathways [17]. This ancestral regulatory module interacts with a multiprotein complex including RFX, X2BP/ATF/CREB, NF-Y factors, and CIITA that are involved in constitutive and inducible MHC class I gene expression. In the promoter sequence of nonclassical HLA class I gene HLA-E, S-X-Y boxes are homologous to those found in classical HLA class I genes suggesting closed regulatory mechanisms. In contrast, HLA-G appears as the “odd one out gene” because the S box and X1 box, consisting of the 5⬘ half of the X box, are the only conserved sequences [23]. Accordingly, the present work demonstrated for the first time the differential binding of nuclear factors to the X box within the HLA-G promoter in comparison to HLA-E. RFX factors bind indifferently to the X1 box of both gene promoters, whereas X2BP/ATF/CREB factors only bind the X2 box (3⬘ half of the X box) from HLA-E promoter sequence. These results agree with those from Gobin and collegues (HLA-G 2000 conference), which showed that CIITAinduced transactivation was restricted to HLA-E and HLA-F where the X-Y-Z module is also conserved. The presence of an intact X1 site in HLA-G gene promoter and the demonstration of its ability to associate the RFX complex may be of functional significance. In effect, we propose that RFX could be a component of a HLA-G specific multiprotein complex involved in an activation pathway that evolved independantly of the pathway involving CIITA-transactivation. This may have given rise to tissue restricted HLA-G gene activation in relation to the highly specialized function of HLA-G in immune tolerance. In agreement with this hypothesis it is very interesting to note that in addition to the X1 box, the only conserved regulatory sequence in
P. Rousseau et al.
the HLA-G gene promoter is S box, which has been shown to interact with RFX proteins [24]. On the other hand, the lack of X2BP/ATF/CREB binding to the mutated HLA-G X2 box should provide priviledged access to other factors. In support of this assumption are results in Figure 3 using B.EBV cell line extracts, which identify factors we are currently analyzing that associate to this region with a higher affinity in comparison to other sequences. Using supershift approaches, this study also provides the first evidence for association of Sp1 factor to the X1 box within HLA-G, HLA-DR, HLA-E, and promoter sequences. Sp1 is a ubiquitously expressed transcription factor that plays a primary role in the regulation of a large number of gene promoters and consists of multiple functional domains including zinc-finger DNA binding region and four transcriptional activation domains [25– 27]. In particular, the binding of Sp1 to both kB sites and their flanking sequences of the HLA-G promoter was recently reported [28]. To further investigate Sp1 association to HLA-G X box, we performed competition experiments using an excess of cold target DNA corresponding to the Sp1 consensus binding site [25] and did not observe any band shift suggesting that Sp1 DNA binding to the X1 box was faint or absent (data not shown). Thus, it is possible that the Sp1 factor is involved in protein–protein interactions with one factor of the RFX complex and, therefore, may interact with DNA at another locus that may be one of the two Sp1 binding site described within HLA-G gene promoter. In such a model mutations in both X2 and Y boxes of HLA-G will disrupt DNA binding of X2BP/ATF/CREB and NFY factors, which are required for CIITA transactivation, thus allowing specific Sp1 interactions with possible implications for chromatin remodeling. This hypothesis is currently under investigation using in vivo analysis approaches. ACKNOWLEDGMENTS
We are grateful to Sonia Berrih-Aknin and the whole team at the Marie Lannelongue Hospital for thymus. We thank Walter Reith for helpful discussion and the “Service Photographique de l’Institut d’He´matologie” for photographic work. This study was funded by the French Commissariat a` l’Energie Atomique (C.E.A.). M.O’B. is a recipient of a fellowship from the Socie´te´ de Secours des Amis des Sciences.
REFERENCES 1. Carosella ED, Rouas-Freiss N, Paul P, Dausset J : HLA-G: a tolerance molecule from the major histocompatibility complex. Immunol Today 20:60, 1999. 2. Llano M, Lee N, Navarro F, Garcia P, Albar JP, Geraghty DE, Lopez-Botet M: HLA-E-bound peptides influence
RFX, Sp1, and HLA-G Gene Promoter
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
recognition by inhibitory and triggering CD94/NKG2 receptors: preferential response to an HLA-G-derived nonamer. Eur J Immunol 28:2854, 1998. Le Gal FA, Riteau B, Sedlik C, Khalil-Daher I, Menier C, Dausset J, Guillet JG, Carosella ED, Rouas-Freiss N: HLA-G-mediated inhibition of antigen-specific cytotoxic T lymphocytes. Int Immunol 11:1351, 1999. Kovats S, Main EK, Librach C, Stubblebine M, Fisher SJ, DeMars R: A class I antigen, HLA-G, expressed in human trophoblasts. Science 248:220, 1990. McMaster MT, Librach CL, Zhou Y, Lim KH, Janatpour MJ, DeMars R, Kovats S, Damsky C, Fisher SJ: Human placental HLA-G expression is restricted to differentiated cytotrophoblasts. J Immunol 154:3771, 1995. Hammer A, Hutter H, Blaschitz A, Mahnert W, Hartmann M, Uchanska-Ziegler B, Ziegler A, Dohr G: Amnion epithelial cells, in contrast to trophoblast cells, express all classical HLA class I molecules together with HLA-G. Am J Reprod Immunol 37:161, 1997. Paul P, Cabestre FA, Le Gal FA, Khalil-Daher I, Le Danff C, Schmid M, Mercier S, Avril MF, Dausset J, Guillet JG, Carosella ED: Heterogeneity of HLA-G gene transcription and protein expression in malignant melanoma biopsies. Cancer Res 59:1954, 1999. Crisa L, McMaster MT, Ishii JK, Fisher SJ, Salomon DR: Identification of a thymic epithelial cell subset sharing expression of the class Ib HLA-G molecule with fetal trophoblasts. J Exp Med 186:289, 1997. Yang Y, Chu W, Geraghty DE, Hunt JS: Expression of HLA-G in human mononuclear phagocytes and selective induction by IFN-gamma. J Immunol 156:4224, 1996. Moreau P, Adrian-Cabestre F, Menier C, Guiard V, Gourand L, Dausset J, Carosella ED, Paul P: IL-10 selectively induces HLA-G expression in human trophoblasts and monocytes. Int Immunol 11:803, 1999. Moreau P, Lefebvre S, Gourand L, Dausset J, Carosella ED, Paul P: Specific binding of nuclear factors to the HLA-G gene promoter correlates with a lack of HLA-G transcripts in first trimester human fetal liver. Hum Immunol 59:751, 1998. Teyssier M, Bensussan A, Kirszenbaum M, Moreau P, Gluckman E, Dausset J, Carosella E: Natural killer cells are the unique lymphocyte cell subset which do not express HLA-G. Nat Immun 14:262, 1995. Onno M, Amiot L, Bertho N, Drenou B, Fauchet R: CpG methylation patterns in the 5⬘ part of the nonclassical HLA-G gene in peripheral blood CD34⫹ cells and CD2⫹ lymphocytes. Tissue Antigens 49:356, 1997. Schmidt CM, Ehlenfeldt RG, Athanasiou MC, Duvick LA, Heinrichs H, David CS, Orr HT: Extraembryonic expression of the human MHC class I gene HLA-G in transgenic mice. Evidence for a positive regulatory region located 1 kilobase 5⬘ to the start site of transcription. J Immunol 151:2633, 1993.
1137
15. Moreau P, Paul P, Gourand L, Prost S, Dausset J, Carosella E, Kirszenbaum M: HLA-G gene transcriptional regulation in trophoblasts and blood cells: differential binding of nuclear factors to a regulatory element located 1.1 kb from exon 1. Hum Immunol 52:41, 1997. 16. Gobin SJ, Keijsers V, van Zutphen M, van den Elsen PJ: The role of enhancer A in the locus-specific transactivation of classical and nonclassical HLA class I genes by nuclear factor kappa B. J Immunol 161:2276, 1998. 17. van den Elsen PJ, Peijnenburg A, van Eggermond MC, Gobin SJ: Shared regulatory elements in the promoters of MHC class I and class II genes. Immunol Today 19:308, 1998. 18. Mach B, Steimle V, Martinez-Soria E, Reith W: Regulation of MHC class II genes: lessons from a disease. Annu Rev Immunol 14:301, 1996. 19. Louis-Plence P, Moreno CS, Boss JM: Formation of a regulatory factor X/X2 box-binding protein/nuclear factor-Y multiprotein complex on the conserved regulatory regions of HLA class II genes. J Immunol 159:3899, 1997. 20. Nagarajan UM, Louis-Plence P, DeSandro A, Nilsen R, Bushey A, Boss JM: RFX-B is the gene responsible for the most common cause of the bare lymphocyte syndrome, an MHC class II immunodeficiency. Immunity 10:153, 1999. 21. Mach B: Perspectives in immunology. Regulating the regulator. Science 285:1367, 1999. 22. Gobin SJ, Peijnenburg A, van Eggermond M, van Zutphen M, van den Berg R, van den Elsen PJ: The RFX complex is crucial for the constitutive and CIITA-mediated transactivation of MHC class I and beta2-microglobulin genes. Immunity 9:531, 1998. 23. Gobin SJ, van den Elsen PJ: The regulation of HLA class I expression: is HLA-G the odd one out? Semin Cancer Biol 9:55, 1999. 24. Briggs MR, Kadonaga JT, Bell SP, Tjian R: Purification and biochemical characterization of the promoter-specific transcription factor, Sp1. Science 234:47, 1986. 25. Jabrane-Ferrat N, Fontes JD, Boss JM, Peterlin BM: Complex architecture of major histocompatibility complex class II promoters: reiterated motifs and conserved protein-protein interactions. Mol Cell Biol 16:4683, 1996. 26. Courey AJ, Tjian R: Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55:887, 1988. 27. Pascal E, Tjian R: Different activation domains of Sp1 govern formation of multimers and mediate transcriptional synergism. Genes Dev 5:1646, 1991. 28. Gobin SJ, van Zutphen M, Woltman AM, van den Elsen PJ: Transactivation of classical and nonclassical HLA class I genes through the IFN-stimulated response element. J Immunol 163:1428, 1999.