- Email: [email protected]
The Xenobiotic Transporter ABCG2 Plays a Novel Role in Differentiation of Trophoblast-like BeWo Cells
Placenta 28, Supplement A, Trophoblast Research, Vol. 21 (2007) S116eS120
The Xenobiotic Transporter ABCG2 Plays a Novel Role in Differentiation of Trophoblast-like BeWo Cells D.A. Evseenko a,*, J.W. Paxton b, J.A. Keelan a,b b
a Liggins Institute, University of Auckland, Private Bag 92019, Auckland 1003, New Zealand Department of Pharmacology and Clinical Pharmacology, Faculty of Medical and Health Science, University of Auckland, Private Bag 92019, Auckland, New Zealand
Accepted 11 December 2006
Abstract Trophoblast cells undergo loss of plasma membrane lipid asymmetry during cell fusion without further progression to terminal phases of apoptosis. The nature of the anti-apoptotic mechanisms providing cell survival during this process is unknown. Using a BeWo cell model, we explored the role of the xenobiotic/lipid transporter ABCG2 in promoting cell survival during forskolin-induced differentiation. Suppression of ABCG2 expression by siRNA led to a marked increase in phosphatidylserine externalisation followed by accumulation of ceramides and increased apoptosis. Expression of markers of syncytial formation (b-hCG and HERV-W) was decreased by ABCG2 silencing, although fusion was unaffected. These findings suggest that ABCG2 protects cells during the period of transient membrane instability associated with cell differentiation and fusion, highlighting a novel, previously unrecognised role of ABCG2 as a survival factor during the formation of the placental syncytium. Ó 2007 Published by IFPA and Elsevier Ltd. Keywords: ABCG2; Trophoblast; Differentiation; Apoptosis; Ceramides; BeWo
1. Introduction The defining cell type of the human placenta is the trophoblast, a highly specific type of epithelium that covers the external surface of placental villous tree as a multinucleated syncytium, directly interfacing with maternal blood. Syncytialisation, involving differentiation/fusion of cytotrophoblasts and reorganisation of cytoskeletal proteins and plasma membrane lipids [1], a unique process employing aspects of the apoptotic pathway [2e5]. Two important events of trophoblast differentiation have been defined, activation of caspase-8 followed and externalisation of phosphatidylserine (PS) from the inner to outer leaflet of the plasma membrane. Blockade of caspase-8 activity or inhibition PS externalisation prevents syncytialisation [3,6]. Activation of caspase-8 by a variety of
* Corresponding author. Tel.: þ64 9 3737599x82016; fax: þ64 9 3737497. E-mail address: [email protected] (D.A. Evseenko). 0143-4004/$ - see front matter Ó 2007 Published by IFPA and Elsevier Ltd. doi:10.1016/j.placenta.2006.12.003
stimuli has been shown to result in the generation of ceramide [7,8], a ubiquitous sphingolipid mediator implicated in regulation of cell death and differentiation in various cell types, including trophoblast [7e9]. Despite activation of these initial steps of apoptosis, trophoblasts appear to possess a protective mechanism preventing progression of apoptosis to a terminal phase [5], although the nature of this protective mechanism is unknown. We have recently shown that expression of ABCG2 (also known as BCRP, breast cancer resistance protein), a xenobiotic/lipid transporter and member of the ATP binding cassette family, is dramatically up-regulated during trophoblast fusion [10] and that ABCG2 protects the primary trophoblasts from cytokine and ceramide-induced apoptosis [11]. We therefore hypothesised that ABCG2 plays a role as a survival factor, protecting trophoblast from progression of apoptosis during the period of caspase activation and loss of the plasma membrane asymmetry associated with early phases of cell differentiation.
D.A. Evseenko et al. / Placenta 28, Supplement A, Trophoblast Research, Vol. 21 (2007) S116eS120
2. Materials and methods BeWo cells were obtained from American Type Culture Collection (Manassas, USA). DMEM, Ham’s F-12, GlutaMAXÔ, fetal calf serum (FCS), and Lipofectamine RNAiMAX were from Invitrogen (Carlsbad, USA). Cy3-labelled goat anti-mouse antibody was from Amersham Pharmacia Biotech (Buckinghamshire, UK), anti-ABCG2 (clone BXP21) antibodies from Chemicon (Temecula, USA) and monoclonal anti-b actin, peroxidase-conjugated sheep anti-mouse antibody, Hoechst 33258, mitoxantrone, Sigma FastÔ 3,3-diaminobenzidine tablet set from SigmaeAldrich (St. Louis, USA). Mouse monoclonal anti-phosphatidylserine and anti-desmaplakin antibodies were from Abcam (Cambridge, USA), forskolin from Alexis Biochemicals (Lausen, Switzerland) and M30 antibody was from Roche Diagnostics (Mannheim, Germany). General chemicals (analytical grade) were obtained from Serva (Heidelberg, Germany), Scharlay Chemie (Barcelona, Spain), or AppliChem (Darmstadt, Germany).
S117
2.5. Transient transfection using ABCG2 antisense oligonucleotides Three different StealthÔ ABCG2 siRNA duplexes, designed and synthesised by Invitrogen (San Diego, USA) were used for transient inhibition of ABCG2 in BeWo cells. Sequences were as follows (50 e30 ): AUAACCAGCUG AUUCAAAGUAUCCC, UAAUGAUGUCCAAGAAGAAGUCUGC, UAAG AUGACACUCUGUAGUAUCCGC. BeWo cells (10 000 cells/well in 96 well plates, 50 000 cells/well in 24 well plates) were transfected using Lipofectamine RNAiMAX transfection reagent according to the reverse transfection protocol provided by the manufacturer. All StealthÔ ABCG2 siRNA duplexes were used as a cocktail in equal proportions with 20 nM final concentration, shown to be non-toxic in the pilot experiments. For the control of offtarget effect cells were transfected with equivalent amount of StealthÔ scrambled siRNA duplexes with the same GC content.
2.6. Lipid analysis by mass spectrometry 2.1. Cell culture BeWo cells, passages 5e10, were cultured in 1:1 DMEM/F-12 with 10% FCS and GlutaMAXÔ. To induce fusion BeWo cells were exposed to 10 mM of forskolin in 1:1 DMEM/F-12K with 10% FCS and GlutaMAXÔ and incubated for up to 72 h, after which approximately 60e70% of cells had fused into a multinucleated syncytium. Syncytium formation was assessed by the quantitation of the distribution of desmoplakin and nuclei in cells after fixation and immunostaining as previously described [12].
Analysis/quantitation of ceramide species and total cholesterol was performed on a Thermo Finnigan TSQ Quantum Ultra AM mass spectrometer operating in a multiple reaction monitoring, positive ionization mode. Ceramides and cholesterol were extracted from the cells using a previously described protocol [15]. Each sample was injected into a Surveyor Autosampler & Surveyor MS pump/TSQ Quantum Ultra AM liquid chromatography/mass spectrometry system, and eluted from Phenomenex Luna 3m C18 (2) 50 3 mm column with a 100% methanol mobile phase system. Peaks corresponding to the target analytes and internal standards were identified, collected, and processed using the Xcalibur software system.
2.2. Quantitative real-time PCR Total RNA extraction, first-strand cDNA synthesis and PCR amplification were carried out using standard technique as previously described [10]. BCRP/ ABCG2 PCR primers were designed by SuperArray (Frederick, USA), (forward: GGATGAGCCTACAACTGGCTT, reverse: CTTCCTGAGGCCAATA AGGTG). The following PCR primers were used for amplification of human endogenous retrovirus W Env (HERV-W env), forward: CGGACATCCA AAGTGATACATCCT; reverse: TGATGTATCCAAGACTCCACTCCA [13], and the b-subunit of chorionic gonadotropin (b-hCG), forward: CTACTG CCCCACCATGACCC; reverse: TGGACTCGAAGCGCACATC [14]).
2.7. Statistics All studies were performed three times for ceramide measurements and at least three times for apoptosis, caspase-8, PS externalisation and syncytialisation assays. Descriptive statistics were performed for each data set. Graphs were plotted and data transformed using Microsoft Excel 2003 (San Diego, USA). Statistical analysis was performed using SigmaStat software from Systat Software Inc. (Richmond, USA). Ceramide data was assessed by one-way ANOVA with repeated measures. For analysis of apoptotic data, one-way ANOVA was applied, followed by StudenteNewmaneKeuls test. A P value < 0.05 was considered to be significant.
2.3. Immunoblotting
3. Results Total BeWo cell lysates were prepared as previously described and proteins separated on polyacrylamide gels [10]. Membranes were incubated with anti-ABCG2 (1:500) monoclonal antibody followed by horseradish peroxidase-conjugated goat anti-mouse antibody and visualised by enhanced chemiluminescence. Band intensity was quantitated by densitometry using Quantity One software Bio-Rad Laboratories (Auckland, NZ).
2.4. Assessment of cell death Detection of cytokeratin 18 neo-epitope, a product of caspase 3/7 activity used as marker of execution stages of apoptosis [3], was performed using M30 immunoperoxidase staining visualised with diaminebenzidine. Apoptotic cell death (chromatin condensation and nuclear fragmentation) was measured by fluorescent microscopic analysis of cell DNA-morphology after staining with Hoechst 33258 with an Olympus IX 71 inverted fluorescence microscope (Olympus, Tokyo, Japan). Appearance of phosphatidyserine (PS) on the cell surface was detected using anti-PS antibodies followed by visualisation with Cy3-labelled secondary antibodies. Quantitative analysis was carried out using ImageJ 1.36b software from National Institutes of Health (USA) and expressed in normalised fluorescent units (area of positive PS staining normalised to a total area of nuclei in the same field). Caspase-8 activity was measured using Caspase-Glo 8 Assay from Promega Corporation (Madison, USA) according to the manufacturer’s protocol.
To identify whether ABCG2 plays a role in the process of BeWo cell differentiation, ABCG2 expression was transiently silenced in BeWo cells with a cocktail three of StealthÔ ABCG2 siRNA. Silencing led to more than 75% reduction of ABCG2 mRNA and protein levels in BeWo cells 48 h after transfection and was sustained for at least for 3 days. Control transfections had little effect on ABCG2 expression. Silencing of ABCG2 resulted in a dramatic increase in sensitivity to the cytotoxic drug mitoxantrone, a high affinity ABCG2 substrate, leading to 5-fold increase in cell death as determined by the percentage of cells with positive M30 staining (control siRNA: vehicle 0.71 0.29%, mitoxantrone 3.93 1.3%; ABCG2 siRNA: vehicle 2.08 1.4%, mitoxantrone 23.67 5.03%). BeWo cells transfected with either control or ABCG2 siRNA were exposed to forskolin 48 h after transfection to initiate cell differentiation and fusion, and expression of HERVW and b-hCG genes were measured at different time-points to assess progression of cell differentiation. In control cells,
S118
D.A. Evseenko et al. / Placenta 28, Supplement A, Trophoblast Research, Vol. 21 (2007) S116eS120
with silenced ABCG2, PS externalisation was detected much earlier, with the area of positive staining markedly being increased after 12 h reaching a maximal difference (w2-fold higher) at 72 h of forskolin treatment (Fig. 2F; Fig. 3A). Measurement of endogenous C16, 18, C20 and C24 ceramide levels by tandem HPLCeMS demonstrated that ABCG2 silencing resulted in significantly higher levels of ceramide accumulation during the differentiation/fusion process. This difference was minimal in non-differentiated cells, but increased markedly by w100% (P < 0.05) at 36 and 72 h differentiation (Fig. 3B) in parallel with increased levels of apoptosis. Analysis of caspase-8 activity showed increases in activity in both control and ABCG2-silenced cells at 4 h after forskolin stimulation, reaching maximal levels of activity at 24 h of incubation with little changes thereafter (data not shown), with no significant differences between controls and silenced cells. 4. Discussion
Fig. 1. Relative expression (mean SD, n ¼ 4) of HERV-W (A) and b-HCG (B) mRNA in BeWo cells during forskolin-induced differentiation. For quantitative analysis of gene expression, the comparative Ct method for relative quantification (2DDCt) was applied. Expression of the target genes was normalised to the level of 18s rRNA. For statistical analysis one-way ANOVA for repeated measurements was used. *P < 0.05.
levels of HERV-W (Fig. 1A) and b-hCG (Fig. 1B) mRNA increased throughout the differentiation period, whereas in cells with silenced ABCG2, expression of both genes increased only during the first 36 h, remaining steady during 36e48 h, and was markedly lower than in control cells after 72 h differentiation. Morphological and immunocytochemical analysis, carried out on the same cells, showed that fusion and syncytialisation were not reduced by ABCG2 silencing (data not shown). Silencing of ABCG2 led to a w2-fold increase in number of apoptotic cells during fusion compared to control cells. This difference progressed during differentiation, being most notable after 72 h post-forskolin addition (Fig. 2AeD), as determined by M30 staining of apoptotic cells (control siRNA 4.54 0.68%, ABCG2 siRNA 7.31 0.74%, P < 0.05) and detection of chromatin condensation using Hoechst 33358 staining (control siRNA 2.98 0.77%, ABCG2 siRNA 6.18 1.11, P < 0.05). To investigate whether silencing of ABCG2 affects externalisation of PS, BeWo cells were stained with anti-PS antibody at various stages of differentiation. Quantitation of staining revealed that control cells showed only modest increase in PS externalisation after 36 and 72 h of differentiation (Fig. 2E; Fig. 3A). Importantly, positive PS staining was absent or minimal in cells that had already syncytialised. In contrast, in cells
The present study is the first to implicate the xenobiotic/ lipid transporter ABCG2 as a survival factor during the process of trophoblast fusion and differentiation. We have shown that BeWo cells with silenced ABCG2 expression demonstrate significantly increased PS externalisation, have higher rates of apoptosis and accumulate markedly higher levels of the ceramides during forskolin-induced differentiation. Silencing of ABCG2 also reduced terminal b-hCG and HERV-W expression suggestive of profound changes in differentiation dynamics. Human placenta and BeWo cells express extremely high levels of ABCG2, but its functional significance remains speculative [10,16]. Although ABCG2 regulates drug transport across biological barriers, including the placental syncytium, several recent studies have suggested alternative functions for this transporter. Krishnamurthy et al. (2004) demonstrated that ABCG2 protects blood stem cells from hypoxic injury [17]. More recently it has been shown that transgenic mice lacking ABCG2 and another major ABC transporter (multidrug resistance gene product 1) have a reduction in stem cells subpopulation in different organs [18], suggesting that these ABC transporters might be implicated in the maintenance of general regeneration potential. In accordance with these studies, our findings indicate the potential importance of the ABCG2 for the regeneration of the placental syncytial epithelium. Fusion of trophoblasts is associated with activation of caspase system and the subsequent alteration of the plasma membrane’s highly asymmetric architecture. During this process PS, located in the inner leaflet of the membrane in non-stress conditions, is translocated in the outer leaflet, very similar to the membrane changes at early stages of apoptosis in different cell types [19]. How trophoblasts terminate the apoptotic progression and restore membrane architecture remains unclear. It is important, though, that in contrast to cells undergoing apoptosis, differentiating trophoblasts loose membrane asymmetry only during the transient period associated with cell fusion without terminal progression of the apoptotic cascade.
D.A. Evseenko et al. / Placenta 28, Supplement A, Trophoblast Research, Vol. 21 (2007) S116eS120
S119
Fig. 2. Silencing of ABCG2 in BeWo cells by siRNA duplexes significantly increased levels of apoptosis during BeWo cell fusion after 72 h induction with 10 mM of forskolin. (A), (C), (E) and (G). Control BeWo cells transfected with scrambled siRNA. (B), (D), (F) and (H). BeWo cells transfected with ABCG2 siRNA. (A) and (B) Staining with M30 antibody. Nuclei of the cells additionally stained with haematoxylin. Arrows show apoptotic nuclei. (C) and (D) Hoechst 33358 staining of the nuclei. Arrows show apoptotic nuclei. (E) and (F) Externalisation of PS to outer leaflet of the plasma membrane visualised with primary anti-PS antibody and secondary antibody labelled with Cy3 red fluorescent marker. (G) and (H) Phase contrast images of the cells shown with PS staining on previous slides. Magnification 400 for images (A)e(D), 200 for images (E)e(H).
The precise mechanism whereby ABCG2 acts to prevent apoptotic progression is unknown, but it may be associated with reconstitution of plasma membrane lipid architecture following fusion. Several ABC transporters, including the members
of ABCG subfamily, have been implicated in the trafficking of structural lipids within the plasma membrane [20,21], indirectly supporting the possibility that they may play an important role in the differentiation process.
S120
D.A. Evseenko et al. / Placenta 28, Supplement A, Trophoblast Research, Vol. 21 (2007) S116eS120
Fig. 3. Levels of phosphatidylserine externalisation and ceramide accumulation in BeWo cells 12, 36 and 72 h after fusion induction by 10 mM of forskolin. (A) Quantitative analysis of PS externalisation was carried out using ImageJ 1.36b software from National Institutes of Health (USA) and expressed in normalised fluorescent units (area of positive PS staining normalised to a total area of nuclei in the same field). StudenteNewmaneKeuls test was used for statistical analysis, carried out using pooled data of all three experiments. *P < 0.05 ABCG2 siRNA vs. control siRNA; #P < 0.05 vs. vehicle control. (B) Accumulation of C16, C18, C20 and C24 ceramide in BeWo cells during forskolin-induced differentiation at 12, 36 and 72 h of incubation. Levels of ceramides were measured by tandem MSeHPLC and results shown as a sum of all four ceramides normalised to cholesterol levels in the same samples. Cholesterol content was not affected by the differentiation process. The experiment was repeated three times and data pooled (mean SD, n ¼ 3). One-way ANOVA for repeated measurements was used for statistical analysis. P < 0.05 was considered as statistically significant.
In summary, the present study suggests the possibility of a novel, previously unrecognised role of ABCG2 as a differentiation/survival factor in the placenta. References [1] Das M, Xu B, Lin L, Chakrabarti S, Shivaswamy V, Rote NS. Phosphatidylserine efflux and intercellular fusion in a BeWo model of human villous cytotrophoblast. Placenta 2004;25:396e407.
[2] Yusuf K, Smith SD, Sadovsky Y, Nelson DM. Trophoblast differentiation modulates the activity of caspases in primary cultures of term human trophoblasts. Pediatr Res 2002;52:411e5. [3] Black S, Kadyrov M, Kaufmann P, Ugele B, Emans N, Huppertz B. Syncytial fusion of human trophoblast depends on caspase 8. Cell Death Differ 2004;11:90e8. [4] Huppertz B, Kingdom JC. Apoptosis in the trophoblast e role of apoptosis in placental morphogenesis. J Soc Gynecol Investig 2004;11: 353e62. [5] Straszewski-Chavez SL, Abrahams VM, Mor G. The role of apoptosis in the regulation of trophoblast survival and differentiation during pregnancy. Endocr Rev 2005;26:877e97. [6] Leslie EM, Deeley RG, Cole SP. Multidrug resistance proteins: role of Pglycoprotein, MRP1, MRP2, and BCRP (ABCG2) in tissue defense. Toxicol Appl Pharmacol 2005;204:216e37. [7] Rotolo JA, Zhang J, Donepudi M, Lee H, Fuks Z, Kolesnick R. Caspasedependent and -independent activation of acid sphingomyelinase signaling. J Biol Chem 2005;280:26425e34. [8] Pettus BJ, Chalfant CE, Hannun YA. Ceramide in apoptosis: an overview and current perspectives. Biochim Biophys Acta 2002;1585:114e25. [9] Payne SG, Brindley DN, Guilbert LJ. Epidermal growth factor inhibits ceramide-induced apoptosis and lowers ceramide levels in primary placental trophoblasts. J Cell Physiol 1999;180:263e70. [10] Evseenko DA, Paxton JW, Keelan JA. ABC drug transporter expression and functional activity in trophoblast-like cell lines and differentiating primary trophoblast. Am J Physiol Regul Integr Comp Physiol 2006;290. [11] Keelan JA, Evseenko DA, Paxton JW. Cytokine-induced trophoblast apoptosis involves down regulation of ABC transporter proteins. Placenta 2006;27(9e10): P34. [12] Frendo JL, Olivier D, Cheynet V, Blond JL, Bouton O, Vidaud M, et al. Direct involvement of HERV-W Env glycoprotein in human trophoblast cell fusion and differentiation. Mol Cell Biol 2003;23:3566e74. [13] Malassine A, Handschuh K, Tsatsaris V, Gerbaud P, Cheynet V, Oriol G, et al. Expression of HERV-W Env glycoprotein (syncytin) in the extravillous trophoblast of first trimester human placenta. Placenta 2005;26: 556e62. [14] Ng EK, Tsui NB, Lau TK, Leung TN, Chiu RW, Panesar NS, et al. mRNA of placental origin is readily detectable in maternal plasma. Proc Natl Acad Sci U S A 2003;100:4748e53. [15] Sullards MC, Merrill Jr AH. Analysis of sphingosine 1-phosphate, ceramides, and other bioactive sphingolipids by high-performance liquid chromatographyetandem mass spectrometry. Science’s Stke: Signal Transduc Knowl Environ 2001;2001. Pl1. [16] Evseenko DA, Paxton JW, Keelan JA. Active transport across the human placenta: impact on drug efficacy and toxicity. Expert Opin Drug Metab Toxicol 2006;2:51e69. [17] Krishnamurthy P, Ross DD, Nakanishi T, Bailey-Dell K, Zhou S, Mercer KE, et al. The stem cell marker Bcrp/ABCG2 enhances hypoxic cell survival through interactions with heme. J Biol Chem 2004;279:24218e25. [18] Jonker JW, Freeman J, Bolscher E, Musters S, Alvi AJ, Titley I, et al. Contribution of the ABC transporters Bcrp1 and Mdr1a/1b to the side population phenotype in mammary gland and bone marrow of mice. Stem Cells 2006;1059e65. [19] Martin SJ, Reutelingsperger CP, McGahon AJ, Rader JA, van Schie RC, LaFace DM, et al. Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl. J Eukaryot Microbiol 1995;182:1545e56. [20] Daleke DL. Regulation of transbilayer plasma membrane phospholipid asymmetry. J Lipid Res 2003;44:233e42. [21] van Meer G, Halter D, Sprong H, Somerharju P, Egmond MR. ABC lipid transporters: extruders, flippases, or flopless activators? FEBS Lett 2006;580:1171e7.
The Xenobiotic Transporter ABCG2 Plays a Novel Role in Differentiation of Trophoblast-like BeWo Cells D.A. Evseenko a,*, J.W. Paxton b, J.A. Keelan a,b b
a Liggins Institute, University of Auckland, Private Bag 92019, Auckland 1003, New Zealand Department of Pharmacology and Clinical Pharmacology, Faculty of Medical and Health Science, University of Auckland, Private Bag 92019, Auckland, New Zealand
Accepted 11 December 2006
Abstract Trophoblast cells undergo loss of plasma membrane lipid asymmetry during cell fusion without further progression to terminal phases of apoptosis. The nature of the anti-apoptotic mechanisms providing cell survival during this process is unknown. Using a BeWo cell model, we explored the role of the xenobiotic/lipid transporter ABCG2 in promoting cell survival during forskolin-induced differentiation. Suppression of ABCG2 expression by siRNA led to a marked increase in phosphatidylserine externalisation followed by accumulation of ceramides and increased apoptosis. Expression of markers of syncytial formation (b-hCG and HERV-W) was decreased by ABCG2 silencing, although fusion was unaffected. These findings suggest that ABCG2 protects cells during the period of transient membrane instability associated with cell differentiation and fusion, highlighting a novel, previously unrecognised role of ABCG2 as a survival factor during the formation of the placental syncytium. Ó 2007 Published by IFPA and Elsevier Ltd. Keywords: ABCG2; Trophoblast; Differentiation; Apoptosis; Ceramides; BeWo
1. Introduction The defining cell type of the human placenta is the trophoblast, a highly specific type of epithelium that covers the external surface of placental villous tree as a multinucleated syncytium, directly interfacing with maternal blood. Syncytialisation, involving differentiation/fusion of cytotrophoblasts and reorganisation of cytoskeletal proteins and plasma membrane lipids [1], a unique process employing aspects of the apoptotic pathway [2e5]. Two important events of trophoblast differentiation have been defined, activation of caspase-8 followed and externalisation of phosphatidylserine (PS) from the inner to outer leaflet of the plasma membrane. Blockade of caspase-8 activity or inhibition PS externalisation prevents syncytialisation [3,6]. Activation of caspase-8 by a variety of
* Corresponding author. Tel.: þ64 9 3737599x82016; fax: þ64 9 3737497. E-mail address: [email protected] (D.A. Evseenko). 0143-4004/$ - see front matter Ó 2007 Published by IFPA and Elsevier Ltd. doi:10.1016/j.placenta.2006.12.003
stimuli has been shown to result in the generation of ceramide [7,8], a ubiquitous sphingolipid mediator implicated in regulation of cell death and differentiation in various cell types, including trophoblast [7e9]. Despite activation of these initial steps of apoptosis, trophoblasts appear to possess a protective mechanism preventing progression of apoptosis to a terminal phase [5], although the nature of this protective mechanism is unknown. We have recently shown that expression of ABCG2 (also known as BCRP, breast cancer resistance protein), a xenobiotic/lipid transporter and member of the ATP binding cassette family, is dramatically up-regulated during trophoblast fusion [10] and that ABCG2 protects the primary trophoblasts from cytokine and ceramide-induced apoptosis [11]. We therefore hypothesised that ABCG2 plays a role as a survival factor, protecting trophoblast from progression of apoptosis during the period of caspase activation and loss of the plasma membrane asymmetry associated with early phases of cell differentiation.
D.A. Evseenko et al. / Placenta 28, Supplement A, Trophoblast Research, Vol. 21 (2007) S116eS120
2. Materials and methods BeWo cells were obtained from American Type Culture Collection (Manassas, USA). DMEM, Ham’s F-12, GlutaMAXÔ, fetal calf serum (FCS), and Lipofectamine RNAiMAX were from Invitrogen (Carlsbad, USA). Cy3-labelled goat anti-mouse antibody was from Amersham Pharmacia Biotech (Buckinghamshire, UK), anti-ABCG2 (clone BXP21) antibodies from Chemicon (Temecula, USA) and monoclonal anti-b actin, peroxidase-conjugated sheep anti-mouse antibody, Hoechst 33258, mitoxantrone, Sigma FastÔ 3,3-diaminobenzidine tablet set from SigmaeAldrich (St. Louis, USA). Mouse monoclonal anti-phosphatidylserine and anti-desmaplakin antibodies were from Abcam (Cambridge, USA), forskolin from Alexis Biochemicals (Lausen, Switzerland) and M30 antibody was from Roche Diagnostics (Mannheim, Germany). General chemicals (analytical grade) were obtained from Serva (Heidelberg, Germany), Scharlay Chemie (Barcelona, Spain), or AppliChem (Darmstadt, Germany).
S117
2.5. Transient transfection using ABCG2 antisense oligonucleotides Three different StealthÔ ABCG2 siRNA duplexes, designed and synthesised by Invitrogen (San Diego, USA) were used for transient inhibition of ABCG2 in BeWo cells. Sequences were as follows (50 e30 ): AUAACCAGCUG AUUCAAAGUAUCCC, UAAUGAUGUCCAAGAAGAAGUCUGC, UAAG AUGACACUCUGUAGUAUCCGC. BeWo cells (10 000 cells/well in 96 well plates, 50 000 cells/well in 24 well plates) were transfected using Lipofectamine RNAiMAX transfection reagent according to the reverse transfection protocol provided by the manufacturer. All StealthÔ ABCG2 siRNA duplexes were used as a cocktail in equal proportions with 20 nM final concentration, shown to be non-toxic in the pilot experiments. For the control of offtarget effect cells were transfected with equivalent amount of StealthÔ scrambled siRNA duplexes with the same GC content.
2.6. Lipid analysis by mass spectrometry 2.1. Cell culture BeWo cells, passages 5e10, were cultured in 1:1 DMEM/F-12 with 10% FCS and GlutaMAXÔ. To induce fusion BeWo cells were exposed to 10 mM of forskolin in 1:1 DMEM/F-12K with 10% FCS and GlutaMAXÔ and incubated for up to 72 h, after which approximately 60e70% of cells had fused into a multinucleated syncytium. Syncytium formation was assessed by the quantitation of the distribution of desmoplakin and nuclei in cells after fixation and immunostaining as previously described [12].
Analysis/quantitation of ceramide species and total cholesterol was performed on a Thermo Finnigan TSQ Quantum Ultra AM mass spectrometer operating in a multiple reaction monitoring, positive ionization mode. Ceramides and cholesterol were extracted from the cells using a previously described protocol [15]. Each sample was injected into a Surveyor Autosampler & Surveyor MS pump/TSQ Quantum Ultra AM liquid chromatography/mass spectrometry system, and eluted from Phenomenex Luna 3m C18 (2) 50 3 mm column with a 100% methanol mobile phase system. Peaks corresponding to the target analytes and internal standards were identified, collected, and processed using the Xcalibur software system.
2.2. Quantitative real-time PCR Total RNA extraction, first-strand cDNA synthesis and PCR amplification were carried out using standard technique as previously described [10]. BCRP/ ABCG2 PCR primers were designed by SuperArray (Frederick, USA), (forward: GGATGAGCCTACAACTGGCTT, reverse: CTTCCTGAGGCCAATA AGGTG). The following PCR primers were used for amplification of human endogenous retrovirus W Env (HERV-W env), forward: CGGACATCCA AAGTGATACATCCT; reverse: TGATGTATCCAAGACTCCACTCCA [13], and the b-subunit of chorionic gonadotropin (b-hCG), forward: CTACTG CCCCACCATGACCC; reverse: TGGACTCGAAGCGCACATC [14]).
2.7. Statistics All studies were performed three times for ceramide measurements and at least three times for apoptosis, caspase-8, PS externalisation and syncytialisation assays. Descriptive statistics were performed for each data set. Graphs were plotted and data transformed using Microsoft Excel 2003 (San Diego, USA). Statistical analysis was performed using SigmaStat software from Systat Software Inc. (Richmond, USA). Ceramide data was assessed by one-way ANOVA with repeated measures. For analysis of apoptotic data, one-way ANOVA was applied, followed by StudenteNewmaneKeuls test. A P value < 0.05 was considered to be significant.
2.3. Immunoblotting
3. Results Total BeWo cell lysates were prepared as previously described and proteins separated on polyacrylamide gels [10]. Membranes were incubated with anti-ABCG2 (1:500) monoclonal antibody followed by horseradish peroxidase-conjugated goat anti-mouse antibody and visualised by enhanced chemiluminescence. Band intensity was quantitated by densitometry using Quantity One software Bio-Rad Laboratories (Auckland, NZ).
2.4. Assessment of cell death Detection of cytokeratin 18 neo-epitope, a product of caspase 3/7 activity used as marker of execution stages of apoptosis [3], was performed using M30 immunoperoxidase staining visualised with diaminebenzidine. Apoptotic cell death (chromatin condensation and nuclear fragmentation) was measured by fluorescent microscopic analysis of cell DNA-morphology after staining with Hoechst 33258 with an Olympus IX 71 inverted fluorescence microscope (Olympus, Tokyo, Japan). Appearance of phosphatidyserine (PS) on the cell surface was detected using anti-PS antibodies followed by visualisation with Cy3-labelled secondary antibodies. Quantitative analysis was carried out using ImageJ 1.36b software from National Institutes of Health (USA) and expressed in normalised fluorescent units (area of positive PS staining normalised to a total area of nuclei in the same field). Caspase-8 activity was measured using Caspase-Glo 8 Assay from Promega Corporation (Madison, USA) according to the manufacturer’s protocol.
To identify whether ABCG2 plays a role in the process of BeWo cell differentiation, ABCG2 expression was transiently silenced in BeWo cells with a cocktail three of StealthÔ ABCG2 siRNA. Silencing led to more than 75% reduction of ABCG2 mRNA and protein levels in BeWo cells 48 h after transfection and was sustained for at least for 3 days. Control transfections had little effect on ABCG2 expression. Silencing of ABCG2 resulted in a dramatic increase in sensitivity to the cytotoxic drug mitoxantrone, a high affinity ABCG2 substrate, leading to 5-fold increase in cell death as determined by the percentage of cells with positive M30 staining (control siRNA: vehicle 0.71 0.29%, mitoxantrone 3.93 1.3%; ABCG2 siRNA: vehicle 2.08 1.4%, mitoxantrone 23.67 5.03%). BeWo cells transfected with either control or ABCG2 siRNA were exposed to forskolin 48 h after transfection to initiate cell differentiation and fusion, and expression of HERVW and b-hCG genes were measured at different time-points to assess progression of cell differentiation. In control cells,
S118
D.A. Evseenko et al. / Placenta 28, Supplement A, Trophoblast Research, Vol. 21 (2007) S116eS120
with silenced ABCG2, PS externalisation was detected much earlier, with the area of positive staining markedly being increased after 12 h reaching a maximal difference (w2-fold higher) at 72 h of forskolin treatment (Fig. 2F; Fig. 3A). Measurement of endogenous C16, 18, C20 and C24 ceramide levels by tandem HPLCeMS demonstrated that ABCG2 silencing resulted in significantly higher levels of ceramide accumulation during the differentiation/fusion process. This difference was minimal in non-differentiated cells, but increased markedly by w100% (P < 0.05) at 36 and 72 h differentiation (Fig. 3B) in parallel with increased levels of apoptosis. Analysis of caspase-8 activity showed increases in activity in both control and ABCG2-silenced cells at 4 h after forskolin stimulation, reaching maximal levels of activity at 24 h of incubation with little changes thereafter (data not shown), with no significant differences between controls and silenced cells. 4. Discussion
Fig. 1. Relative expression (mean SD, n ¼ 4) of HERV-W (A) and b-HCG (B) mRNA in BeWo cells during forskolin-induced differentiation. For quantitative analysis of gene expression, the comparative Ct method for relative quantification (2DDCt) was applied. Expression of the target genes was normalised to the level of 18s rRNA. For statistical analysis one-way ANOVA for repeated measurements was used. *P < 0.05.
levels of HERV-W (Fig. 1A) and b-hCG (Fig. 1B) mRNA increased throughout the differentiation period, whereas in cells with silenced ABCG2, expression of both genes increased only during the first 36 h, remaining steady during 36e48 h, and was markedly lower than in control cells after 72 h differentiation. Morphological and immunocytochemical analysis, carried out on the same cells, showed that fusion and syncytialisation were not reduced by ABCG2 silencing (data not shown). Silencing of ABCG2 led to a w2-fold increase in number of apoptotic cells during fusion compared to control cells. This difference progressed during differentiation, being most notable after 72 h post-forskolin addition (Fig. 2AeD), as determined by M30 staining of apoptotic cells (control siRNA 4.54 0.68%, ABCG2 siRNA 7.31 0.74%, P < 0.05) and detection of chromatin condensation using Hoechst 33358 staining (control siRNA 2.98 0.77%, ABCG2 siRNA 6.18 1.11, P < 0.05). To investigate whether silencing of ABCG2 affects externalisation of PS, BeWo cells were stained with anti-PS antibody at various stages of differentiation. Quantitation of staining revealed that control cells showed only modest increase in PS externalisation after 36 and 72 h of differentiation (Fig. 2E; Fig. 3A). Importantly, positive PS staining was absent or minimal in cells that had already syncytialised. In contrast, in cells
The present study is the first to implicate the xenobiotic/ lipid transporter ABCG2 as a survival factor during the process of trophoblast fusion and differentiation. We have shown that BeWo cells with silenced ABCG2 expression demonstrate significantly increased PS externalisation, have higher rates of apoptosis and accumulate markedly higher levels of the ceramides during forskolin-induced differentiation. Silencing of ABCG2 also reduced terminal b-hCG and HERV-W expression suggestive of profound changes in differentiation dynamics. Human placenta and BeWo cells express extremely high levels of ABCG2, but its functional significance remains speculative [10,16]. Although ABCG2 regulates drug transport across biological barriers, including the placental syncytium, several recent studies have suggested alternative functions for this transporter. Krishnamurthy et al. (2004) demonstrated that ABCG2 protects blood stem cells from hypoxic injury [17]. More recently it has been shown that transgenic mice lacking ABCG2 and another major ABC transporter (multidrug resistance gene product 1) have a reduction in stem cells subpopulation in different organs [18], suggesting that these ABC transporters might be implicated in the maintenance of general regeneration potential. In accordance with these studies, our findings indicate the potential importance of the ABCG2 for the regeneration of the placental syncytial epithelium. Fusion of trophoblasts is associated with activation of caspase system and the subsequent alteration of the plasma membrane’s highly asymmetric architecture. During this process PS, located in the inner leaflet of the membrane in non-stress conditions, is translocated in the outer leaflet, very similar to the membrane changes at early stages of apoptosis in different cell types [19]. How trophoblasts terminate the apoptotic progression and restore membrane architecture remains unclear. It is important, though, that in contrast to cells undergoing apoptosis, differentiating trophoblasts loose membrane asymmetry only during the transient period associated with cell fusion without terminal progression of the apoptotic cascade.
D.A. Evseenko et al. / Placenta 28, Supplement A, Trophoblast Research, Vol. 21 (2007) S116eS120
S119
Fig. 2. Silencing of ABCG2 in BeWo cells by siRNA duplexes significantly increased levels of apoptosis during BeWo cell fusion after 72 h induction with 10 mM of forskolin. (A), (C), (E) and (G). Control BeWo cells transfected with scrambled siRNA. (B), (D), (F) and (H). BeWo cells transfected with ABCG2 siRNA. (A) and (B) Staining with M30 antibody. Nuclei of the cells additionally stained with haematoxylin. Arrows show apoptotic nuclei. (C) and (D) Hoechst 33358 staining of the nuclei. Arrows show apoptotic nuclei. (E) and (F) Externalisation of PS to outer leaflet of the plasma membrane visualised with primary anti-PS antibody and secondary antibody labelled with Cy3 red fluorescent marker. (G) and (H) Phase contrast images of the cells shown with PS staining on previous slides. Magnification 400 for images (A)e(D), 200 for images (E)e(H).
The precise mechanism whereby ABCG2 acts to prevent apoptotic progression is unknown, but it may be associated with reconstitution of plasma membrane lipid architecture following fusion. Several ABC transporters, including the members
of ABCG subfamily, have been implicated in the trafficking of structural lipids within the plasma membrane [20,21], indirectly supporting the possibility that they may play an important role in the differentiation process.
S120
D.A. Evseenko et al. / Placenta 28, Supplement A, Trophoblast Research, Vol. 21 (2007) S116eS120
Fig. 3. Levels of phosphatidylserine externalisation and ceramide accumulation in BeWo cells 12, 36 and 72 h after fusion induction by 10 mM of forskolin. (A) Quantitative analysis of PS externalisation was carried out using ImageJ 1.36b software from National Institutes of Health (USA) and expressed in normalised fluorescent units (area of positive PS staining normalised to a total area of nuclei in the same field). StudenteNewmaneKeuls test was used for statistical analysis, carried out using pooled data of all three experiments. *P < 0.05 ABCG2 siRNA vs. control siRNA; #P < 0.05 vs. vehicle control. (B) Accumulation of C16, C18, C20 and C24 ceramide in BeWo cells during forskolin-induced differentiation at 12, 36 and 72 h of incubation. Levels of ceramides were measured by tandem MSeHPLC and results shown as a sum of all four ceramides normalised to cholesterol levels in the same samples. Cholesterol content was not affected by the differentiation process. The experiment was repeated three times and data pooled (mean SD, n ¼ 3). One-way ANOVA for repeated measurements was used for statistical analysis. P < 0.05 was considered as statistically significant.
In summary, the present study suggests the possibility of a novel, previously unrecognised role of ABCG2 as a differentiation/survival factor in the placenta. References [1] Das M, Xu B, Lin L, Chakrabarti S, Shivaswamy V, Rote NS. Phosphatidylserine efflux and intercellular fusion in a BeWo model of human villous cytotrophoblast. Placenta 2004;25:396e407.
[2] Yusuf K, Smith SD, Sadovsky Y, Nelson DM. Trophoblast differentiation modulates the activity of caspases in primary cultures of term human trophoblasts. Pediatr Res 2002;52:411e5. [3] Black S, Kadyrov M, Kaufmann P, Ugele B, Emans N, Huppertz B. Syncytial fusion of human trophoblast depends on caspase 8. Cell Death Differ 2004;11:90e8. [4] Huppertz B, Kingdom JC. Apoptosis in the trophoblast e role of apoptosis in placental morphogenesis. J Soc Gynecol Investig 2004;11: 353e62. [5] Straszewski-Chavez SL, Abrahams VM, Mor G. The role of apoptosis in the regulation of trophoblast survival and differentiation during pregnancy. Endocr Rev 2005;26:877e97. [6] Leslie EM, Deeley RG, Cole SP. Multidrug resistance proteins: role of Pglycoprotein, MRP1, MRP2, and BCRP (ABCG2) in tissue defense. Toxicol Appl Pharmacol 2005;204:216e37. [7] Rotolo JA, Zhang J, Donepudi M, Lee H, Fuks Z, Kolesnick R. Caspasedependent and -independent activation of acid sphingomyelinase signaling. J Biol Chem 2005;280:26425e34. [8] Pettus BJ, Chalfant CE, Hannun YA. Ceramide in apoptosis: an overview and current perspectives. Biochim Biophys Acta 2002;1585:114e25. [9] Payne SG, Brindley DN, Guilbert LJ. Epidermal growth factor inhibits ceramide-induced apoptosis and lowers ceramide levels in primary placental trophoblasts. J Cell Physiol 1999;180:263e70. [10] Evseenko DA, Paxton JW, Keelan JA. ABC drug transporter expression and functional activity in trophoblast-like cell lines and differentiating primary trophoblast. Am J Physiol Regul Integr Comp Physiol 2006;290. [11] Keelan JA, Evseenko DA, Paxton JW. Cytokine-induced trophoblast apoptosis involves down regulation of ABC transporter proteins. Placenta 2006;27(9e10): P34. [12] Frendo JL, Olivier D, Cheynet V, Blond JL, Bouton O, Vidaud M, et al. Direct involvement of HERV-W Env glycoprotein in human trophoblast cell fusion and differentiation. Mol Cell Biol 2003;23:3566e74. [13] Malassine A, Handschuh K, Tsatsaris V, Gerbaud P, Cheynet V, Oriol G, et al. Expression of HERV-W Env glycoprotein (syncytin) in the extravillous trophoblast of first trimester human placenta. Placenta 2005;26: 556e62. [14] Ng EK, Tsui NB, Lau TK, Leung TN, Chiu RW, Panesar NS, et al. mRNA of placental origin is readily detectable in maternal plasma. Proc Natl Acad Sci U S A 2003;100:4748e53. [15] Sullards MC, Merrill Jr AH. Analysis of sphingosine 1-phosphate, ceramides, and other bioactive sphingolipids by high-performance liquid chromatographyetandem mass spectrometry. Science’s Stke: Signal Transduc Knowl Environ 2001;2001. Pl1. [16] Evseenko DA, Paxton JW, Keelan JA. Active transport across the human placenta: impact on drug efficacy and toxicity. Expert Opin Drug Metab Toxicol 2006;2:51e69. [17] Krishnamurthy P, Ross DD, Nakanishi T, Bailey-Dell K, Zhou S, Mercer KE, et al. The stem cell marker Bcrp/ABCG2 enhances hypoxic cell survival through interactions with heme. J Biol Chem 2004;279:24218e25. [18] Jonker JW, Freeman J, Bolscher E, Musters S, Alvi AJ, Titley I, et al. Contribution of the ABC transporters Bcrp1 and Mdr1a/1b to the side population phenotype in mammary gland and bone marrow of mice. Stem Cells 2006;1059e65. [19] Martin SJ, Reutelingsperger CP, McGahon AJ, Rader JA, van Schie RC, LaFace DM, et al. Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl. J Eukaryot Microbiol 1995;182:1545e56. [20] Daleke DL. Regulation of transbilayer plasma membrane phospholipid asymmetry. J Lipid Res 2003;44:233e42. [21] van Meer G, Halter D, Sprong H, Somerharju P, Egmond MR. ABC lipid transporters: extruders, flippases, or flopless activators? FEBS Lett 2006;580:1171e7.