- Email: [email protected]
Therapeutic effect of CpG-enriched plasmid administration on the tight-skin mouse model of scleroderma
Journal of Autoimmunity 24 (2005) 183e190 www.elsevier.com/locate/issn/08968411
Therapeutic effect of CpG-enriched plasmid administration on the tight-skin mouse model of scleroderma Yan Shena, Motohide Ichinoa, Masatoshi Nakazawaa, Takashi Ikejimab, Yoshitsugu Kojimac, Kenji Okudac, Mutsuhiko Minamia,* a
Department of Immunology, Yokohama City University School of Medicine, Fukuura 3-9, Kanazawa-ku, Yokohama, Kanagawa 236-0004, Japan b China-Japan Research Institute of Medical and Pharmaceutical Science, Shenyang Pharmaceutical University, Shenyang, China c Department of Molecular Biodefense Research, Yokohama City University School of Medicine, Yokohama, Japan Received 13 October 2004; revised 6 December 2004; accepted 5 January 2005
Abstract Immunostimulatory CpG motifs can preferentially induce Th1 immune responses and have been applied to treat Th2-dominant disease. In this study, we investigated whether a plasmid with the addition of 20 copies of an immunostimulatory CpG motif (pBCpG20) might prevent the development of scleroderma-like syndrome in tight-skin (Tsk/C) mice. Administration of pB-CpG20 to Tsk/Cmice every 3 weeks starting at the age of 1 week reduced skin thickness and collagen content compared to that of pB or saline. The reduction was long lasting even after halting the treatment. Furthermore, this treatment partially reduced the production of anti-nuclear antibodies although it did not decrease the incidence of lung emphysema. pB-CpG20 increased the number of spleen cells secreting IFN-g and reduced that of the cells secreting IL-4 in vivo and in vitro compared to saline. These results suggest that repeated administration of a CpG-enriched plasmid can ameliorate scleroderma-like syndrome by biasing Th1 immunity in young Tsk/Cmice. Ó 2005 Elsevier Ltd. All rights reserved. Keywords: CpG motif; Plasmid; Scleroderma; Th1; Tight-skin mouse
1. Introduction Scleroderma is an autoimmune connective tissue disease characterized by fibrosis of the skin and internal organs, and the presence of anti-nuclear antibodies (ANA). Tight-skin (Tsk/C) mice represent an animal model for scleroderma [1]. They spontaneously develop a syndrome including cutaneous hyperplasia, lung emphysema and ANA specific for topoisomerase I, RNA polymerase I and fibrilin-1 [1,2]. Recent studies suggest * Corresponding author. Tel.: C81 45 787 2612; fax: C81 45 787 2509. E-mail address: [email protected] (M. Minami). 0896-8411/$ - see front matter Ó 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.jaut.2005.01.014
that IL-4 and/or transforming growth factor-b may play an important role in the fibrogenesis of Tsk/Cmice [3e 5], and the progression of the disease can be prevented by suppressing Th2 responses or normalizing the Th1/ Th2 balance in vivo [6,7]. Patients with systemic sclerosis have elevated serum levels of IL-4 and increased numbers of IL-4-producing T cells [8e10]. Recombinant IFN-g has been clinically attempted to treat these patients, resulting in mild beneficial effects on skin sclerosis and disease-associated symptoms in scleroderma [11]. It is widely accepted that CpG motifs frequently existing in microbial DNA are immunostimulatory and able to elicit a Th1-biased immune response when
184
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
recognized by Toll-like receptor 9 [12,13]. Bacterial DNA and synthetic oligodeoxynucleotides (ODN) containing CpG motifs can trigger B cells, NK cells and macrophages to proliferate, activate and secrete a variety of cytokines, including IL-12, IFN-g, IL-6 and TNFa [12,14,15]. CpG ODN have been used as immunomodulatory agents and/or adjuvants to treat or prevent Th2-driven diseases [16e18]. In our early study, we administered CpG ODN to Tsk/Cmice starting at 1 week of age and observed a long-term inhibitory effect on the development of skin fibrosis (Y. Shen, in preparation). Recently there is considerable interest in studying the therapeutic benefit of a CpG-enriched plasmid based on its economics and stability [19]. We previously examined the adjuvant effect of plasmids containing 5e20 copies of an immunostimulatory CpG motif when coadministered with HIV-1 DNA vaccine, and found that the plasmids containing 20 CpG copies most effectively augmented cytotoxic T lymphocyte activity, delayed type hypersensitivity and IFN-g production [20]. Moreover, other investigators showed that addition of immunostimulatory CpG motifs to the plasmid backbone can enhance its adjuvant activity as a Th1 trigger [21]. However, it is unclear whether a plasmid enriched in CpG content itself might be of therapeutic effect on Th2-driven autoimmune diseases. Hence, we investigated the efficacy of a CpG-enriched plasmid as an approach to treat scleroderma-like disease. Our results indicate that administration of a plasmid containing 20 CpG copies reduced the development of skin fibrosis compared to that of control plasmid or saline, and partially reduced the production of ANA in Tsk/Cmice.
2. Materials and methods 2.1. Plasmids pB-CpG20 was constructed as described previously [20]. In brief, an ODN fragment containing five CpG motifs (5#-GATATCTCTCCCAGCGTGCGCCATTC TCCCAGCGTGCGCCATTCTCCCAGCGTGCGCCA TTCTCCCAGCGTGCGCCATTCTCCCAGCGTGCG CCAGAATTC-3#) and its complement sequence were synthesized by Sawaday Technology (Tokyo, Japan). Restricted enzyme sites for EcoRV and EcoRI were linked at the 5#- and 3#-ends of the fragment, respectively. Annealed double-stranded fragments were digested with EcoRV and EcoRI and subcloned into pBluescript KS (ÿ) (pB) (Stratagene, La Jolla, CA, GenBank no. X52329). pB-CpG20 was obtained by inserting 20 copies of a CpG motif between the EcoRV and EcoRI sites. The sequence was confirmed by DNA sequencing. Plasmids were purified from Escherichia coli strain DH5a using Endofree plasmid maxi kit (QIAGEN
GmbH, Hilden, Germany), resuspended in sterile endotoxin-free water, and stored at 4 C.
2.2. Mice and treatment Tsk/Cand C57BL/6 pa/pa mice were purchased from Jackson Laboratories (Bar Harbor, ME) and maintained under specific pathogen free conditions at the animal facility of Yokohama City University School of Medicine (Yokohama, Japan). Mice were handled in accordance with institutional animal care and use committee protocols approved by the facility. Tsk/Cmice were produced by mating Tsk/Cmale with pa/pa female mice. Neonatal Tsk/Cmice were distinguished from pa/pa littermates by their black skin and eye color. Mice were injected with 100 ml of pB or pB-CpG20 (50 mg/mouse, respectively) or saline in both quadriceps muscles seven times at 3 week intervals starting at 1 week of age. In some experiments, 6e8-week-old naive mice were injected 1 week before sacrifice for ELISPOT assay. Male Tsk/Cmice were used for experiments.
2.3. Preparation of sections and histological analysis Skin samples were removed and processed as described previously [7]. As skin thickness varies from site to site, skin sections were taken from the same anatomic site to minimize regional variations in thickness. Briefly, 25 mm2 fragments of skin from the interscapular region (23 weeks old) or dorsum immediately below the neck (32 weeks old) were removed and fixed in 10% formalin for 30 h. Specimens were then gradually dehydrated in alcohol and embedded in paraffin. Sections were cut perpendicular to the skin surface and stained with hematoxylin and eosin. Skin thickness was measured from the top of the granular layer to the junction between the dermis and subcutaneous fat using an ocular micrometer. Ten random measurements were taken per section, and the average dermal thickness was calculated. The lungs were removed after sacrifice and processed by the same method described above. The extent of airspace was analyzed on hematoxylin/eosin stained sections. In all the experiments the measurement was performed in a blinded method.
2.4. Collagen staining Differential staining of collagenous and noncollagenous proteins was performed on paraffin sections with 0.1% sirius red with 0.1% fast green FCF as a counter-stain, in saturated picric acid. Collagen is stained red by this procedure.
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
2.5. Immunohistochemistry of collagen type I Immunostaining was performed on 3 mm thick consecutive sections obtained from paraffin-embedded skin samples. Briefly, the sections were deparaffinized in xylene, rehydrated through a graded series of ethanol solutions, and washed in TBS for 5 min three times. Sections were incubated with 0.3% H2O2 for 15 min. To prevent nonspecific binding of antibody, sections were incubated for 30 min at room temperature with a blocking solution containing TBS, 1% bovine serum albumin and 2.5% goat serum. Rabbit anti-mouse collagen I (Biodesign International, Kennebunk, ME) was diluted 1:50 and incubated overnight at 4 C. The secondary antibody was horseradish peroxidase-linked donkey anti-rabbit IgG (1:100; Amersham Pharmacia Biotech, Buckinghamshire, UK). The Vector VIP substrate kit (Vector Laboratories, Burlingame, CA) was used as the chromogenic substrate, which produces a purple reaction. Sections were counterstained with hematoxylin. 2.6. Immunofluorescence assay for anti-nuclear antibodies Blood was collected by retro-orbital puncture at 23 weeks of age. Serum was prepared by centrifugation at 4 C, and stored frozen at ÿ70 C until use. Serum ANA titers were determined by monitoring binding of serially diluted samples to HEp-2 slides (Fluoro HEPANA Test; MBL, Nagoya, Japan). Sera were added for 30 min at 37 C in a moist chamber. The slides were then washed extensively in PBS, incubated for 30 min at 37 C with a FITC-conjugated anti-mouse immunoglobulin (DAKO A/S, Glostrup, Denmark), and examined by fluorescence microscopy (BH2-RFCA; Olympus, Tokyo, Japan). Specific fluorescence at a serum dilution of O1:40 was considered positive [22]. 2.7. ELISPOT assay The frequency of IFN-g- and IL-4-secreting cells in the spleen was assessed using mouse cytokine ELISPOT kits as recommended by the manufacturer (Mabtech, Nacka, Sweden). In brief, 96-well plates (MAIPS 4510; Millipore, Bedford, MA) were coated with 10 mg/ml of capture antibody overnight at 4 C. Plates were then blocked with RPMI 1640 supplemented with L-glutamine, penicillin, streptomycin and 10% FCS for 2 h at 37 C. Freshly isolated spleen cells were serially diluted onto the pre-coated plates with 4e20!104 cells/ well in triplicate. The cells were incubated at 37 C in 5% CO2 in the presence or absence of stimulators including plasmids (6 mg/ml) or Con A (5 mg/ml). The assay was optimized to detect fine spots so that the cells were incubated at 37 C in 5% CO2 for 48 h. After washing with 0.025% Tween 20 in PBS, 1 mg/ml of biotinylated
185
detection antibody was added for 2 h at room temperature. Washed plates were treated with 1:1000 dilution of streptavidin-alkaline phosphatase for 1 h and then with BCIP/NBT (KPL, Gaithersburg, MD). Spots were counted with KS ELISPOT system (Carl Zeiss, Tokyo, Japan) and expressed as numbers per million spleen cells. 2.8. ELISA Spleen cells (5!105 cells/well) were cultured in triplicate with medium alone or with 6 mg/ml of plasmids for 48 h in 96-well flat-bottom plates. Concentrations of IL-6 in culture supernatants were determined using a sandwich ELISA kit (eBioscience Inc., San Diego, CA). 2.9. Statistical analysis Statistical significance between groups was measured using ManneWhitney’s U test for all the experiments. P!0.05 was considered to be significant.
3. Results 3.1. Prevention of skin fibrosis by administration with pB-CpG20 To examine the curative effects of pB-CpG20 on the development of scleroderma-like syndrome, pB-CpG20 was injected intramuscularly into Tsk/Cmice starting at 1 week of age. The treatment consisted of seven injections at 3-week intervals. By 23 weeks of age, histological analysis of skin demonstrated that pBCpG20 treatment reduced dermis width, whereas salineor pB-treated Tsk/Cmice displayed apparent dermal thickening compared with C57BL/6 pa/pa mice (Fig. 1). Since the skin thickening in Tsk/Cmice is the result of increased synthesis and accumulation of collagen, skin collagen staining was examined. In contrast to pa/pa mice, Tsk/Cmice treated with saline or pB displayed cutaneous hyperplasia characterized by increased deposition of collagen (red) in the dermis extending to the panniculus carnosus (Fig. 2, upper panel). Reduced collagen content was observed in the dermis of pBCpG20-treated Tsk/Cmice. Furthermore, immunohistochemistry for collagen type I was analyzed because the increase in collagen type I is mainly associated with skin abnormality in Tsk/Cmice [23]. As seen in Fig. 2 (lower panel), immunohistochemistry showed decreased amounts of collagen type I content in pB-CpG20treated mice compared with those in other control Tsk/ Cmice. Dermal thickness measured by light microscopy also revealed that by 23 weeks of age a significant reduction was caused by pB-CpG20 treatment among
186
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
the Tsk/Cmice treated with saline or pB were ANApositive, whereas only 43% (3/7) of pB-CpG20-treated mice showed ANA-positive (Fig. 3). ANA levels in pBCpG20-treated mice were significantly lower than those in saline-treated Tsk/Cmice (P!0.05). These results suggest that early treatment with pB-CpG20 did not entirely inhibit ANA production, but reduced or delayed the production. Lungs from all the treated Tsk/Cmice displayed enlarged alveolar spaces compared with pa/pa littermates, which reflected the development of sclerodermaassociated emphysema (data not shown). This finding is consistent with the inability of other therapies to affect pulmonary complication in Tsk/Cmice [3,7]. 3.3. Effects of pB-CpG20 treatment on IFN-g and IL-4 production
Fig. 1. Histopathology of dorsal skin from C57BL/6 pa/pa and the treated Tsk/Cmice. Tsk/Cmice were treated seven times at 3-week intervals with saline (Tsk/Csaline), pB (Tsk/CpB), and pB-CpG20 (Tsk/CpB-CpG20) starting at 1 week of age. pa/pa littermates were untreated as control. Representative paraffin-embedded sections stained with hematoxylin/eosin are shown (magnification !20) from the mice at 23 weeks of age. Scale bar:100 mm.
the Tsk/Cgroups (Table 1) (P!0.05, pB-CpG20 compared to saline or pB). The reduction in skin thickness was observed even at 32 weeks, 13 weeks after the seventh administration (Table 1) (P!0.05, pBCpG20 compared to saline or pB). These results suggest that repeatedly administering pB-CpG20 to young Tsk/Cmice every 3 weeks attenuated skin fibrosis and the attenuation is long lasting even after the termination of the treatment.
3.2. Effects of pB-CpG20 treatment on the production of ANA and lung emphysema For other manifestations of scleroderma-like syndrome in Tsk/Cmice, serum ANA levels and lung histology were analyzed. Indirect immunofluorescent staining of HEp-2 cells was used to evaluate the incidence and titers of ANA. At 23 weeks of age, all
The effect of pB-CpG20 treatment of Tsk/Cmice on the Th1/Th2 balance was investigated by examining the frequency of IFN-g- and IL-4-secreting cells in the spleen at 20 weeks of age, 1 week after the final administration. As shown in Fig. 4A, there were significantly more spleen cells spontaneously secreting IFN-g in pB-CpG20-treated mice than in saline-treated mice (P!0.05). When stimulated with Con A in vitro, the increased frequency of cells secreting IFN-g was also observed in pB-CpG20-treated mice compared to salinetreated mice (P!0.05). Although pB-CpG20 treatment had no effect on spontaneous IL-4 production, a significant decrease in the number of cells available to secrete that cytokine was uncovered by in vitro stimulation with Con A compared to saline treatment (P!0.05). One week after the final administration, the ratio of cells spontaneously secreting IFN-g:IL-4 was approximately 2:1 in pB-CpG20-treated mice, while the ratio was about 1:1 in saline- or pB-treated mice. When stimulated with Con A in vitro, the ratio of cells secreting IFN-g:IL-4 in pB-CpG20-treated mice was 3.5-fold higher than that in saline-treated mice. Although no significant difference in the number of IFN-g-secreting cells regardless of the stimulation with Con A was found between pB-treated mice and pB-CpG20-treated mice, the ratio of cells secreting IFN-g:IL-4 in pB-CpG20treated mice was 2-fold higher than in pB-treated mice. These findings suggest that pB-CpG20 treatment of Tsk/Cmice increased the number of cells actively secreting IFN-g while reducing the number available to secrete IL-4 in vivo. To examine the impact of single administration of pB-CpG20 on cytokine production, 6e8-week-old naive Tsk/Cmice were injected 1 week prior to ELISPOT assay. Unexpectedly, no significant difference in the number of either IFN-g- or IL-4-secreting cells was detected among the Tsk/Cgroups with or without Con A stimulation (Fig. 4B). Taken together, these results
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
187
Fig. 2. Collagen expression in dorsal skin from C57BL/6 pa/pa and the treated Tsk/Cmice. Tsk/Cmice were treated with saline (Tsk/Csaline), pB (Tsk/CpB), and pB-CpG20 (Tsk/CpB-CpG20). At the age of 23 weeks, dorsal skins were taken and prepared for collagen staining with sirius red and fast green FCF as a counterstain (upper panel, magnification !20) or for immunohistochemistry using anti-mouse collagen type I antibody (lower panel, magnification !10). Upper panel: collagen and non-collagenous proteins were colored red and blue, respectively; Lower panel: collagen type I and nuclei were colored purple and blue, respectively.
suggest that a single administration of pB-CpG20 to Tsk/Cmice is insufficient to skew cytokine profile toward Th1, but repeated administration can improve the Th1:Th2 cytokine balance by cumulative effects. 3.4. Effects of plasmids containing CpG motifs on cytokine production by spleen cells in vitro Next we examined cytokine profile of spleen cells from 6e8-week-old naive Tsk/Cmice in the presence or absence of plasmids in vitro. As shown in Fig. 5A,B, pB-CpG20 increased significantly the number of IFN-gsecreting cells, but reduced that of IL-4-secreting cells compared to medium alone. Furthermore, pB-CpG20 did not affect IL-6 production (Fig. 5C). pB induced the similar cytokine pattern to pB-CpG20 possibly because pB also contains six CpG motifs in its backbone [20]. All the reagents exhibited the same effects on the spleen cells of pa/pa littermates (data not shown).
4. Discussion Gene vaccination is a promising vaccine strategy with some advantages such as ease of manufacture, long-lived efficacy and few harmful effects [24]. Gene vaccination with plasmid DNA induces preferentially a Th1-type immune response. It has been demonstrated that the adjuvanticity of plasmid DNA for gene vaccination is related to immunostimulatory sequences with CpG motifs in a plasmid backbone [25]. The Th1-biased immune response can be augmented by the addition of immunostimulatory CpG motifs to the plasmid backbone. Therefore, modifying a plasmid vector by the introduction of immunostimulatory sequences would be
Table 1 Skin thickness in C57BL/6 pa/pa mice and Tsk/Cmice treated with saline, pB or pB-CpG20a Group
C57BL/6 pa/pa Tsk/Csaline Tsk/CpB Tsk/CpB-CpG20 a
N
8 7 5 7
Dermal thickness (mm) Age (23 weeks)
Age (32 weeks)
323G22 401G26 404G37 360G30b
247G24 278G23 308G29 245G15b
Skin sections from the interscapular region (23 weeks) and dorsum immediately below the neck (32 weeks) were stained with hematoxylin/ eosin, and dermal thickness was measured under a light microscope. Values are shown as the meanGSD. b P!0.05 as compared with Tsk/Csaline and Tsk/CpB.
Fig. 3. Serum levels of ANA from the treated Tsk/Cmice. Tsk/Cmice were treated with saline (Tsk/Csaline), pB (Tsk/CpB), and pB-CpG20 (Tsk/CpB-CpG20). Sera were collected at the age of 23 weeks. ANA were determined by immunofluorescence staining using HEp-2 cells as the substrate. ANA titers are evaluated by scoring serum dilutions (from 1:20 to 1:320) and higher titer is defined as detectable in more dilution. Each circle indicates the ANA titer of an individual mouse and black circles mean positive response. *P!0.05.
188
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
Fig. 4. The number of IFN-g- and IL-4-secreting cells in the spleen of the treated Tsk/Cmice. ELISPOT assays were performed on single cell suspensions of spleen cells (A) from the Tsk/Cmice 1 week after the final administration or (B) from 6e8-week-old Tsk/Cmice receiving a single administration 1 week prior to sacrifice. Untreated C57BL/6 pa/pa littermates were used as control. Spleen cells were incubated in the absence (ÿ) or presence of Con A (5 mg/ml). The frequency of IFN-g- and IL-4-secreting cells per million spleen cells is shown. Each bar shows the meanGSD values for three individual mice per group. Data are representative of three independent experiments. *P!0.05.
very important to induce a potent Th1 immune response. Our previous study demonstrated that co-administration of a plasmid enriched in CpG content enhanced the immunogenicity of HIV-1 DNA vaccine in a CpG copiesdependent manner [20]. pB-CpG20 containing additional 20 CpG copies, the most effective immune enhancer in the experiment, was selected in the present study. This report is the first to demonstrate that administration of a CpGenriched plasmid (not coding any protein) is able to prevent skin thickening and skin collagen deposition in Tsk/Cmice. Previous studies indicate that IL-4 induces the upregulation of Type I collagen gene expression in murine fibroblasts, while IFN-g inhibits fibroblast collagen synthesis [4,26]. In keeping with the opposing effects of IL-4 and IFN-g on collagen synthesis, the prevention of dermal fibrosis caused by pB-CpG20 administration was accompanied by an increase in the number of IFN-gsecreting cells and a decrease in that of IL-4-secreting cells. IFN-g induction and IL-4 down-regulation by
pB-CpG20 treatment may be a key factor mediating the abrogation of skin fibrosis in Tsk/Cmice. It has been reported that serum levels of autoantibodies closely correlate with the development of skin fibrosis in Tsk/Cmice and with disease severity and activity in patients with scleroderma [27,28]. Recent studies demonstrate that CD19 signaling is constitutively augmented in B cells from Tsk/Cmice and patients of systemic sclerosis [29,30]. In addition, IL-6 overproduction by abnormal Tsk/CB cells has been proposed possibly responsible for skin sclerosis and ANA production. Our experiments showed that pB-CpG20 induced IFN-g, but did not enhance the production of IL-4 and IL-6, which could explain the partial inhibitory effect of pB-CpG20 on the production of ANA. We failed to prevent the development of lung emphysema by stimulating Th1 immune response and the result is consistent with the inability of other therapies [3,7]. Lung abnormality in Tsk/Cmice is likely due to factors other than Th2 cytokines. In fact, Saito and others reported
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
189
There are hardly any therapeutic options in patients with scleroderma presently. Thus, a form of economical therapy that could ameliorate the manifestations of this disease would be of considerable public health benefit. Plasmid DNA has several properties that make it especially appealing in gene therapy; plasmid DNA is safe to use and there is a potential for low-cost production and administration. CpG-enriched plasmids have been applied in DNA vaccine for large animals such as cattle and pig [21,33]. Optimizing the number of immunostimulatory sequences and the exact sequences could enhance the potency of CpG-enriched plasmids. In this context, plasmid DNA is suitable for engineering multiple copies of improved immunostimulatory sequences into its backbone. Although administration of CpG-enriched plasmid demonstrated potential to ameliorate Tsk/Csyndrome as well as CpG ODN, further studies are needed to examine whether similar efficacy can be found in patients with scleroderma. In summary, this study demonstrates that treatment with a plasmid enriched in CpG content can prevent the development of scleroderma-like syndrome by preferentially promoting Th1-biased immune responses.
Acknowledgements
Fig. 5. Production of cytokines by spleen cells stimulated with plasmids. (A,B) Spleen cells from naive Tsk/Cmice were incubated with medium or with 6 mg/ml of plasmids. The number of cells secreting IFN-g (A) and IL-4 (B) was determined by ELISPOT. (C) Spleen cells (5!105/well) were cultured with plasmids as above. After 48 h, the culture supernatants were harvested and analyzed for IL-6 levels by ELISA. Each bar shows the meanGSD values for 3e5 mice. *P!0.05 as compared with medium.
that lung emphysema may be controlled by a different gene that cosegregates with mutated Fbn-1 [31]. Different CpG motif sequences can induce dramatically different profiles of immune activation [14]. Immunostimulatory CpG motifs in pB-CpG20 can induce a potent Th1 immune response with little effect on B cells [32]. As expected, pB-CpG20 induced the production of IFN-g, but not IL-6 in vitro. This provides an advantage to avoid the risk for the enhancement of ANA production by abnormal B cells in Tsk/Cmice. pB showed the same potential to induce cytokines as pB-CpG20 in vitro. However, unlike pB-CpG20, no curative effect was caused by pB administration in vivo. The ANA levels in pB-treated mice seemed to be relatively, but not significantly, lower than those in saline-treated mice. This tendency might be caused by CpG motifs existing in the plasmid backbone. These results indicate that the additional 20 CpG copies are crucial to ameliorate the Tsk syndrome.
This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan to M. Ichino and M. Nakazawa (13670466).
References [1] Green MC, Sweet HO, Bunker LE. Tight-skin, a new mutation of the mouse causing excessive growth of connective tissue and skeleton. Am J Pathol 1976;82:493e512. [2] Bona C, Rothfield N. Autoantibodies in scleroderma and tight skin mice. Curr Opin Immunol 1994;6:931e7. [3] McGaha T, Saito S, Phelps RG, Gordon R, Noben-Trauth N, Paul WE, et al. Lack of skin fibrosis in tight skin (TSK) mice with targeted mutation in the interleukin-4R alpha and transforming growth factor-beta genes. J Invest Dermatol 2001;116:136e43. [4] McGaha TL, Le M, Kodera T, Stoica C, Zhu J, Paul WE, et al. Molecular mechanisms of interleukin-4-induced up-regulation of type I collagen gene expression in murine fibroblasts. Arthritis Rheum 2003;48:2275e84. [5] Kodera T, McGaha TL, Phelps R, Paul WE, Bona CA. Disrupting the IL-4 gene rescues mice homozygous for the tight-skin mutation from embryonic death and diminishes TGFbeta production by fibroblasts. Proc Natl Acad Sci U S A 2002;99:3800e5. [6] Ong C, Wong C, Roberts CR, Teh HS, Jirik FR. Anti-IL-4 treatment prevents dermal collagen deposition in the tight-skin mouse model of scleroderma. Eur J Immunol 1998;28:2619e29. [7] Tsuji-Yamada J, Nakazawa M, Takahashi K, Iijima K, Hattori S, Okuda K, et al. Effect of IL-12 encoding plasmid administration on tight-skin mouse. Biochem Biophys Res Commun 2001; 280:707e12.
190
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
[8] Needleman BW. Immunologic aspects of scleroderma. Curr Opin Rheumatol 1992;4:862e8. [9] Postlethwaite AE. Role of T cells and cytokines in effecting fibrosis. Int Rev Immunol 1995;12:247e58. [10] Hasegawa M, Fujimoto M, Kikuchi K, Takehara K. Elevated serum levels of interleukin 4 (IL-4), IL-10, and IL-13 in patients with systemic sclerosis. J Rheumatol 1997;24:328e32. [11] Grassegger A, Schuler G, Hessenberger G, Walder-Hantich B, Jabkowski J, MacHeiner W, et al. Interferon-gamma in the treatment of systemic sclerosis: a randomized controlled multicentre trial. Br J Dermatol 1998;139:639e48. [12] Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 1995;374:546e9. [13] Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, et al. A Toll-like receptor recognizes bacterial DNA. Nature 2000;408:740e5. [14] Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 2002;20:709e60. [15] Klinman DM, Verthelyi D, Takeshita F, Ishii KJ. Immune recognition of foreign DNA: a cure for bioterrorism? Immunity 1999;11:123e9. [16] Kline JN, Waldschmidt TJ, Businga TR, Lemish JE, Weinstock JV, Thorne PS, et al. Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J Immunol 1998;160:2555e9. [17] Zimmermann S, Egeter O, Hausmann S, Lipford GB, Rocken M, Wagner H, et al. CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J Immunol 1998;160:3627e30. [18] Sur S, Wild JS, Choudhury BK, Sur N, Alam R, Klinman DM. Long term prevention of allergic lung inflammation in a mouse model of asthma by CpG oligodeoxynucleotides. J Immunol 1999;162:6284e93. [19] Klinman DM, Ishii KJ, Verthelyi D. CpG DNA augments the immunogenicity of plasmid DNA vaccines. Curr Top Microbiol Immunol 2000;247:131e42. [20] Kojima Y, Xin KQ, Ooki T, Hamajima K, Oikawa T, Shinoda K, et al. Adjuvant effect of multi-CpG motifs on an HIV-1 DNA vaccine. Vaccine 2002;20:2857e65. [21] Pontarollo RA, Babiuk LA, Hecker R, Van Drunen Littel-Van Den Hurk S. Augmentation of cellular immune responses to bovine herpesvirus-1 glycoprotein D by vaccination with CpGenhanced plasmid vectors. J Gen Virol 2002;83:2973e81.
[22] Bocchieri MH, Henriksen PD, Kasturi KN, Muryoi T, Bona CA, Jimenez SA. Evidence for autoimmunity in the tight skin mouse model of systemic sclerosis. Arthritis Rheum 1991;34:599e605. [23] Jimenez SA, Williams CJ, Myers JC, Bashey RI. Increased collagen biosynthesis and increased expression of type I and type III procollagen genes in tight skin (TSK) mouse fibroblast. J Biol Chem 1986;261:657e62. [24] Tighe H, Corr M, Roman M, Raz E. Gene vaccination: plasmid DNA is more than just a blueprint. Immunol Today 1998;19: 89e97. [25] Sato Y, Roman M, Tighe H, Lee D, Corr M, Nguyen MD, et al. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 1996;273:352e4. [26] Serpier H, Gillery P, Salmon-Her V, Garnotel R, Georges N, Kalis B, et al. Antagonistic effects of interferon-gamma and interleukin-4 on fibroblast cultures. J Invest Dermatol 1997;109: 158e62. [27] Hatakeyama A, Kasturi KN, Wolf I, Phelps RG, Bona CA. Correlation between the concentration of serum anti-topoisomerase I autoantibodies and histological and biochemical alterations in the skin of tight skin mice. Cell Immunol 1996;167:135e40. [28] Hu PQ, Fertig N, Medsger Jr TA, Wright TM. Correlation of serum anti-DNA topoisomerase I antibody levels with disease severity and activity in systemic sclerosis. Arthritis Rheum 2003;48:1363e73. [29] Sato S, Hasegawa M, Fujimoto M, Tedder TF, Takehara K. Quantitative genetic variation in CD19 expression correlates with autoimmunity. J Immunol 2000;165:6635e43. [30] Saito E, Fujimoto M, Hasegawa M, Komura K, Hamaguchi Y, Kaburagi Y, et al. CD19-dependent B lymphocyte signaling thresholds influence skin fibrosis and autoimmunity in the tightskin mouse. J Clin Invest 2002;109:1453e62. [31] Saito S, Nishimura H, Phelps RG, Wolf I, Suzuki M, Honjo T, et al. Induction of skin fibrosis in mice expressing a mutated fibrilin-1 gene. Mol Med 2000;6:825e36. [32] Wooldridge JE, Ballas Z, Krieg AM, Weiner GJ. Immunostimulatory oligodeoxynucleotides containing CpG motifs enhance the efficacy of monoclonal antibody therapy of lymphoma. Blood 1997;89:2994e8. [33] Yu. H, Babiuk LA, Van Drunen Littel-Van Den Hurk S. Priming with CpG-enriched plasmid and boosting with protein formulated with CpG oligodeoxynucleotides and Quil A induces strong cellular and humoral immune responses to hepatitis C virus NS3. J Gen Virol 2004;85:1533e43.
Therapeutic effect of CpG-enriched plasmid administration on the tight-skin mouse model of scleroderma Yan Shena, Motohide Ichinoa, Masatoshi Nakazawaa, Takashi Ikejimab, Yoshitsugu Kojimac, Kenji Okudac, Mutsuhiko Minamia,* a
Department of Immunology, Yokohama City University School of Medicine, Fukuura 3-9, Kanazawa-ku, Yokohama, Kanagawa 236-0004, Japan b China-Japan Research Institute of Medical and Pharmaceutical Science, Shenyang Pharmaceutical University, Shenyang, China c Department of Molecular Biodefense Research, Yokohama City University School of Medicine, Yokohama, Japan Received 13 October 2004; revised 6 December 2004; accepted 5 January 2005
Abstract Immunostimulatory CpG motifs can preferentially induce Th1 immune responses and have been applied to treat Th2-dominant disease. In this study, we investigated whether a plasmid with the addition of 20 copies of an immunostimulatory CpG motif (pBCpG20) might prevent the development of scleroderma-like syndrome in tight-skin (Tsk/C) mice. Administration of pB-CpG20 to Tsk/Cmice every 3 weeks starting at the age of 1 week reduced skin thickness and collagen content compared to that of pB or saline. The reduction was long lasting even after halting the treatment. Furthermore, this treatment partially reduced the production of anti-nuclear antibodies although it did not decrease the incidence of lung emphysema. pB-CpG20 increased the number of spleen cells secreting IFN-g and reduced that of the cells secreting IL-4 in vivo and in vitro compared to saline. These results suggest that repeated administration of a CpG-enriched plasmid can ameliorate scleroderma-like syndrome by biasing Th1 immunity in young Tsk/Cmice. Ó 2005 Elsevier Ltd. All rights reserved. Keywords: CpG motif; Plasmid; Scleroderma; Th1; Tight-skin mouse
1. Introduction Scleroderma is an autoimmune connective tissue disease characterized by fibrosis of the skin and internal organs, and the presence of anti-nuclear antibodies (ANA). Tight-skin (Tsk/C) mice represent an animal model for scleroderma [1]. They spontaneously develop a syndrome including cutaneous hyperplasia, lung emphysema and ANA specific for topoisomerase I, RNA polymerase I and fibrilin-1 [1,2]. Recent studies suggest * Corresponding author. Tel.: C81 45 787 2612; fax: C81 45 787 2509. E-mail address: [email protected] (M. Minami). 0896-8411/$ - see front matter Ó 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.jaut.2005.01.014
that IL-4 and/or transforming growth factor-b may play an important role in the fibrogenesis of Tsk/Cmice [3e 5], and the progression of the disease can be prevented by suppressing Th2 responses or normalizing the Th1/ Th2 balance in vivo [6,7]. Patients with systemic sclerosis have elevated serum levels of IL-4 and increased numbers of IL-4-producing T cells [8e10]. Recombinant IFN-g has been clinically attempted to treat these patients, resulting in mild beneficial effects on skin sclerosis and disease-associated symptoms in scleroderma [11]. It is widely accepted that CpG motifs frequently existing in microbial DNA are immunostimulatory and able to elicit a Th1-biased immune response when
184
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
recognized by Toll-like receptor 9 [12,13]. Bacterial DNA and synthetic oligodeoxynucleotides (ODN) containing CpG motifs can trigger B cells, NK cells and macrophages to proliferate, activate and secrete a variety of cytokines, including IL-12, IFN-g, IL-6 and TNFa [12,14,15]. CpG ODN have been used as immunomodulatory agents and/or adjuvants to treat or prevent Th2-driven diseases [16e18]. In our early study, we administered CpG ODN to Tsk/Cmice starting at 1 week of age and observed a long-term inhibitory effect on the development of skin fibrosis (Y. Shen, in preparation). Recently there is considerable interest in studying the therapeutic benefit of a CpG-enriched plasmid based on its economics and stability [19]. We previously examined the adjuvant effect of plasmids containing 5e20 copies of an immunostimulatory CpG motif when coadministered with HIV-1 DNA vaccine, and found that the plasmids containing 20 CpG copies most effectively augmented cytotoxic T lymphocyte activity, delayed type hypersensitivity and IFN-g production [20]. Moreover, other investigators showed that addition of immunostimulatory CpG motifs to the plasmid backbone can enhance its adjuvant activity as a Th1 trigger [21]. However, it is unclear whether a plasmid enriched in CpG content itself might be of therapeutic effect on Th2-driven autoimmune diseases. Hence, we investigated the efficacy of a CpG-enriched plasmid as an approach to treat scleroderma-like disease. Our results indicate that administration of a plasmid containing 20 CpG copies reduced the development of skin fibrosis compared to that of control plasmid or saline, and partially reduced the production of ANA in Tsk/Cmice.
2. Materials and methods 2.1. Plasmids pB-CpG20 was constructed as described previously [20]. In brief, an ODN fragment containing five CpG motifs (5#-GATATCTCTCCCAGCGTGCGCCATTC TCCCAGCGTGCGCCATTCTCCCAGCGTGCGCCA TTCTCCCAGCGTGCGCCATTCTCCCAGCGTGCG CCAGAATTC-3#) and its complement sequence were synthesized by Sawaday Technology (Tokyo, Japan). Restricted enzyme sites for EcoRV and EcoRI were linked at the 5#- and 3#-ends of the fragment, respectively. Annealed double-stranded fragments were digested with EcoRV and EcoRI and subcloned into pBluescript KS (ÿ) (pB) (Stratagene, La Jolla, CA, GenBank no. X52329). pB-CpG20 was obtained by inserting 20 copies of a CpG motif between the EcoRV and EcoRI sites. The sequence was confirmed by DNA sequencing. Plasmids were purified from Escherichia coli strain DH5a using Endofree plasmid maxi kit (QIAGEN
GmbH, Hilden, Germany), resuspended in sterile endotoxin-free water, and stored at 4 C.
2.2. Mice and treatment Tsk/Cand C57BL/6 pa/pa mice were purchased from Jackson Laboratories (Bar Harbor, ME) and maintained under specific pathogen free conditions at the animal facility of Yokohama City University School of Medicine (Yokohama, Japan). Mice were handled in accordance with institutional animal care and use committee protocols approved by the facility. Tsk/Cmice were produced by mating Tsk/Cmale with pa/pa female mice. Neonatal Tsk/Cmice were distinguished from pa/pa littermates by their black skin and eye color. Mice were injected with 100 ml of pB or pB-CpG20 (50 mg/mouse, respectively) or saline in both quadriceps muscles seven times at 3 week intervals starting at 1 week of age. In some experiments, 6e8-week-old naive mice were injected 1 week before sacrifice for ELISPOT assay. Male Tsk/Cmice were used for experiments.
2.3. Preparation of sections and histological analysis Skin samples were removed and processed as described previously [7]. As skin thickness varies from site to site, skin sections were taken from the same anatomic site to minimize regional variations in thickness. Briefly, 25 mm2 fragments of skin from the interscapular region (23 weeks old) or dorsum immediately below the neck (32 weeks old) were removed and fixed in 10% formalin for 30 h. Specimens were then gradually dehydrated in alcohol and embedded in paraffin. Sections were cut perpendicular to the skin surface and stained with hematoxylin and eosin. Skin thickness was measured from the top of the granular layer to the junction between the dermis and subcutaneous fat using an ocular micrometer. Ten random measurements were taken per section, and the average dermal thickness was calculated. The lungs were removed after sacrifice and processed by the same method described above. The extent of airspace was analyzed on hematoxylin/eosin stained sections. In all the experiments the measurement was performed in a blinded method.
2.4. Collagen staining Differential staining of collagenous and noncollagenous proteins was performed on paraffin sections with 0.1% sirius red with 0.1% fast green FCF as a counter-stain, in saturated picric acid. Collagen is stained red by this procedure.
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
2.5. Immunohistochemistry of collagen type I Immunostaining was performed on 3 mm thick consecutive sections obtained from paraffin-embedded skin samples. Briefly, the sections were deparaffinized in xylene, rehydrated through a graded series of ethanol solutions, and washed in TBS for 5 min three times. Sections were incubated with 0.3% H2O2 for 15 min. To prevent nonspecific binding of antibody, sections were incubated for 30 min at room temperature with a blocking solution containing TBS, 1% bovine serum albumin and 2.5% goat serum. Rabbit anti-mouse collagen I (Biodesign International, Kennebunk, ME) was diluted 1:50 and incubated overnight at 4 C. The secondary antibody was horseradish peroxidase-linked donkey anti-rabbit IgG (1:100; Amersham Pharmacia Biotech, Buckinghamshire, UK). The Vector VIP substrate kit (Vector Laboratories, Burlingame, CA) was used as the chromogenic substrate, which produces a purple reaction. Sections were counterstained with hematoxylin. 2.6. Immunofluorescence assay for anti-nuclear antibodies Blood was collected by retro-orbital puncture at 23 weeks of age. Serum was prepared by centrifugation at 4 C, and stored frozen at ÿ70 C until use. Serum ANA titers were determined by monitoring binding of serially diluted samples to HEp-2 slides (Fluoro HEPANA Test; MBL, Nagoya, Japan). Sera were added for 30 min at 37 C in a moist chamber. The slides were then washed extensively in PBS, incubated for 30 min at 37 C with a FITC-conjugated anti-mouse immunoglobulin (DAKO A/S, Glostrup, Denmark), and examined by fluorescence microscopy (BH2-RFCA; Olympus, Tokyo, Japan). Specific fluorescence at a serum dilution of O1:40 was considered positive [22]. 2.7. ELISPOT assay The frequency of IFN-g- and IL-4-secreting cells in the spleen was assessed using mouse cytokine ELISPOT kits as recommended by the manufacturer (Mabtech, Nacka, Sweden). In brief, 96-well plates (MAIPS 4510; Millipore, Bedford, MA) were coated with 10 mg/ml of capture antibody overnight at 4 C. Plates were then blocked with RPMI 1640 supplemented with L-glutamine, penicillin, streptomycin and 10% FCS for 2 h at 37 C. Freshly isolated spleen cells were serially diluted onto the pre-coated plates with 4e20!104 cells/ well in triplicate. The cells were incubated at 37 C in 5% CO2 in the presence or absence of stimulators including plasmids (6 mg/ml) or Con A (5 mg/ml). The assay was optimized to detect fine spots so that the cells were incubated at 37 C in 5% CO2 for 48 h. After washing with 0.025% Tween 20 in PBS, 1 mg/ml of biotinylated
185
detection antibody was added for 2 h at room temperature. Washed plates were treated with 1:1000 dilution of streptavidin-alkaline phosphatase for 1 h and then with BCIP/NBT (KPL, Gaithersburg, MD). Spots were counted with KS ELISPOT system (Carl Zeiss, Tokyo, Japan) and expressed as numbers per million spleen cells. 2.8. ELISA Spleen cells (5!105 cells/well) were cultured in triplicate with medium alone or with 6 mg/ml of plasmids for 48 h in 96-well flat-bottom plates. Concentrations of IL-6 in culture supernatants were determined using a sandwich ELISA kit (eBioscience Inc., San Diego, CA). 2.9. Statistical analysis Statistical significance between groups was measured using ManneWhitney’s U test for all the experiments. P!0.05 was considered to be significant.
3. Results 3.1. Prevention of skin fibrosis by administration with pB-CpG20 To examine the curative effects of pB-CpG20 on the development of scleroderma-like syndrome, pB-CpG20 was injected intramuscularly into Tsk/Cmice starting at 1 week of age. The treatment consisted of seven injections at 3-week intervals. By 23 weeks of age, histological analysis of skin demonstrated that pBCpG20 treatment reduced dermis width, whereas salineor pB-treated Tsk/Cmice displayed apparent dermal thickening compared with C57BL/6 pa/pa mice (Fig. 1). Since the skin thickening in Tsk/Cmice is the result of increased synthesis and accumulation of collagen, skin collagen staining was examined. In contrast to pa/pa mice, Tsk/Cmice treated with saline or pB displayed cutaneous hyperplasia characterized by increased deposition of collagen (red) in the dermis extending to the panniculus carnosus (Fig. 2, upper panel). Reduced collagen content was observed in the dermis of pBCpG20-treated Tsk/Cmice. Furthermore, immunohistochemistry for collagen type I was analyzed because the increase in collagen type I is mainly associated with skin abnormality in Tsk/Cmice [23]. As seen in Fig. 2 (lower panel), immunohistochemistry showed decreased amounts of collagen type I content in pB-CpG20treated mice compared with those in other control Tsk/ Cmice. Dermal thickness measured by light microscopy also revealed that by 23 weeks of age a significant reduction was caused by pB-CpG20 treatment among
186
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
the Tsk/Cmice treated with saline or pB were ANApositive, whereas only 43% (3/7) of pB-CpG20-treated mice showed ANA-positive (Fig. 3). ANA levels in pBCpG20-treated mice were significantly lower than those in saline-treated Tsk/Cmice (P!0.05). These results suggest that early treatment with pB-CpG20 did not entirely inhibit ANA production, but reduced or delayed the production. Lungs from all the treated Tsk/Cmice displayed enlarged alveolar spaces compared with pa/pa littermates, which reflected the development of sclerodermaassociated emphysema (data not shown). This finding is consistent with the inability of other therapies to affect pulmonary complication in Tsk/Cmice [3,7]. 3.3. Effects of pB-CpG20 treatment on IFN-g and IL-4 production
Fig. 1. Histopathology of dorsal skin from C57BL/6 pa/pa and the treated Tsk/Cmice. Tsk/Cmice were treated seven times at 3-week intervals with saline (Tsk/Csaline), pB (Tsk/CpB), and pB-CpG20 (Tsk/CpB-CpG20) starting at 1 week of age. pa/pa littermates were untreated as control. Representative paraffin-embedded sections stained with hematoxylin/eosin are shown (magnification !20) from the mice at 23 weeks of age. Scale bar:100 mm.
the Tsk/Cgroups (Table 1) (P!0.05, pB-CpG20 compared to saline or pB). The reduction in skin thickness was observed even at 32 weeks, 13 weeks after the seventh administration (Table 1) (P!0.05, pBCpG20 compared to saline or pB). These results suggest that repeatedly administering pB-CpG20 to young Tsk/Cmice every 3 weeks attenuated skin fibrosis and the attenuation is long lasting even after the termination of the treatment.
3.2. Effects of pB-CpG20 treatment on the production of ANA and lung emphysema For other manifestations of scleroderma-like syndrome in Tsk/Cmice, serum ANA levels and lung histology were analyzed. Indirect immunofluorescent staining of HEp-2 cells was used to evaluate the incidence and titers of ANA. At 23 weeks of age, all
The effect of pB-CpG20 treatment of Tsk/Cmice on the Th1/Th2 balance was investigated by examining the frequency of IFN-g- and IL-4-secreting cells in the spleen at 20 weeks of age, 1 week after the final administration. As shown in Fig. 4A, there were significantly more spleen cells spontaneously secreting IFN-g in pB-CpG20-treated mice than in saline-treated mice (P!0.05). When stimulated with Con A in vitro, the increased frequency of cells secreting IFN-g was also observed in pB-CpG20-treated mice compared to salinetreated mice (P!0.05). Although pB-CpG20 treatment had no effect on spontaneous IL-4 production, a significant decrease in the number of cells available to secrete that cytokine was uncovered by in vitro stimulation with Con A compared to saline treatment (P!0.05). One week after the final administration, the ratio of cells spontaneously secreting IFN-g:IL-4 was approximately 2:1 in pB-CpG20-treated mice, while the ratio was about 1:1 in saline- or pB-treated mice. When stimulated with Con A in vitro, the ratio of cells secreting IFN-g:IL-4 in pB-CpG20-treated mice was 3.5-fold higher than that in saline-treated mice. Although no significant difference in the number of IFN-g-secreting cells regardless of the stimulation with Con A was found between pB-treated mice and pB-CpG20-treated mice, the ratio of cells secreting IFN-g:IL-4 in pB-CpG20treated mice was 2-fold higher than in pB-treated mice. These findings suggest that pB-CpG20 treatment of Tsk/Cmice increased the number of cells actively secreting IFN-g while reducing the number available to secrete IL-4 in vivo. To examine the impact of single administration of pB-CpG20 on cytokine production, 6e8-week-old naive Tsk/Cmice were injected 1 week prior to ELISPOT assay. Unexpectedly, no significant difference in the number of either IFN-g- or IL-4-secreting cells was detected among the Tsk/Cgroups with or without Con A stimulation (Fig. 4B). Taken together, these results
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
187
Fig. 2. Collagen expression in dorsal skin from C57BL/6 pa/pa and the treated Tsk/Cmice. Tsk/Cmice were treated with saline (Tsk/Csaline), pB (Tsk/CpB), and pB-CpG20 (Tsk/CpB-CpG20). At the age of 23 weeks, dorsal skins were taken and prepared for collagen staining with sirius red and fast green FCF as a counterstain (upper panel, magnification !20) or for immunohistochemistry using anti-mouse collagen type I antibody (lower panel, magnification !10). Upper panel: collagen and non-collagenous proteins were colored red and blue, respectively; Lower panel: collagen type I and nuclei were colored purple and blue, respectively.
suggest that a single administration of pB-CpG20 to Tsk/Cmice is insufficient to skew cytokine profile toward Th1, but repeated administration can improve the Th1:Th2 cytokine balance by cumulative effects. 3.4. Effects of plasmids containing CpG motifs on cytokine production by spleen cells in vitro Next we examined cytokine profile of spleen cells from 6e8-week-old naive Tsk/Cmice in the presence or absence of plasmids in vitro. As shown in Fig. 5A,B, pB-CpG20 increased significantly the number of IFN-gsecreting cells, but reduced that of IL-4-secreting cells compared to medium alone. Furthermore, pB-CpG20 did not affect IL-6 production (Fig. 5C). pB induced the similar cytokine pattern to pB-CpG20 possibly because pB also contains six CpG motifs in its backbone [20]. All the reagents exhibited the same effects on the spleen cells of pa/pa littermates (data not shown).
4. Discussion Gene vaccination is a promising vaccine strategy with some advantages such as ease of manufacture, long-lived efficacy and few harmful effects [24]. Gene vaccination with plasmid DNA induces preferentially a Th1-type immune response. It has been demonstrated that the adjuvanticity of plasmid DNA for gene vaccination is related to immunostimulatory sequences with CpG motifs in a plasmid backbone [25]. The Th1-biased immune response can be augmented by the addition of immunostimulatory CpG motifs to the plasmid backbone. Therefore, modifying a plasmid vector by the introduction of immunostimulatory sequences would be
Table 1 Skin thickness in C57BL/6 pa/pa mice and Tsk/Cmice treated with saline, pB or pB-CpG20a Group
C57BL/6 pa/pa Tsk/Csaline Tsk/CpB Tsk/CpB-CpG20 a
N
8 7 5 7
Dermal thickness (mm) Age (23 weeks)
Age (32 weeks)
323G22 401G26 404G37 360G30b
247G24 278G23 308G29 245G15b
Skin sections from the interscapular region (23 weeks) and dorsum immediately below the neck (32 weeks) were stained with hematoxylin/ eosin, and dermal thickness was measured under a light microscope. Values are shown as the meanGSD. b P!0.05 as compared with Tsk/Csaline and Tsk/CpB.
Fig. 3. Serum levels of ANA from the treated Tsk/Cmice. Tsk/Cmice were treated with saline (Tsk/Csaline), pB (Tsk/CpB), and pB-CpG20 (Tsk/CpB-CpG20). Sera were collected at the age of 23 weeks. ANA were determined by immunofluorescence staining using HEp-2 cells as the substrate. ANA titers are evaluated by scoring serum dilutions (from 1:20 to 1:320) and higher titer is defined as detectable in more dilution. Each circle indicates the ANA titer of an individual mouse and black circles mean positive response. *P!0.05.
188
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
Fig. 4. The number of IFN-g- and IL-4-secreting cells in the spleen of the treated Tsk/Cmice. ELISPOT assays were performed on single cell suspensions of spleen cells (A) from the Tsk/Cmice 1 week after the final administration or (B) from 6e8-week-old Tsk/Cmice receiving a single administration 1 week prior to sacrifice. Untreated C57BL/6 pa/pa littermates were used as control. Spleen cells were incubated in the absence (ÿ) or presence of Con A (5 mg/ml). The frequency of IFN-g- and IL-4-secreting cells per million spleen cells is shown. Each bar shows the meanGSD values for three individual mice per group. Data are representative of three independent experiments. *P!0.05.
very important to induce a potent Th1 immune response. Our previous study demonstrated that co-administration of a plasmid enriched in CpG content enhanced the immunogenicity of HIV-1 DNA vaccine in a CpG copiesdependent manner [20]. pB-CpG20 containing additional 20 CpG copies, the most effective immune enhancer in the experiment, was selected in the present study. This report is the first to demonstrate that administration of a CpGenriched plasmid (not coding any protein) is able to prevent skin thickening and skin collagen deposition in Tsk/Cmice. Previous studies indicate that IL-4 induces the upregulation of Type I collagen gene expression in murine fibroblasts, while IFN-g inhibits fibroblast collagen synthesis [4,26]. In keeping with the opposing effects of IL-4 and IFN-g on collagen synthesis, the prevention of dermal fibrosis caused by pB-CpG20 administration was accompanied by an increase in the number of IFN-gsecreting cells and a decrease in that of IL-4-secreting cells. IFN-g induction and IL-4 down-regulation by
pB-CpG20 treatment may be a key factor mediating the abrogation of skin fibrosis in Tsk/Cmice. It has been reported that serum levels of autoantibodies closely correlate with the development of skin fibrosis in Tsk/Cmice and with disease severity and activity in patients with scleroderma [27,28]. Recent studies demonstrate that CD19 signaling is constitutively augmented in B cells from Tsk/Cmice and patients of systemic sclerosis [29,30]. In addition, IL-6 overproduction by abnormal Tsk/CB cells has been proposed possibly responsible for skin sclerosis and ANA production. Our experiments showed that pB-CpG20 induced IFN-g, but did not enhance the production of IL-4 and IL-6, which could explain the partial inhibitory effect of pB-CpG20 on the production of ANA. We failed to prevent the development of lung emphysema by stimulating Th1 immune response and the result is consistent with the inability of other therapies [3,7]. Lung abnormality in Tsk/Cmice is likely due to factors other than Th2 cytokines. In fact, Saito and others reported
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
189
There are hardly any therapeutic options in patients with scleroderma presently. Thus, a form of economical therapy that could ameliorate the manifestations of this disease would be of considerable public health benefit. Plasmid DNA has several properties that make it especially appealing in gene therapy; plasmid DNA is safe to use and there is a potential for low-cost production and administration. CpG-enriched plasmids have been applied in DNA vaccine for large animals such as cattle and pig [21,33]. Optimizing the number of immunostimulatory sequences and the exact sequences could enhance the potency of CpG-enriched plasmids. In this context, plasmid DNA is suitable for engineering multiple copies of improved immunostimulatory sequences into its backbone. Although administration of CpG-enriched plasmid demonstrated potential to ameliorate Tsk/Csyndrome as well as CpG ODN, further studies are needed to examine whether similar efficacy can be found in patients with scleroderma. In summary, this study demonstrates that treatment with a plasmid enriched in CpG content can prevent the development of scleroderma-like syndrome by preferentially promoting Th1-biased immune responses.
Acknowledgements
Fig. 5. Production of cytokines by spleen cells stimulated with plasmids. (A,B) Spleen cells from naive Tsk/Cmice were incubated with medium or with 6 mg/ml of plasmids. The number of cells secreting IFN-g (A) and IL-4 (B) was determined by ELISPOT. (C) Spleen cells (5!105/well) were cultured with plasmids as above. After 48 h, the culture supernatants were harvested and analyzed for IL-6 levels by ELISA. Each bar shows the meanGSD values for 3e5 mice. *P!0.05 as compared with medium.
that lung emphysema may be controlled by a different gene that cosegregates with mutated Fbn-1 [31]. Different CpG motif sequences can induce dramatically different profiles of immune activation [14]. Immunostimulatory CpG motifs in pB-CpG20 can induce a potent Th1 immune response with little effect on B cells [32]. As expected, pB-CpG20 induced the production of IFN-g, but not IL-6 in vitro. This provides an advantage to avoid the risk for the enhancement of ANA production by abnormal B cells in Tsk/Cmice. pB showed the same potential to induce cytokines as pB-CpG20 in vitro. However, unlike pB-CpG20, no curative effect was caused by pB administration in vivo. The ANA levels in pB-treated mice seemed to be relatively, but not significantly, lower than those in saline-treated mice. This tendency might be caused by CpG motifs existing in the plasmid backbone. These results indicate that the additional 20 CpG copies are crucial to ameliorate the Tsk syndrome.
This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan to M. Ichino and M. Nakazawa (13670466).
References [1] Green MC, Sweet HO, Bunker LE. Tight-skin, a new mutation of the mouse causing excessive growth of connective tissue and skeleton. Am J Pathol 1976;82:493e512. [2] Bona C, Rothfield N. Autoantibodies in scleroderma and tight skin mice. Curr Opin Immunol 1994;6:931e7. [3] McGaha T, Saito S, Phelps RG, Gordon R, Noben-Trauth N, Paul WE, et al. Lack of skin fibrosis in tight skin (TSK) mice with targeted mutation in the interleukin-4R alpha and transforming growth factor-beta genes. J Invest Dermatol 2001;116:136e43. [4] McGaha TL, Le M, Kodera T, Stoica C, Zhu J, Paul WE, et al. Molecular mechanisms of interleukin-4-induced up-regulation of type I collagen gene expression in murine fibroblasts. Arthritis Rheum 2003;48:2275e84. [5] Kodera T, McGaha TL, Phelps R, Paul WE, Bona CA. Disrupting the IL-4 gene rescues mice homozygous for the tight-skin mutation from embryonic death and diminishes TGFbeta production by fibroblasts. Proc Natl Acad Sci U S A 2002;99:3800e5. [6] Ong C, Wong C, Roberts CR, Teh HS, Jirik FR. Anti-IL-4 treatment prevents dermal collagen deposition in the tight-skin mouse model of scleroderma. Eur J Immunol 1998;28:2619e29. [7] Tsuji-Yamada J, Nakazawa M, Takahashi K, Iijima K, Hattori S, Okuda K, et al. Effect of IL-12 encoding plasmid administration on tight-skin mouse. Biochem Biophys Res Commun 2001; 280:707e12.
190
Y. Shen et al. / Journal of Autoimmunity 24 (2005) 183e190
[8] Needleman BW. Immunologic aspects of scleroderma. Curr Opin Rheumatol 1992;4:862e8. [9] Postlethwaite AE. Role of T cells and cytokines in effecting fibrosis. Int Rev Immunol 1995;12:247e58. [10] Hasegawa M, Fujimoto M, Kikuchi K, Takehara K. Elevated serum levels of interleukin 4 (IL-4), IL-10, and IL-13 in patients with systemic sclerosis. J Rheumatol 1997;24:328e32. [11] Grassegger A, Schuler G, Hessenberger G, Walder-Hantich B, Jabkowski J, MacHeiner W, et al. Interferon-gamma in the treatment of systemic sclerosis: a randomized controlled multicentre trial. Br J Dermatol 1998;139:639e48. [12] Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 1995;374:546e9. [13] Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, et al. A Toll-like receptor recognizes bacterial DNA. Nature 2000;408:740e5. [14] Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 2002;20:709e60. [15] Klinman DM, Verthelyi D, Takeshita F, Ishii KJ. Immune recognition of foreign DNA: a cure for bioterrorism? Immunity 1999;11:123e9. [16] Kline JN, Waldschmidt TJ, Businga TR, Lemish JE, Weinstock JV, Thorne PS, et al. Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J Immunol 1998;160:2555e9. [17] Zimmermann S, Egeter O, Hausmann S, Lipford GB, Rocken M, Wagner H, et al. CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. J Immunol 1998;160:3627e30. [18] Sur S, Wild JS, Choudhury BK, Sur N, Alam R, Klinman DM. Long term prevention of allergic lung inflammation in a mouse model of asthma by CpG oligodeoxynucleotides. J Immunol 1999;162:6284e93. [19] Klinman DM, Ishii KJ, Verthelyi D. CpG DNA augments the immunogenicity of plasmid DNA vaccines. Curr Top Microbiol Immunol 2000;247:131e42. [20] Kojima Y, Xin KQ, Ooki T, Hamajima K, Oikawa T, Shinoda K, et al. Adjuvant effect of multi-CpG motifs on an HIV-1 DNA vaccine. Vaccine 2002;20:2857e65. [21] Pontarollo RA, Babiuk LA, Hecker R, Van Drunen Littel-Van Den Hurk S. Augmentation of cellular immune responses to bovine herpesvirus-1 glycoprotein D by vaccination with CpGenhanced plasmid vectors. J Gen Virol 2002;83:2973e81.
[22] Bocchieri MH, Henriksen PD, Kasturi KN, Muryoi T, Bona CA, Jimenez SA. Evidence for autoimmunity in the tight skin mouse model of systemic sclerosis. Arthritis Rheum 1991;34:599e605. [23] Jimenez SA, Williams CJ, Myers JC, Bashey RI. Increased collagen biosynthesis and increased expression of type I and type III procollagen genes in tight skin (TSK) mouse fibroblast. J Biol Chem 1986;261:657e62. [24] Tighe H, Corr M, Roman M, Raz E. Gene vaccination: plasmid DNA is more than just a blueprint. Immunol Today 1998;19: 89e97. [25] Sato Y, Roman M, Tighe H, Lee D, Corr M, Nguyen MD, et al. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 1996;273:352e4. [26] Serpier H, Gillery P, Salmon-Her V, Garnotel R, Georges N, Kalis B, et al. Antagonistic effects of interferon-gamma and interleukin-4 on fibroblast cultures. J Invest Dermatol 1997;109: 158e62. [27] Hatakeyama A, Kasturi KN, Wolf I, Phelps RG, Bona CA. Correlation between the concentration of serum anti-topoisomerase I autoantibodies and histological and biochemical alterations in the skin of tight skin mice. Cell Immunol 1996;167:135e40. [28] Hu PQ, Fertig N, Medsger Jr TA, Wright TM. Correlation of serum anti-DNA topoisomerase I antibody levels with disease severity and activity in systemic sclerosis. Arthritis Rheum 2003;48:1363e73. [29] Sato S, Hasegawa M, Fujimoto M, Tedder TF, Takehara K. Quantitative genetic variation in CD19 expression correlates with autoimmunity. J Immunol 2000;165:6635e43. [30] Saito E, Fujimoto M, Hasegawa M, Komura K, Hamaguchi Y, Kaburagi Y, et al. CD19-dependent B lymphocyte signaling thresholds influence skin fibrosis and autoimmunity in the tightskin mouse. J Clin Invest 2002;109:1453e62. [31] Saito S, Nishimura H, Phelps RG, Wolf I, Suzuki M, Honjo T, et al. Induction of skin fibrosis in mice expressing a mutated fibrilin-1 gene. Mol Med 2000;6:825e36. [32] Wooldridge JE, Ballas Z, Krieg AM, Weiner GJ. Immunostimulatory oligodeoxynucleotides containing CpG motifs enhance the efficacy of monoclonal antibody therapy of lymphoma. Blood 1997;89:2994e8. [33] Yu. H, Babiuk LA, Van Drunen Littel-Van Den Hurk S. Priming with CpG-enriched plasmid and boosting with protein formulated with CpG oligodeoxynucleotides and Quil A induces strong cellular and humoral immune responses to hepatitis C virus NS3. J Gen Virol 2004;85:1533e43.