The YrdC protein—a putative ribosome maturation factor

Biochimica et Biophysica Acta 1727 (2005) 87 – 96 http://www.elsevier.com/locate/bba

The YrdC protein—a putative ribosome maturation factor Magdalena Kaczanowska, Monica Ryde´n-Aulin* Department of Genetics, Microbiology and Toxicology (GMT), University of Stockholm, S-106 91 Stockholm, Sweden Received 24 September 2004; received in revised form 17 November 2004; accepted 29 November 2004 Available online 31 December 2004

Abstract Release factor one (RF1) terminates protein synthesis in response to stop codons UAG and UAA. A mutant allele of RF1 causes temperature sensitive growth at 42 8C. We have earlier described the isolation of a suppressor of the temperature sensitive phenotype. The suppressor mutation is a small deletion in the open reading frame yrdC, and we have shown that the DyrdC mutation leads to immature 30S subunits and, as a consequence, to fewer translating ribosomes. YrdC is a small conserved protein with a dsRNA-binding surface. Here, we have characterized the YrdC protein. We show that the deletion leads to no production of functional protein, and we have indications that the YrdC protein might be essential in a wild type background. The protein is needed for the maturation of 16S rRNA, even though it does not interact tightly with either of the ribosomal subunits, or the 70S particles. The less effective maturation of rRNA affects the ribosomal feedback control, leading to an increase in expression from P1rrnB. We suggest that the function of the YrdC protein is to keep an rRNA structure needed for proper processing of 16S rRNA, especially at lower temperatures. This activity may require other factor(s). We suggest the gene be renamed rimN, and the mutant allele rimN141. D 2004 Elsevier B.V. All rights reserved. Keywords: Release factor one; 17S rRNA; Ribosome biogenesis; RimN; YciO; SUA5

1. Introduction During translation termination the nascent peptide is hydrolyzed from the P-site tRNA, a reaction that in Escherichia coli requires the binding of release factor (RF) one or two to the ribosomal A-site. RF1 and RF2 recognize stop codons UAG and UGA, respectively. The stop codon UAA is recognized by both factors. After hydrolysis, RF3, which is a GTP-binding protein, promotes the release of RF1 or RF2 from the ribosome [1]. Finally, ribosome recycling factor (RRF) and elongation factor G (EFG) dissociate the ribosomal subunits from the mRNA. The subunits can then be reused for a new cycle of translation [2]. The importance of RF1 for translation termination and regulation of protein synthesis has been studied using a mutant allele of RF1 [3]. RF1 is encoded by the prfA gene, and the prfA1 mutation codes for a factor that causes a * Corresponding author. Tel.: +46 8 164155; fax: +46 8 6129552. E-mail address: [email protected] (M. Ryde´n-Aulin). 0167-4781/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.bbaexp.2004.11.010

temperature sensitive (Ts) phenotype at 42 8C. We have described the selection and characterization of suppressors of the temperature sensitive phenotype caused by the prfA1 mutation [4]. One of the suppressor mutations was found to be a small deletion of twelve nucleotides including the initiation codon of the open reading frame yrdC. The suppressor was called DyrdC. The function of the YrdC protein is unknown, but it has been crystallized and found to have dsRNA-binding capacity [5]. YrdC belongs to a conserved protein-family with the sua5-yciO-yrdC domain (PF01300, Swiss-Prot/TrEMBL database), whose members can be found in both prokaryotes and eukaryotes. Suggested members of the family are proteins YciO and HypF (E. coli), YwlC (Bacillus subtilis), Sua5 (Saccharomyces cerevisiae), Drosophila melanogaster yrdC protein, and human yrdC protein. The sequences of the YciO protein, whose function is unknown, and the YrdC protein show 27% amino acid identity, and their three-dimensionalstructures are quite similar [6]. HypF catalyzes the formation of cyanide ligands, a reaction required for the

88

M. Kaczanowska, M. Ryde´n-Aulin / Biochimica et Biophysica Acta 1727 (2005) 87–96

maturation of NiFe-hydrogenases [7]. The YrdC homolog in S. cerevisiae, Sua5, has been suggested to be involved in the re-initiation of translation [8]. The human yrdC protein consists of the sua5-yciO-yrdC domain, a GTP-binding elongation factor signature, and a leucine zipper pattern. The leucine zipper pattern is important for protein dimerization and nucleic acid binding. The yrdC transcript is expressed ubiquitously in human tissues, but at elevated levels in liver, pancreas, brain, and some tumor tissues—all cells with increased protein synthesis [9]. Previously, we have reported that the DyrdC mutation leads to increased amounts of 17S rRNA, a precursor of 16S rRNA. The elevated level is a consequence of slower rRNA maturation, which results in less effective assembly of 30S ribosomal subunits. In this work we continue the characterization of the YrdC protein, investigating the possibility of it being an assembly factor involved in ribosome biogenesis.

pAD34. The plasmid pAD34 has a cloned promoter region of the hemA–prfA operon, containing the promoters P1hemA and P2hemA. Lysogens were detected as blue colonies on Luria broth (LB) plates with X-gal, and checked for single copy integration [14]. The new strains were named MK70, MK72, and MK71, respectively. Strains MK65, MK66, and MK68 were also lysogenized by E lysates made on RLG6358 (P1rrnB) and on RLG5036 (PlacUV5). Lysogens Table 1 Bacterial strains used in this study Strain

Genotype and phenotype

Reference(s) or source

AN344 DH5a

pro leu hemA glnV(supE44) gyrA96 recA1 relA1 endA1 thi-1 hsdR17(r k , m k+) f80dlacZDM15 rph as US473 but zcg-174::Tn10 hemA as US486 but zcg-174::Tn10 hemA as MK66 but aroE zhb-3169::Tn10kan as MK67 but DyrdC aroE +kan S as MK65, with single-copy EphemA2 phemA1 (a derivative of pAD34) as MK68, with single-copy EphemA2 phemA1 (a derivative of pAD34) as MK66, with single-copy EphemA2 phemA1 (a derivative of pAD34) as MK65, with single-copy ErrnB P1 ( 41/+1) as MK65, with single-copy ElacUV5 ( 46/+1) as MK66, with single-copy ErrnB P1 ( 41/+1) as MK66, with single-copy ElacUV5 ( 46/+1) as MK68, with single-copy ErrnB P1 ( 41/+1) as MK68, with single-copy ElacUV5 ( 46/+1) as MG1655 but D(tonB trpAB) zcg-174::Tn10 as MG1655 but aroE zhb-3169::Tn10kan as US477 but DyrdC as MRA2 but hemA tonB +trp +

[31] [11]

2. Materials and methods

MG1655 MK65 MK66 MK67

2.1. Media, strains, and DNA manipulations

MK68 MK70

The strains and plasmids used in this study are listed in Tables 1 and 2, respectively. Media and genetic procedures are as described by Miller [10]. Procedures for plasmid constructions and transformation were as described by Sambrook et al. [11]. For plasmid construction details see Table 2. Phage lambda (E) lysates and transductions were made as described by Simons et al. [12]. Where appropriate, the medium contained ampicillin (Ap) (100 Ag/ml), chloramphenicol (Cm) (20 Ag/ml), kanamycin (Km) (50 Ag/ml), or tetracycline (Tc) (25 Ag/ml). When growing HemA mutants, y-aminolevulinic acid was added to the medium (100 Ag/ml) [13]. 2.2. Construction of strains MK70, MK71, MK72, MK74, MK75, MK76, MK77, MK78, and MK79 First, MRA2 was transduced with P1vir grown on AN344, selecting for Trp+. The transductants were screened for TcR and inability to grow without y-aminolevulinic acid (Ala ). One such isolate was called MRA476. Thereafter, strains US473 and US486 were transduced with P1vir grown on MRA476, selecting for TcR and screening for Ala , the clones were called MK65 and MK66, respectively. MK66 was also tested for inability to grow at 42 8C to determine the presence of the prfA1 mutation. Strain MK66 was transduced with P1vir grown on MRA95, selecting for KmR and screening for inability to grow without aromatic amino acids (Aro ). One such isolate was called MK67. Thereafter, P1vir grown on MRA100 was transduced to MK67, selecting for Aro+, and screening for KmS and Ts+. One clone was called MK68. Strains MK65 (wt), MK66 (prfA1), and MK68 (prfA1 DyrdC) were lysogenized with a E lysate made on DH5a/

MK71

MK72

MK74 MK75 MK76 MK77 MK78 MK79 MRA2 MRA95 MRA100 MRA476 RLG5036 RLG6358 US473 US475 US477 US486 VH1000

as VH1000, with single-copy ElacUV5 ( 46/+1) as VH1000, with single-copy ErrnB P1 ( 41/+1) ara D(gpt-lac)5 gyrA(nalA) arg(UAG) thi ara D(gpt-lac)5 zcg-174::Tn10 gyrA(nalA) arg(UAG) thi as US475 but prfA1 zcg-174::Tn10 ara D(gpt-lac)5 prfA1 gyrA(nalA) arg(UAG) thi as MG1655, but lacIZD(Mlu) rph +

[32,33] This work This work This work This work This work

This work

This work

This work This work This work This work This work This work [34] M. Ryde´n-Aulin strain collection [4] M. Ryde´n-Aulin strain collection R. Gourse strain collection, [35] R. Gourse strain collection, [35] M. Ryde´n-Aulin strain collection [4] [4] M. Ryde´n-Aulin strain collection V.J. Hernandez via R. Gourse

M. Kaczanowska, M. Ryde´n-Aulin / Biochimica et Biophysica Acta 1727 (2005) 87–96

89

Table 2 Plasmids used in this study Plasmid

Description

Construction and/or reference and/or source

pAD34 pBAD-A (Myc-His) pBADZZSCDHis6 pEZZ18 pmk55

PhemA2 and PhemA1 fused to lacZ a vector with arabinose-inducible promoter ZZ peptide constitutive expression of ZZ, wild type YrdC

pmk103

wild type YrdC fused to ZZ

pmk105

truncated YrdC, starting at AUG in position 43

pmk107

wild type YrdC

pmk109

wild type YciO

pSU19

medium copy-number vector with IPTG-inducible promoter ZZ gene

[36] [37], Invitrogen ZZ cloned in pBAD-A. R. Schnell plasmid collection. AmershamBiosciences PCR product amplified with oligonucleotides 5V-AAAGCTTGGGCTATCGGATTACCAAAAACAGC-3V and 5V-ACCATGGATAATAACCTGCAAAGAGACGC-3V. Cloned into pBAD-A using restriction enzymes HindIII and NcoI. The ZZ sequence was cleaved out from pBADZZSCDHis6 using restriction enzyme NcoI. It was cloned into pmk55 to create a fusion of ZZ to the 5V end of yrdC. Cloned into pBAD-A. AACTGCAGAGCGAAACAGCAGTGATGCGACTGTTG-3V and 5V-GGAATTCTTACCCCTGTCGAAACAGTTCACCCGTCAG-3V. Cloned into pSU19 using restriction enzymes PstI and EcoRI. PCR product amplified with oligonucleotides 5V-AACTGCAGTCGGCGGAATAATAACGTGAATAAT-3V and 5V-GGAATTCTTACCCCTGTCGAAACAGTTCACCCGTCAG-3V. Cloned into pSU19 using restriction enzymes PstI and EcoRI. PCR product amplified with oligonucleotides 5V-GCATGCGCAGAACACCACAGAGAGGGAATTATG-3V and 5V-TCTAGATTATAAGAAAGGCTTCACATCACC-3V. Cloned into pSU19 using restriction enzymes SphI and XbaI. [20]

SR376

were detected as above. The resulting strains were MK74, MK76, MK78, MK75, MK77, and MK79. 2.3. RT-PCR, PCR, and sequence analysis Reverse transcription (RT) was performed using M-MuLV Reverse Transcriptase (Fermentas). PCR was done using Expand Long Template PCR System (Roche). Oligonucleotides used for RT-PCR are shown in Table 3. Sequence analysis was done at MWG BIOTECH (Germany). 2.4. Northern blot analysis of mRNA mRNA was prepared from cells grown in LB at room temperature, 37 8C and 42 8C, respectively, using GramTable 3 Oligonucleotides used for the RT-PCR reactions Oligonucleotide

omk42 omk43 omk52 omk102 omk120 omk131 omk144 omk145 omk147

Used for RT-PCR reaction

Sequence 5V to 3V

A, B C D C D B E A E

GTCATGCCCGACTGGCTGCCAGTCTG GACGGGCCATCTGGTCCAGCGCCGC GCCAGGCTTATGGTAAACCGCTGG CCCCTGTCGAAACAGTTCACCCGTC GAATGAGCGATGACGGGATCGCCGG CCAATAAACATACCAAAGCGTCCCTG CCCAGCGATGCTGACGAAAACTCGC CTTCTCGCCCCTGCTCAAGCGCAC GGGCGCGTGTTGGCACCCATCAATG

pEZZ18 with cloned His6 - tag that provides a stop codon for the ZZ gene. R. Schnell plasmid collection.

Cracker, TotallyRNA and MICROBExpress (Ambion Inc). 3 Ag mRNA was separated by 1% agarose–6% formaldehyde (w/v) denaturing gels and blotted to a BrightStarPlus membrane (Ambion Inc) by capillary transfer. RNA was UV cross-linked to the membrane and hybridized in ULTRAhyb buffer (Ambion Inc). A radioactively labeled RNA was transcribed using STRIP-EZ RNA T7 (Ambion Inc) and [a-32P]-UTP (AmershamBiosciences) to probe the aroE mRNA. The primers used to make the DNA template for transcription of the probe are 5V-ATGGAAACCTATGCTGTTTTTGGTAAT-3V and 5V-TAATACGACTCACTATAGGGAGGTCACGCGGACAATTCCTCCTGCAATTGC-3V. Unincorporated nucleotides were removed with Microspin G-50 Columns (AmershamBiosciences). After the washing procedure, the signals were detected with IP Reader/Gauge (FUJI PHOTO FILM). 2.5. Ribosome preparation and sucrose gradients A 500 ml culture was grown in LB to log phase. Cells were chilled, harvested, washed and concentrated in cold R buffer (10 mM Tris–HCl pH 7.5; 50 mM KCl; 6 mM hmercaptoethanol; with either 1 mM or 10 mM MgCl2). Lysozyme (1 mg/ml) was added and the cells were lysed gently by several cycles of freezing and thawing. The cell debris was pelleted, the supernatant was loaded onto a 5%– 35% sucrose gradient in R buffer and centrifuged at 20,500 rpm for 15 h in an SW4ITi rotor (Beckman). 200 Al fractions were collected, and absorbency at 260 nm was measured.

90

M. Kaczanowska, M. Ryde´n-Aulin / Biochimica et Biophysica Acta 1727 (2005) 87–96

2.6. Purification and analysis of ZZ –YrdC and ZZ peptide from gradients and growing cultures

3. Results 3.1. Characterization of the yrdD operon

Fractions from sucrose-gradient peaks were pooled and loaded on an IgG column to purify ZZ–YrdC (AmershamBiosciences Biodirectory 2004). The eluate was dried and dissolved in 5 sample buffer (6 mM Tris–HCl pH 6.8; 2% SDS; 25% glycerol; 0.1% bromphenol blue; 5% hmercaptoethanol). The protein was separated using SDSpolyacrylamide gel electrophoresis (PAGE) (12.5% resolution/5% stacking gel). The gel was stained with SYPRO Ruby protein gel stain (Molecular Probes) and the signals were detected with IP Reader/Gauge (FUJI PHOTO FILM). To purify ZZ–YrdC and ZZ peptide from growing cultures, 50 ml cultures were grown to late log phase in LB at 37 8C. When needed, 1 mM arabinose was added to induce protein expression from the plasmid, and the culture was grown for an additional 30 min. Thereafter, the cells were pelleted and the pellets were dissolved in TST buffer [15]. Lysozyme (1 mg/ml) and DNase I (20 Ag/ml) were added, and the cells were lysed by several cycles of freezing and thawing, and by sonication. The cell debris was pelleted and the supernatant was filtered through a filter with 0.2 AM cut-off (PALL Life Sciences). TST buffer was added to the lysate (to a total volume of 50 ml) and loaded on an IgG column to purify ZZ–YrdC or ZZ peptide (AmershamBiosciences Biodirectory 2004). After elution, the samples were loaded on NAP5 columns (AmershamBiosciences) to change the elution buffer to R buffer (with 10 mM MgCl2). Extinction coefficients (www.basic.nwu.edu/biotools/proteincalc.html) and absorbency (280 nm) of the ZZ–YrdC and ZZ peptide samples were used to determine protein concentration. 2.7. in vitro maturation A culture grown in 500 ml LB to log phase was chilled and harvested. The cells were washed and concentrated in cold R buffer (with 10 mM MgCl2). Lysozyme (1 mg/ml) was added and the cells were sonicated. 10 Al of purified ZZ–YrdC or ZZ peptide (approximately 0.5 Ag) was added to 300 Al of the cell lysates, and incubated in room temperature for 30 min. RNA was prepared using TotallyRNA (Ambion Inc), 5 Ag of the RNAwas loaded onto a gel, separated, and blotted in the same way as for Northern blot. The oligonucleotide 5V-GCACTGCAAAGTACGCTTC- 3V, used for probing the 3Vend of 17S rRNA, was labeled at the 5V end with [g 32P]-ATP. The unincorporated nucleotides were removed with Microspin G-25 Columns (AmershamBiosciences). After hybridization [16], the membrane was washed, and the signals were detected and quantified with IP Reader/Gauge (FUJI PHOTO FILM). 2.8. b-galactosidase assay The cultures were grown to log phase in LB and yaminolevulinic acid (100 Ag/ml) at 37 8C. The assay was performed as described previously [17].

The yrdD operon is located at 73.9 min on the E. coli linkage map. The yrdD gene is the first gene in the operon, followed by yrdC, aroE, and yrdB (Fig. 1A). Not much is known about this operon (Swiss-Prot/TrEMBL). There is a computational prediction of one j70 promoter upstream of yrdD (www.cifn.unam.mx/Computational _Genomics/ regulondb/). YrdD is a hypothetical protein highly similar to topoisomerase I. The aroE gene encodes shikimate 5dehydrogenase, an enzyme catalyzing the fourth step in the shikimate pathway [18]. The initiation codon of the last open reading frame (orf) in the operon, yrdB, overlaps the aroE stop codon and has no known features. Upstream of the yrdD operon, three open reading frames coding for unknown functions are found: smf1, smf2, and smg. A+1 frame-shift in codon position 249 of the smf1 gene has been suggested, which would lead to a fusion of smf1 and smf2 into one gene (EcoCyc.org). The smg gene overlaps the 3V end of the smf2 gene with 27 bases. During our work, these two operons were sequenced to confirm that the yrdC deletion is the only mutation relevant for the suppressor phenotype. Two additional changes within the sequence were found, also present in the wild type strain. The first one is a G insertion at the already suggested codon 249 (nucleotide 745) of the smf1 gene, resulting in an alteration of the reading frame and fusion of the two reading frames smf1 and smf2. This finding corroborates a merge made at EcoCyc.org. The new gene, smf, has the same initiation codon as the smf1 orf and the stop codon of orf smf2 (Fig. 1B). The other alteration within the sequence is a deletion of G40 in the beginning of the yrdD gene. This leaves most of the yrdD orf intact, only its 5Vend is changed. Two start sites are possible, AUG 11 codons and GUG three codons upstream of the previously reported initiation start site, respectively. The AUG at position 11 has a weak Shine-Dalgarno (SD) sequence but it interferes with the predicted promoter region of the yrdD operon while the GUG codon at position 3 does not have a good SD sequence. To determine the start site for YrdD more experiments are needed. To investigate how the two operons are expressed on the transcriptional level, RT-PCR was chosen. The suppressor strain MRA100 (contains both the prfA1 and the DyrdC mutations since the DyrdC mutation cannot be separated from prfA1), and the control strain US477 (prfA1) were grown in LB at 37 8C, and total RNA was prepared. Oligonucleotides were designed to transcribe cDNA with reverse transcriptase, the possible fragments are shown in Fig. 1C and the results are shown in Fig. 1D. The cDNA fragment A shows that the smf1 gene is expressed, and we suggest that this means that smf is expressed. When RT-PCR was done with oligonucleotides designed to amplify the smg gene (fragment F) no cDNA was observed, indicating that

M. Kaczanowska, M. Ryde´n-Aulin / Biochimica et Biophysica Acta 1727 (2005) 87–96

91

Fig. 1. Expression of genes within the smf and yrdD operons. (A) The smf and yrdD operons, as they are presented in databases (www.cifn.unam.mx/ Computational _Genomics/regulondb/). Arrows mark predicted promoters, T mark predicted terminators, *position uncertain. The smg gene overlaps the smf2 gene with 27 bases; the yrdB start codon overlaps the aroE termination codon. (B) The suggested revised organization of the smf operon. (C) The size and positions of putative RT-PCR fragments A–F. (D) The result of the RT-PCR reactions on RNA prepared from strains US477 (1) and MRA100 (2). M, DNAmarker; four fragments sizes (kb) are shown to the right.

the smg gene is not transcribed from the promoter upstream of the smf gene (data not shown). The absence of fragment B in both strains indicates that the smf and yrdD operons are not cotranscribed. Oligonucleotides used for the amplification of fragments C and D were designed to examine if the suppressor mutation leads to pronounced polarity, if so, both fragments would be absent in MRA100 RT-PCR samples. However, cDNA was observed in these reactions. Only a few mRNA transcripts are required for detection with RT-PCR, which therefore seems to be too sensitive a method to answer whether DyrdC leads to polarity. The existence of fragment E in both strains suggests that the open reading frame yrdB is transcribed. Our revised view of the two operons is shown in Fig. 1B. As RT-PCR was not a good method to detect polarity, we decided to use Northern blot, a less sensitive method. mRNA from three strains (US475 (wt), US477 (prfA1), and MRA100 (prfA1 DyrdC)) grown at different temperatures (room temperature, 37 8C and 42 8C) was prepared and mRNA coding for aroE was hybridized with a long RNA probe. As shown in Fig. 2, a transcript can only be seen in samples from strains US475 and US477 grown at room temperature. The transcript could not be observed in any of the samples from the suppressor mutant MRA100. This suggests that the mRNA is mainly expressed at room temperature and that in MRA100 it is transcribed in much lower amounts compared to the control strains, probably due to polarity caused by the deletion.

At 37 8C, the suppressor strain MRA100 grows slower than both the wild type (US475) and the RF1 mutant (US477) strains. When grown in LB, the generation time for these strains are 25 min, 27 min, and 48 min for US475 (wt), US477 (prfA1), and MRA100 (prfA1 DyrdC), respectively. Even if the slow growth is taken into consideration, a cold sensitive phenotype for the suppressor mutant can be observed when grown on LB plates at room temperature. Since the yrdC mRNA is mainly expressed at low temperatures, it is not unlikely that the cold sensitivity is due to the dramatic decrease of the yrdC transcript and hence a probable decrease in YrdC concentration. 3.2. Is the YrdC protein required for cell viability? Since the mutant gene lacks the first four codons, there has to be another initiation codon within close proximity of

Fig. 2. A Northern blot analysis of the expression of the yrdD operon transcript. 3 Ag mRNA from strains US475, US477, and MRA100 grown at room temperature, 37 8C, or 42 8C was prepared and the aroE gene was probed. The size of the transcript is 2.4 kb, corresponding to the size of an mRNA reaching from the yrdD gene to the yrdB gene.

92

M. Kaczanowska, M. Ryde´n-Aulin / Biochimica et Biophysica Acta 1727 (2005) 87–96

the wild type start site for a functional protein to be translated. However, the closest putative initiation codon (AUG) can be found at codon position 43. To examine whether a truncated protein, translated from this AUG, is functional, both the wild type gene and a truncated yrdC gene was cloned in an intermediate-copy number vector pSU19 [19]. The plasmids were named pmk107 and pmk105, respectively. We have checked whether these two plasmids express protein, which they do. We also tested whether production was induced by IPTG but there was no significant induction (data not shown). The two plasmids pMK107 and pMK105 together with the pSU19 vector were transformed into MRA100, and a viable count was done. Any possible complementation of the DyrdC mutation by an N-terminally truncated YrdC protein would be observed as a change of the Ts+ phenotype of the suppressor strain to the temperature sensitivity caused by the prfA1 mutant. Cultures were diluted and spread on LB plates, which were incubated at 37 8C and 42 8C, respectively. As presented in Table 4, wild type YrdC protein complements the DyrdC mutation, the number of colonies decreases about 200 times at 42 8C due to temperature sensitivity. The truncated YrdC protein, however, behaves as the control strain. This suggests that the shorter form of YrdC is not functional. These results indicate that no YrdC protein is made in the suppressor strain and thus that the protein is not essential. However, we have earlier shown that the DyrdC mutation cannot be separated from the prfA1 mutation [4]. This indicates that the YrdC protein might be essential in a prfA wild type background. 3.3. Does the YrdC homolog YciO suppress DyrdC? As the YciO and YrdC proteins have very similar threedimensional structures and share 27% amino acid identity, we wanted to investigate whether these two proteins have similar or overlapping functions. The yciO gene was amplified and cloned into the IPTG-inducible pSU19 vector, the clone was named pmk109. The protein is weakly expressed but not significantly induced by IPTG (data not shown). A viable count was performed in the same way as described above. The strain MRA100 containing pmk109 was plated and grown at 37 8C and 42 8C, respectively, and the number of colonies was counted. No significant difference in the amount of colonies between 37 8C (8108) and 42 8C (5.6108) was observed. This suggests that YciO Table 4 The effect of truncated YrdC protein Plasmid

Temperature 37 8C

pSU19 (control) pmk107 (wt yrdC) pmk105 (truncated yrdC)

a

1 1 0.8

42 8C 0.6 0.006 0.6

a The number of colonies with the control vector was 5109 cells/ml, this number was set to one and the other counts were normalized to this.

cannot compensate for the lack of the YrdC protein. It is possible that the over expression of YciO can suppress DyrdC. 3.4. Do the YrdC proteins interact with the ribosome? In our recent study the suggested function of the YrdC protein was involvement in ribosome biogenesis [4]. The lack of YrdC in the cell leads to an accumulation of a premature form of 16S rRNA, 17S rRNA. We think that the maturation defect is because a structure required for the activities of RNaseE and RNaseG, which cleave the 17S rRNA at the 5V end, and the still unknown RNase that cleaves the 3V end of the rRNA, is formed slower than in the wild type strain [20,21]. Since the YrdC protein has the capacity to bind dsRNA, we wanted to examine whether YrdC interacts with the ribosome or the ribosomal subunits. To be able to prepare YrdC from gradient fractions, a 405 nt long ZZ gene was fused to the 5V end of the yrdC gene (pmk103). The ZZ peptide is composed of two repeats of the Z domain, a derivative of protein A from Staphylococcus aureus. The ability of ZZ to interact with antibodies is used for the purification on IgG columns (AmershamBiosciences Biodirectory 2004). The ZZ peptide is short and most of the time does not alter the folding of tagged proteins, however, the ability of the ZZ–YrdC protein to complement DyrdC was controlled. MRA100/pmk103 was streaked on LB plates and incubated at 37 8C and 42 8C, respectively, testing whether the strain is temperature sensitive at 42 8C and fast growing at 37 8C (the phenotype of the prfA1 mutant). The result was positive. Also, a sucrose gradient on ribosomes from MRA100/ pmk103 (10 mM MgCl2, Fig. 3) shows a pattern indistinguishable from that of the wild type strain (not shown). Ribosomes from MRA100/pmk103 were prepared and separated on sucrose gradients with either 1 mM or 10 mM MgCl2. At 1 mM MgCl2 the ribosomal 30S and 50S subunits are dissociated. At this concentration detection of any possible YrdC binding to mature or immature subunits can be done. At 10 mM MgCl2, the subunits are kept as 70S ribosomes and polysomes. Fractions from sucrose gradients with either 1 mM or 10 mM MgCl2 were collected and samples from each peak (the polysome, 70S, 50S, 30S, and the cytosol fractions) were taken. To ensure that no other protein of YrdC’s size is mistaken for YrdC, a cell lysate made on MRA100/pmk55 (the yrdC gene without ZZ-tag) was loaded on a sucrose gradient with 10 mM MgCl2, and a sample from the cytosol peak was taken. The collected samples were loaded onto IgG columns to purify possible ZZ–YrdC. The protein samples were separated on SDS-PAGE. The result can be seen in Fig. 3. The 34 kDa protein band, corresponding to the ZZ–YrdC protein, can be observed only in samples prepared from the cytosol. There is no detectable YrdC protein in samples from the peaks containing ribosomes or ribosomal subunits. This suggests that the YrdC protein does not bind tightly to

M. Kaczanowska, M. Ryde´n-Aulin / Biochimica et Biophysica Acta 1727 (2005) 87–96

93

Fig. 3. Cellular location of the ZZ–YrdC protein. M, protein pre-stained marker; C, purified ZZ–YrdC; P, polysome sample; C1, cytosol sample from a sucrose gradient on MRA100/pmk103 with 1 mM MgCl2; C2, cytosol sample from a sucrose gradient on MRA100/pmk103 with 10 mM MgCl2; C3, cytosol sample from a sucrose gradient on MRA100/pmk55 (untagged YrdC) with 10 mM MgCl2. The position of ZZ–YrdC is shown, as also the sizes of two marker proteins.

either of the ribosomal subunits, or to the translating ribosomes. However, a brief interaction between YrdC and the ribosome cannot be excluded. 3.5. The YrdC protein is required for the maturation of 16S rRNA One of the consequences of the DyrdC mutation is an increased level of 17S rRNA. The normal amount of 17S rRNA in a wild type cell is approximately 7–9% at 37 8C [20], the double mutant (MRA100) has a slightly elevated level of 16% [4]. To confirm that it is the lack of YrdC that causes the observed accumulation, an in vitro maturation experiment was done. For this purpose, ZZ–YrdC (expressed from plasmid pmk103) and ZZ peptide (expressed from plasmid SR376) were prepared from strain MRA100. Cell lysates from strains US475 (wt), US477 (prfA1), and MRA100 (prfA1 DyrdC) were prepared. To these lysates, ZZ–YrdC or ZZ peptides were added, and the samples were incubated at room temperature for 30 min. After incubation, total RNA was prepared and Northern blot analysis performed. For hybridization, an oligonucleotide recognizing the 3V end of 17S rRNA was used. During the 16S rRNA maturation process, this end is cleaved off by an unknown RNase [4,20]. Fig. 4 shows the result of one such

Fig. 4. In vitro maturation of 16S rRNA. Northern blot analysis on 5 Ag total RNA, probing 17S rRNA from lysates treated with either ZZ–YrdC or ZZ peptide. Lysates were prepared from strains US475 (wt), US477 (prfA1), and MRA100 (prfA1 DyrdC). The amount of 17S in the wild type lysate treated with ZZ peptide was set to one, the relative amount of 17S rRNA in the other samples are shown below the picture. The experiment has been repeated three times and the error is less than 20%.

experiment, with the amount of 17S in the wild type lysate with added ZZ peptide set to one. As can be seen, the only significant change after the addition of ZZ–YrdC to the three lysates is a decrease of approximately four times for the double mutant. The result suggests that YrdC is involved in the maturation of 16S rRNA. This result, however, does not say anything about any possible function of YrdC, or if YrdC requires other factors for the activity. 3.6. DyrdC induces the feedback control of rRNA transcription Earlier, we have presented data that indicate that the prfA1 mutation can be suppressed by decreased amounts of active ribosomes [4]. It has been shown that such a decrease induces the expression of rrn operons, the socalled feedback control of ribosome synthesis [22]. Since the P1hemA promoter for the hemA operon, where prfA is the second gene, shares several characteristics with the P1 promoter for the rrn operons, we suggested that the feedback control increases not only rRNA transcription, but also the transcription of the prfA gene. As it has been shown that over expression of mutant RF1 leads to a Ts+ phenotype [3], this might be the mechanism for suppression. To test this hypothesis, we first wanted to see whether rRNA transcription was induced in a strain with the DyrdC mutation, since the mutation leads to fewer ribosomes. The P1 promoter for the rrnB operon (P1rrnB) was fused to lacZ, and so was the control promoter, PlacUV5. The constructs were introduced onto the chromosome as E-lysogens in a wild type, prfA1, and prfA1 DyrdC background, respectively (Table 1). The strains MK74 (wt, P1rrnB), MK75 (wt, PlacUV5), MK76 (prfA1, P1rrnB) MK77 (prfA1, PlacUV5), MK78 (prfA1 DyrdC, P1rrnB), and MK79 (prfA1 DyrdC, PlacUV5) were grown to log phase in LB at 37 8C, and hgalactosidase activity was assayed. The results are shown in Fig. 5. As expected, expression from the PlacUV5 promoter did not change significantly between strains. However,

94

M. Kaczanowska, M. Ryde´n-Aulin / Biochimica et Biophysica Acta 1727 (2005) 87–96

Fig. 5. Expression from the P1rrnB and PlacUV5 promoters. h-galactosidase activity was measured in cells grown to mid log phase in LB at 37 8C.

expression from the P1rrnB promoter is five times increased in the suppressor strain compared to the wild type and the RF1 mutant strains. This suggests that the decreased amount of active ribosomes in a DyrdC mutant strain leads to an increased expression of rRNA, probably by the induction of the feedback control. To investigate whether P1hemA is affected the same way, three strains were made. The whole promoter region of the hemA-prfA operon, containing promoters P2hemA and P1hemA, was fused to the lacZ gene and transferred to a wild type, prfA1, or a prfA1 DyrdC background, creating strains MK70, MK72, and MK71, respectively. h-galactosidase activity was assayed, but no difference in activity between the strains could be seen (data not shown). In conclusion, the DyrdC mutations lead to increased rRNA transcription but not prfA expression.

4. Discussion In this work we have continued the characterization of a suppressor of the temperature sensitive phenotype caused by a mutant RF1. The suppressor mutation, named DyrdC, is known to affect the efficiency of three RNases that are involved in the maturation of 17S rRNA to 16S rRNA, resulting in slower assembly of 30S ribosomal subunits. This leads to a decreased level of active ribosomes, a decrease directly or indirectly involved in suppression of the prfA1 mutation [4]. To ascertain that the suppressor phenotype is caused by DyrdC only, an extensive region was sequenced. We found two base alterations within the yrdD and smf operons; both alterations were also present in the wild type strain. One of the alterations, a one-base insertion within the smf1 gene, results in a fusion of the open reading frames smf1 and smf2, into one larger gene, smf (Fig. 1A, B). This finding corroborates a merge made at EcoCyc.org. Our results also suggest that the smg gene is not expressed (fragment F, Fig. 1C). We did not investigate this further. The second change, a deletion of G40 in the yrdD-coding region, alters the predicted reading frame of the orf at the 5V end. The identity

of the initiation codon is not clear and needs further experiments to be identified. We wanted to determine whether the yrdD gene is the first gene in the yrdD operon and to examine whether the DyrdC mutation causes polarity. First, we used RT-PCR and showed that the smf and yrdD operons are not cotranscribed. However, this method did not reveal whether DyrdC causes polarity, since it is too sensitive. Instead, using Northern blot analysis (Fig. 2) we found that in the wild type strain the yrdC mRNA is mainly transcribed at room temperature, and that no yrdC mRNA was detected in the DyrdC mutant. The lack of yrdC mRNA in the samples from the suppressor mutant (MRA100) indicates that DyrdC induces polarity and that this decreases dramatically the amount of the transcript. The fact that the suppressor strain has a cold sensitive phenotype together with the expression pattern suggests that YrdC mainly functions at low temperatures. In line with this we have indications that there is more 17S rRNA in the mutant strain, compared to the wild type strain at room temperature (data not shown). Sufficient amounts of mRNA are produced in both the mutant and in the wild type strains to allow shikimate 5-dehydrogenase synthesis, since neither strain have an Aro phenotype. We also know that the YrdC protein also is produced at 42 8C in the wild type strain since it is the lack of YrdC that leads to the suppressor phenotype. HypF and YciO are the two proteins in E. coli, besides YrdC, that belong to the sua5-yrdC-yciO family. HypF is involved in the formation of cyanide ligands required for maturation of NiFe-hydrogenases [7]. Jia et al. [6] suggest that YciO can bind to extended RNA molecules, but no experimental evidence is at hand. The similarity between YrdC and YciO leads us to examine if YciO may have an overlapping function with YrdC. A complementation test was performed and the result shows that YciO cannot substitute for YrdC in the DyrdC background. A mutation in Sua5, the YrdC homolog in S. cerevisiae, was isolated as a suppressor of an aberrant AUG initiation codon upstream of the cyc1 gene, which encodes the iso-1-cytochrome c enzyme [8]. The extra initiation codon, created by a single base alteration at position 18 relative to the authentic initiation codon, forms a short open reading frame with a stop codon upstream of the start codon of the cyc1 gene. This mutant produces only 2% of the wild type (wt) enzyme level, a level that is increased to 60% by the mutated Sua5 protein. SUA5 was suggested to suppress the cyc1–1019 mutation either by altering the rate of cyc1 transcription, by affecting the cyc1 mRNA stability, or by affecting the initiation of translation of the CYC1 protein. We hypothesize that Sua5 has a similar function to YrdC and therefore might be involved in ribosome biogenesis. This assumption is supported by results that show that in the SUA5 mutant, rRNA processing is affected (S. Ellis, personal communication). The expression of ribosomal RNA is regulated by a feedback mechanism that senses the amount of actively

M. Kaczanowska, M. Ryde´n-Aulin / Biochimica et Biophysica Acta 1727 (2005) 87–96

translating ribosomes [22]. We have suggested that the mechanism behind suppression is that lower amounts of active ribosomes induce the expression of RF1, as part of the feedback control [4]. However, when tested, the expression of RF1 was not induced. An alternative model for suppression may be that the slow termination by the mutant factor is somehow balanced by a slower initiation rate. This needs to be investigated. The maturation of rRNA and the assembly of ribosomes is a very complex process, which has to be tightly regulated to avoid energy loss. There are seven rRNA operons in E. coli, containing the immature forms of 16S rRNA, 23S rRNA, 5S rRNA, and different tRNAs. The rRNA operons are transcribed as one transcript, respectively, which already during transcription are cleaved by RNaseIII to separate the RNA species [20]. The assembly of the 30S and 50S ribosomal subunits follows with ordered binding of ribosomal proteins [22,23], cleavage of the rRNA by several RNases [20], a series of conformational changes, and addition of modifications to the rRNA [24]. Several extrinsic proteins have been suggested to be required for effective maturation and the assembly of ribosomal subunits. DnaK, which belongs to the chaperone Hsp70 family [25], together with its co-chaperone DnaJ, seems to affect ribosome biogenesis at temperatures above 30 8C. Whether this effect is direct or indirect is unclear [26,27]. The proteins RimM and RbfA have affinity for the immature 30S ribosomal subunit, and are essential for efficient processing of 16S rRNA [28]. Also, two RNA helicases, CsdA and SrmB, both interacting with the 50S ribosomal subunit, were found to be important for 50S biogenesis [29,30]. Mutations in all of the mentioned proteins lead to an increased accumulation of ribosome precursors and a decrease of translating ribosomes. Since this is what we find for the DyrdC mutant, we wanted to investigate if the YrdC protein also interacts with the ribosome or its subunits. However, after sucrose-gradient fractionation, ZZ–YrdC was found only in the cytosol peak, and not bound to any ribosomal species. A brief interaction with one of the subunits can however, not be ruled out. To investigate whether the YrdC protein is involved in ribosome biogenesis, an in vitro maturation test was done. Our results suggest that YrdC is required for the maturation of 16S rRNA (Fig. 4), but it does not say if other factor(s) are required for the YrdC activity. A possible function of YrdC is facilitating rRNA folding as an RNA chaperone (a maturation factor). YrdC might be used for keeping an rRNA structure needed for proper processing of 16S rRNA or to pull apart misfolded secondary structures of rRNA, which are then free to retry to reach the correct structure. This may especially be required at lower temperatures when YrdC is expressed at higher levels (Fig. 2). The chaperoning event must be brief or the interaction weak, leaving most of the YrdC protein free in the cytosol. The genes for many factors that affect ribosome assembly have been named rim

95

for ribosome maturation. Since we believe that the YrdC protein is involved in ribosome maturation, we suggest, after consulting the E. coli Genetic Stock Center, that the gene for YrdC be renamed rimN, and our mutant allele rimN141.

Acknowledgements This work was supported by the M. Bergvall Society.

References [1] V. Ramakrishnan, Ribosome structure and the mechanism of translation, Cell 108 (2002) 557 – 572. [2] M.C. Kiel, V.S. Raj, H. Kaji, A. Kaji, Release of ribosome-bound ribosome recycling factor by elongation factor G, J. Biol. Chem. 278 (2003) 48041 – 48050. [3] M. Ryde´n, J. Murphy, R. Martin, L. Isaksson, J. Gallant, Mapping and complementation studies of the gene for release factor 1, J. Bacteriol. 168 (1986) 1066 – 1069. [4] M. Kaczanowska, M. Ryde´n-Aulin, Temperature sensitivity caused by mutant release factor 1 is suppressed by mutations that affect 16S rRNA maturation, J. Bacteriol. 186 (2004) 3046 – 3055. [5] M. Teplova, V. Tereshko, R. Sanishvili, A. Joachimiak, T. Bushueva, W.F. Anderson, M. Egli, The structure of the yrdC gene product from Escherichia coli reveals a new fold and suggests a role in RNA binding, Protein Sci. 9 (2000) 2557 – 2566. [6] J. Jia, V.V. Lunin, V. Sauve´, L.-W. Huang, A. Matte, M. Cygler, Crystal structure of the YciO protein from Escherichia coli, Proteins: Struct. Funct. Genet. 49 (2002) 139 – 141. [7] S. Reissmann, A. Hochleitner, H. Wang, A. Paschos, F. Lottspeich, R.S. Glass, A. Bfck, Taming of a poison: biosynthesis of the NiFe-hydrogenase cyanide ligands, Science 299 (2003) 1067 – 1070. [8] J.G. Na, I. Pinto, M. Hampsey, Isolation and Characterization of SUA5, a novel gene required for normal growth in Saccharomyces cerevisiae, Genetics 131 (1992) 791 – 801. [9] J. Chen, C. Ji, S. Gu, E. Zhao, J. Dai, L. Huang, J. Qian, K. Ying, Y. Xie, Y. Mao, Isolation and identification of a novel cDNA that encodes human yrdC protein, J. Hum. Genet. 48 (2003) 164 – 169. [10] J.H. Miller, Experiments in Molecular Genetics, Cold Spring Harbor, New York, 1972. [11] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular cloning—a laboratory manual, in: Chris Nolan (Ed.), Cold Spring Harbor Laboratory Press, 1989. [12] R.W. Simons, F. Houman, N. Kleckner, Improved single and multicopy lac-based cloning vectors for protein and operon fusions, Gene 53 (1987) 85 – 96. [13] E. Verkamp, B.K. Chelm, Isolation, nucleotide sequence, and preliminary characterization of the Escherichia coli K-12 hemA gene, J. Bacteriol. 171 (1989) 4728 – 4735. [14] B.S. Powell, D.L. Court, Y. Nakamura, M.P. Rivas, C.L. Turnbough Jr., Rapid confirmation of single copy lambda prophage integration by PCR, Nucleic Acids Res. 22 (1994) 5765 – 5766. [15] A. Bjfrnsson, S. Mottagui-Tabar, L.A. Isaksson, The analysis of translational activity using a reporter gene constructed from repeats of an antibody-binding domain from protein A, in: R. Martin (Ed.), Methods in Molecular Biology, Protein Synthesis: Methods and Protocols, Humana Press Inc., New Jersey, 1998, pp. 75 – 91. [16] F.M. Ausubel, Curr. Protocols Mol. Biol., John Wiley & Sons Inc, 2003.

96

M. Kaczanowska, M. Ryde´n-Aulin / Biochimica et Biophysica Acta 1727 (2005) 87–96

[17] M. Ryde´n-Aulin, S. Zhang, P. Kylsten, L.A. Isaksson, Ribosome activity and modification of 16S RNA are influenced by deletion of ribosomal protein S20, Mol. Microbiol. 7 (1993) 983 – 992. [18] G. Michel, A.W. Roszak, V. Sauve´, A.M. Maclean, A. Matte, J.R. Coggins, M. Cygler, A.J. Lapthorn, Structures of shikimate dehydrogenase AroE and its paralog YdiB: a common structural framework for different activities, J. Biol. Chem. 278 (2003) 19463 – 19472. [19] B. Bartolome´, Y. Jubete, E. Martı´nez, F. Cruz de la, Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives, Gene 102 (1991) 75 – 78. [20] T.C. King, R. Sirdeskmukh, D. Schlessinger, Nucleolytic processing of ribonucleic acid transcripts in procaryotes, Microbiol. Rev. 50 (1986) 428 – 451. [21] Z. Li, S. Pandit, M.P. Deutscher, RNase G (CafA protein) and RNaseE are both required for the 5V maturation of 16S ribosomal RNA, EMBO J. 18 (1999) 2878 – 2885. [22] C. Condon, C. Squires, C.L. Squires, Control of rRNA transcription in Escherichia coli, Microbiol. Rev. 59 (1995) 623 – 645. [23] S.M. Stagg, J.A. Mears, S.C. Harvey, A structural model for the assembly of the 30S subunit of the ribosome, J. Mol. Biol. 328 (2003) 49 – 61. [24] G.R. Bjfrk, Stable RNA modification, in: F.C. Neidhardt (Ed.), Escherichia Coli and Salmonella Cellular and Molecular Biology, ASM Press, Washington, DC, 1996, pp. 861 – 886. [25] P. Genevaux, F. Keppel, F. Schwager, P.S. Langendijk-Genevaux, U.F. Hartl, C. Georgopoulos, In vivo analysis of the overlapping functions of DnaK and trigger factor, EMBO Rep. 5 (2004) 1 – 6. [26] J.-H. Alix, K.H. Nierhaus, DnaK-facilitated ribosome assembly in Escherichia coli revisited, RNA 9 (2003) 787 – 793. [27] J.A. Maki, D.J. Schnobrich, G.M. Culver, The DnaK chaperone system facilitates 30S ribosomal subunit assembly, Mol. Cell 10 (2002) 129 – 138.

[28] G.O. Bylund, L.C. Wipemo, C.L.A. Lundberg, M.P. Wikstrfm, RimM and RbfA are essential for efficient processing of 16S rRNA in Escherichia coli, J. Bacteriol. 180 (1998) 73 – 82. [29] J. Charollais, D. Pflieger, J. Vinh, M. Dreyfus, I. Iost, The DEAD-box RNA helicase SrmB is involved in the assembly of 50S ribosomal subunits in Escherichia coli, Mol. Microbiol. 48 (2003) 1253 – 1265. [30] J. Charollais, M. Dreyfus, I. Iost, CsdA, a cold-shock RNA helicase from Escherichia coli, is involved in the biogenesis of 50S ribosomal subunit, Nucleic Acids Res. 32 (2004) 2751 – 2759. [31] M. Petricek, L. Rutberg, I. Schrfder, L. Hederstedt, Cloning and characterization of the hemA region of the Bacillus subtilis chromosome, J. Bacteriol. 172 (1990) 2250 – 2258. [32] B.J. Bachmann, Derivations and Genotypes of Some Mutant Derivatives of Escherichia Coli K-12, Escherichia Coli and Salmonella, ASM Press, Washington, DC, 1996, pp. 2460 – 2488. [33] K.F. Jensen, The Escherichia coli K-12 bWild TypesQ W3110 and MG1655 have an rph frameshift mutation that leads to pyrimidine starvation due to low pyrE expression levels, J. Bacteriol. 175 (1993) 3401 – 3407. [34] S. Zhang, M. Ryde´n-Aulin, L.A. Kirsebom, L.A. Isaksson, Genetic implication for an interaction between release factor one and ribosomal protein L7/L12 in vivo, J. Mol. Biol. 242 (1994) 614 – 618. [35] M.S. Bartlett, R.L. Gourse, Growth rate-dependent control of the rrnB P1 core promoter in Escherichia coli, J. Bacteriol. 176 (1994) 5560 – 5564. [36] A. Dahlgren, M. Ryde´n-Aulin, Effects of two cis-acting mutations on the regulation and expression of release factor one in Escherichia coli, Biochimie 86 (2004) 431 – 438. [37] L.-M. Guzman, D. Belin, M.J. Carson, J. Beckwith, Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter, J. Bacteriol. 177 (1995) 4121 – 4130.