Thermococcus stetteri sp. nov., a New Extremely Thermophilic Marine Sulfur-Metabolizing Archaebacterium

System. Appl. Microbial. 12, 257-262 (1989)

Thermococcus stetteri sp. nov., a New Extremely Thermophilic Marine Sulfur-Metabolizing Archaebacterium M. L. MIROSHNICHENKO\ E. A. BONCH-OSMOLOVSKAYA1, A. NEUNER2 , N. A. KOSTRIKINA\ N. A. CHERNYCH 1, and V. A. ALEKSEEV 3 1

Z 3

Institute of Microbiology, USSR Academy of Sciences, Moscow, USSR Lehrstuhl fur Mikrobiologie, Universitat, Regensburg, Federal Republic of Germany Institute of Atomic Energy, Moscow, USSR Received July 1, 1989

Summary Four strains of new extremely thermophilic anaerobic archaebacteria were isolated from marine solfataric fields of Kraternaya cove (Ushishir archipelago, Northern Kurils). The cells are irregular cocci 1 to 2 fAm in diameter. Two strains are motile due to a tuft of flagella. Two strains are non-motile. The cell envelope consists of two layers of subunits. Two strains (non-motile) grow at temperatures from 55 to 94°C (opt. 75 0c) and two (motile) from 75 to 98°C. The pH range for growth of all strains is 5.7 to 7.2 (opt. around 6.5). Salt (opt. 2.5 % NaCI) and elemental sulfur are obligately required for growth. Pep tides and polysaccharides are utilized. During growth more than 20 fAmol/ml HzS are formed and CO 2, acetate, isobutyrate and isovalerate ar e produced. The G+C content of DNA of isolate K-3 is 50.2 mol. % . The four isolates exhibited high DNA homology among each other, indicating that they belong to the same species. Partial 16S rRNA sequencing of isolate K-3 indicated that it belongs to the genus Th ermococcus. It shows no significant DNA homology with Thermococcus celer. In view of all differences between the isolates and Thermoco ccus celer, they are considered as representatives of a new species described as Thermococcus stetteri. Type strain is isolate K-3, DSM 5262.

Key words: Extreme thermophile - Sulfur-metabolizing - Marine - Archaebacteria - Thermococcus Thermococcus stetteri

Introduction

Several genera of extremely thermophilic archaebacteria have been found in marine hydrothermal vents (Stetter and Zillig, 1985; Stetter, 1986). In addition to methane producing bacteria, they also comprise sulfur-dependent archaebacteria, such as the obligately litho trophic genus Pyrodictium (Stetter et al., 1983), and numerous heterotrophic cocci capable of both sulfur respiration and fermentation (Zillig et al., 1983; Belkin and Jannasch, 1985; Fiala and Stetter, 1986; Fiala et al., 1986; Svetlichny et al., 1987; Zillig et al., 1987; Jannasch et al., 1988). The majority of these organisms have been isolated from submarine hydrothermal systems in Italy (Stetter, 1986). In this paper we describe a"" new extremely thermophilic archaebacterium isolated from marine hydrothermal vents in the region of the Kuril Islands.

Materials and Methods Coll!ction of samples, isolation and growth conditions. Samples were collected in the Kraternaya cove of Yankich Island (Ushishire archipelago, Northern Kurils). Samples were taken from different sites in the Kraternaya cove, from the coastal solfataras and from slightly warm marine deposits. Samples of mud were put into 50 ml screw cap bottles. Sodium sulfide was added as reducing agent (1 ml of 2.5% solution per bottle). The samples were brought to Moscow without temperature control. One ml of each sample was placed into a 15 ml Hungate tube with lQ ml of anaerobically prepared Pfennig medium (Pfennig, 1965) with the following composition: 0.033 % NH4 CI, 0.033 % MgCI2 X2H2 0, 0.033 % KHzP0 4 , 0.033% CaC1 2 x2H zO, 0.5 % peptone (or starch), 0.15 % NaHC0 3, 0.05% Na zSx9H zO, 1% So, 1 mill of Lippert trace element solution (Pfennig and Lippert, 1966), 0.02% yeast extract, and 0.015% resazurin. Three per-

258

M. L. Miroshnichenko et al.

cent of sea salt from the saltern near Azov sea was added. The remaining head space (5 ml) was filled with a mixture of NziCO z (80: 20). The pH of the medium was adjusted to 6.5. Inoculated tubes were incubated at 80 °C. To obtain pure cultures, repeated transfers in the same medium were carried out using 1 : 10 serial dilution~ . Growth was determined by cell counts under a phase contrast microscope MBI-ll and by estimation of the formation of hydrogen sulfide. The purity of the isolates obtained was checked by examining their morphological homqgeneity under various growth conditions. Cell mass was routin~lYgrown in 0.5 I screw cap serum bottles. Sulfur was removed by filtration and cells were separated by centrifugation. Fine structure. To obtain thin sections, cells were fixed in 5% glutaraldehyde solution for 2 h at 4 DC, and then additionally fixed with 1 % OS04 for 4 h at 4 DC. 3 % NaCl was added to fixing solutions. Embedded in Epon-812, cells were thin-sectioned and stained with uranylacetate and lead citrate. Thin sections were photographed using a JEM-I00 electron microscope. Physiological characteristics. Hydrogen sulfide was measured colorimetrically as described by Truper and Schlegel (1964). Fermentation products were determined using a Hewlett-Packard gas chromatograph with flame ionization detector and Carbowax filled column (oven temperature 120 °C, injector temperature 150 0c). To estimate the pH dependence of growth, the medium was adjusted by the addition of 10% solutions ofNaOH and H zS0 4 • In order to determine substrate utilization, these substrates were added at concentrations of 0.5 % (w/v) to the Pfennig medium but without peptone. Possible electron acceptors were added at a concentration of 0.2 % (w/v) to the sulfur-free medium with peptone. Growth on hydrogen was tested on Pfennig medium without peptone, gassed with a H z/C0 2 mixture (80: 20). The fermentative capacity of the isolates was determined using Pfennig medium without sulfur. To study the effect of salinity, sea salt from the saltern near Azov sea was used. The sensitivity to antibiotics was determined by the addition of 100 Ilg antibiotic per ml of medium. Determination of G+C content and DNA-DNA homology. DNA was prepared according to Lauerer et al. (1985) and the G+C content of the DNA was determined from melting point analysis (Marmur and Doty, 1962). DNA-DNA hybridization was carried ~ut after radioactive labelling of the DNA by nick translation (Kelly et al., 1970),

Table 1. Characteristics of sampling sites in Kraternaya cove and morphology of isolates Sites of sampling

T (CO)

pH

Designation

Morphology of isolates

Coastal solfatara

90

2.8

K-l-l

Rod-shaped fermentative eubacteria

Coastal solfatara

94

6.5

K-17

Submarine hot vent near the seashore (depth 0.2 m)

75

6.5

K-19

Deposits (depth 6 m)

20

6.5

K-3

Deposits (depth 15 m)

16

6.5

K-15

Irregular cocci Irregular COCCI

Irregular cocci Irregular COCCI

using the filter technique (Gillespie and Gillespie, 1971; Birnstiel et al., 1972) at 25 DC below TM in 3xSSC (Marmur and Doty, 1962). Dot Blot Hybridization. Radioactive 3z p -I abelled DNA probes (Kelly et al., 1970) were hybridized with isolated DNA on nitrocellulose filters at 19 °C under T M (restrictive conditions) (B renner, 1973). Hybridization was analysed autoradiographically (modified after Grunstein and Wallis, 1979; Neuner and Stetter, in preparation). Partial sequencing of the 16S rRNA. RNA was prepared by 'hot phenol extraction' (Aiba et al., 1981). Partial 16S ribosomal RNA sequencing was performed using the primer extension method (Lane et al., 1985; Sanger et al., 1977; Smith, 1980) with four specific priming sites within the 16S rRNA of Thermococcus cefer. The following synthetic oligonucleotide primers were used: (1) 5' ACGGGCGTGTGTGCAAG 3' (corresponding to position 1338-1355 in the 16S rRNA of Thermococcus celer), (2) 5'GTCTCGCTCGTIACC 3' (position 1039-1053), (3) 5'TACCGCGGCGGCTGCCAC 3' (position 457-474) and (4) 5'TGCTGCGCCCCGTAGGGCC 3' (position 323-341).

Results Enrichment and isolation Kraternaya cove is a flooded crater of the Ushishire volcano and is linked to the ocean by a small channel. Recent hydrothermal activity in the cove is shown mainly on its south-east shore by a group of coastal high temperature solfataras (80 to 95°C). No underwater hot springs have so far been located in the cove, but there are places with increased temperatures (10 to 20 °C as compared to 4°C for the surrounding water). One ml of each of the samples from Kraternaya cove was transferred under nitrogen flow into anaerobic medium supplemented with pepton and sulfur. The tubes were incubated at 80°C. After one to three days, abundant growth of rods was found in sample K-1-1 and of cocci in samples K-3, K-15, K-17 and K-19 (Table 1). The rods were tentatively characterized as heterotrophic thermophilic eubacteria. In our further work only the coccoid bacteria were studied. After repeated serial dilutions, pure strains of cocci were isolated from samples K-3, K-15, K-17 and K-19 and received the same designations as the samples. Strain K-3 served as the main object of study. Morphology and fine structure Cells of all isolates were irregular cocci, 1-2 fLm in diameter (Fig. 1). Isolates K-3 and K-19 were non-motile, K-15 and K-17 were motile with one polar tuft of flagella. Thin sections showed the same type of cell envelope, consisting of two layers of subunits, each layer approximately 29 nm wide (Fig. 2), in all strains. Between the two layers an electron dense layer, 9 to 10 nm wide (Fig. 2,3), was observed. The cell wall fits tightly to the cytoplasmic membrane. No septa formations in dividing cells have been observed. Cells multiply most likely by constriction as indicated by Figs. 2 and 3.

Thermococcus stetteri sp. nov.

259

2 0.4 }Jm

Fig. 1. Cells of strain K-3 photographed in a phase-contrast microscope.

Metabolic properties

All isolates showed good growth on a medium containing peptone and elemental sulfur (Fig. 4). In addition to peptone and other peptide-containing substrates (casein hydrolysate, trypticase), isolate K-3 was found to utilize starch and pectin. Growth of isolate K-3 was not detected on free amino acids, glucose, maltose, sucrose, cellulose, ethanol, methanol, acetate, propionate or HiCO z. None of the isolates grew in oxidized medium with an Eh higher than -30 mV (deduced from the colour of resazurin). Thus they are obligate anaerobes. None of the four isolates was found to grow in the absence of sulfur. Elemental sulfur could not be substituted by sulfate, nitrate, Fe3 +, Mn4 + or malate. During growth elemental sulfur was reduced to hydrogen sulfide, which was produced in concentrations of up to 20 [Lmol/ ml (Fig. 4). Concurrently, there was formation of carbon dioxide, acetate, isobutyrate and isovalerate. Growth characteristics

Growth of isolates K-3 and K-19 was observed in the temperature range of 55 to 94°C, with an optimum between 73 and trc (Fig. 5). Isolates K-15 and K-17 grew at temperatures from 73 to 98°C with an optimum at 88 dc. Growth of all isolates was found at pH 5.7 to 7.2. The optimal pH was around 6.5. All strains were found to require salt for their growth. The optimum was at 2.5% (Fig. 6). Sea salt could be substituted by an equal concentration of NaC!. The generation time for strain K-3 under optimal cultivation conditions (T = 76°C, pH 6.4, 2.5% sea salt, 0.3% peptone, 0.05% yeast extract, 1% sulfur) was 72 min. After 12 h, the cell yield reached 1.4xl0 8 cells/m!. Lysis of cells in the stationary phas~ was not observed (Fig. 4). Growth of isolate K-3 was not influenced by benzylpenicillin, vancomycin, and streptomycin. It was partly inhibited by chloramphenicol and totally by rifampicin.

Fig. 2, 3. Thin sections of cells (strain K-3).

. M. L. Miroshnichenko et al.

260

o

o

15

I E E

-0

E

~

~

'"

o

u

~

Vl

" U

5

15 Time (h i

18

o

T

-_

2

Seo

so lt

4

("10) ~

Fig. 6. Effect of salinity on cell yield of strain K-3.

Fig. 4. Growth (0) and hydrogen sulfide production (e) of strain K-3. Table 2. DNA homology (%) between the new isolate K-3 and Thermococcus celer DSM 2476 Source of filterbound DNA

% Homology with 32P-labelled DNA from Thermococcus celer Strain K-3

200

Thermococcus celer Strain K-3 Calf thymus (control)

100

11 4

7 100 5

~ 150

.§.

'" E

o

Sequencing of about 320 bases of the 16S rRNA of isolate K-3 showed only five base alterations when compared with the sequence of the type strain Thermococcus celer (Table 3; Achenbach-Richter et aI., 1988).

OJ

E 100 ::0

,3"

o

Discussion

50

~~6~0--~7~0--~8~0--~9'0 Growth

temperature ( ' C ) - -

Fig. 5. Temperature dependence of the generation time of strain K-3.

Genomic characteristics

The G+C content of the DNA of strain K-3 was 50.2 mol%, that of the other strains varied from 50 to 52 mol%. DNA-DNA hybridization (Table 2), showed only an insignificant homology below 11 % between the new isolate K-3 and the type strain of Thermococcus celer. Strains K-3, K-15 and K-17 showed high hybridization with each other as shown by Dot Blot hybridization at 19°C below the melting point of the DNA ('restrictive conditions'; Brenner, 1973, data not shown).

So far three genera of extremely thermophilic marine cocci have been described: Thermococcus (Zillig et aI. , 1983), Pyrococcus (Fiala and Stetter, 1986) and Staphylothermus (Fiala et aI., 1986). Our new isolates differ significantly from the representatives of the latter two genera in their much higher G+C content. However, the G+C content of the genus Thermococcus, represented so far only by its type species Thermococcus celer, is similar to that of our isolates (56.7 mol%). Partial RNA sequencing showed a close relationship between isolate K-3 and Thermococcus celer. Insignificant DNA-DNA hybridization indicated that they belong to different species. Because of positive crossreaction of their DNA in the Dot Blot test, all new isolates should be considered to be representatives of the same species. This species belongs to the genus Thermococcus but differs from the type species Thermococcus celer in several morphological, physiologi-

Thermococcus stetteri sp. nov.

261

Table 3. Alignment of the partial sequence of 16S rRNA of isolate K-3 (K-3) with 16S of Thermococcus celer (Tc). The sequence of Thermococcus celer, homologous to the sequence of strain K-3, is omitted. Gaps are indicated by bars and not readable bases by 'N' (1) K-3

Te

K:3

Te

K-3

Te

primer 1 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCC CUAAGGUCGAAGUGCGCCCGCNCANCGUCGGGC-UUAGGCUUGACCCCCGCCCN GC NNUCCCCUAAGGGAAGGGGAAAGCCCCAG

(2) K-3

primer 2 NNNNNNNNNNNCUGNNGAGUGCCAUGCUCGANUGNCGCCGGUACG

(3) K-3

primer 3 NNNNNNNNNNNNNNNNANUAAGGGCCUCGAAAAAUGUGAGGCCUU

Te Te

K-3

Te

K-3

Te

(4) K-3

Te

K-3

Te

UUCGGCACCNU-N-GUNNNNUGACCCCCAGGGGGGCAGCNCCAACGGGCGUANC CA G GCCUNNNAANCGCGGNCGNCNCGGGNCAUCCCGG U

primer 4 ACCUGGNNUGAGAGUCACAGGUAGAGGCCCGAGGGUGAGAGUACC AC GGGCAUGGCUAGAAGCCGAACCACCCGGCAAUGGGGU

cal and biocemical features: (a) structure of cell envelope consisting of two layers of subunits, (b) obligate sulfurdependent growth, (c) ability to use carbohydrates as carbon and energy source, and (d) a 6% lower G-C content of DNA. Based on this evidence we describe a new species of the genus Thermococcus which we name Thermococcus stetteri. Description of Thermococcus stetteri Miroshnichenko. Thermococcus stetteri Miroshnichenko sp.nov. stet'te.ri (M.L.gen.n.) stetteri, named after K. o. Stetter because of his important contribution to the knowledge of extreme thermophiles. Cells are irregular cocci, Gram-negative, 1 to 2 [lm in diameter. Multiplying by constriction. Non-motile or motile with a polar tuft of flagella. The cell envelope consists of two layers of subunits with a thin electron-dense layer between them. Obligately anaerobic. Temperature range of growth from 55 to 98 °C, optimum 75 to 88°C, depending on the isolate. pH range of growth from 5.7 to 7.2 with the optimum around 6.5. Requires 2.5% sea salt. No growth without elemental sulfur. The energy substrates utilized are peptone, casein hydrolysate, trypticase, starch, and pectin. Produces H 2S, CO 2, acetate, isobutyrate and isovalerate. No growth on free amino acids, glucose, maltose, sucrose, cellulose, ethanol, methanol, acetate, propionate, and H 2/C0 2 • Tolerates H 2S concentrations of up to 20 [lmol/ml. G+C content of DNA of the type strain is 50.2 mol. %. Inhabits marine hydrothermal vents in Kraternaya cove (Northern Kurils). Type strain: Thermococcus stetteri K-3 , DSM 5262, Braunschweig-Stockheim, FRG Acknowledgements. We thank G. A. Zavarzin (lnst. of Microbiology, Moscow, USSR) and K. o. Stetter (Univ. of Regensburg, FRG) for valuable discussions, and V. G. Tarasov (lnst. of Marine Biology, Vladivostok, USSR) and B. B. Namsaraev (lnst.

of Microbiology, Moscow, USSR) for their help with sampling and field research. Thanks are also due to]. Kjems (University of Aarhus, Denmark) and to G. Fiala (University of Regensburg, FRG) for their instructions in partial 16S ribosomal RNA sequencing.

References Achenbach-Richter, L., Gupta, R., Zillig, W., Woese, C. R.: Rooting the archae bacterial tree: the pivotal role of Thermococcus celer in archaebacterial evolution. System. App!. Microbio!. 10,231-240 (1988) Aiba, H., Adhya, S., de Crombrugghe, B.: Evidence for two functional gal promotors in intact E. coli cells. J. Bio!. Chem. 256, 11905-11910 (1981) Belkin, S., Jannasch, H. W .: A new extremely thermophilic, sulfur-reducing heterotrophic marine bacterium. Arch. Microbiol. 141, 181-186 (1985) Birnstiel, M . L., Sells, B. H., Purdom, I. F.: Kinetic complexity of RNA molecules. J. Molec. Bio!. 63, 21-39 (1972) Brenner, D. ].: Deoxyribonucleic acid reassociation in the taxonomy of enteric bacteria. Int. ]. Syst. Bacteriol. 22, 298-307 (1973) Fiala, G., Stetter, K. 0.: Pyrococcus furiosus sp. nov. represents a novel genus of marine heterotrophic archaebacteria growing optimally at 100°C. Arch. Microbiol. 145, 56-61 (1986) Fiala, G., Stetter, K. 0., Jannasch, H. W., Langworthy, T., Madon, ].: Staphylothermus marinus sp. nov. represents a novel genus of extremely thermophilic submarine archaebacteria growing up to 98 °C. System. App!. Microbio!. 8, 106-113 (1986) Gillespie, S., Gillespie, D.: Ribonucleic aeid-desoxyribonucleic acid hybridization in aqueous solutions and in solutions containiqg formamide. Biochem. J. 125,481-487 (1971) Grunstein, M., Wallis,].: Colony hybridization. Meth. Enzymo!. 68, 379-389 (1 979) Jannasch, H. W., Wirsen, C. 0., Molyneaux, S.]., Langworthy, T. A.: Extremely thermophilic fermentative archaebacteria of the genus Desulfurococcus from deep-sea hydrothermal vents. App!. Environm. Microbiol. 54, 1203-1209 (1988)

262

M. L. Miroshnichenko et a!.

Kelly, R. B., Cozzarelli, N. R., Deutscher, M. P., Lehmann, j. R., Kornberg, A.: Enzymatic synthesis of desoxyribonucleic acid. ]. Bio!. Chern. 245, 39-45 (1970) Lane, D . j., Pace, B., Olsen, G. j., Stahl, G. A., Sogin, M. L., Pace, N. R.: Rapid determination of 16S ribosomal RNA se-quences for phylogenetic analyses. Proc. Natl. Acad. Sci. USA 82, 6955-6959 (1985) Lauerer, G., Kristjansson, j. K., Langworthy, T. A., Konig, H., Stetter, K. 0.: Methanothermus sociabilis sp. nov., a second species within the Methanothermaceae growing at 97 °C. System. Appl. Microbio!. 8, 100-105 (1985) Marmur, j., Doty, P. : Determination of the base composition of deoxyribonucleic acid from microoranisms. J. Mol. BioI. 5, 109-118 (1962) Pfennig, N.: Anreicherungskulturen fur rote und griine Schwefelbakterien. Zbl. Bakt. Hyg., I. Abt. Orig. Supp!. 1, 179-189 (1965) Pfennig, N., Lippert, K. D.: Ober das Vitamin B12 -Bediirfnis phototropher Schwefelbakterien. Arch. Mikrobiol. 55, 245-246, (1966) Sanger, F., Nichler, S., Coulson, A. R.: DNA sequencing with chain terminating inhibitors. Proc. Nat!. Acad. Sci. USA. 74, 5463-5467 (1977) Schleifer, K. H. , Stackebrandt, E.: Molecular systematic of prokaryotes. Ann. Rev. Microbiol. 37, 143-187 (1983) Smith, A . j. H.: DNA sequence analysis by primed synthesis. Meth. Enzymol. 65, 560-580 (1980) Steigerwalt, A. G., Fanning, G. R., Fife-Asbury, M. A., Brenner, D. j.: DNA relatedness among species of Enterobacter and Serratia. Can. J. Microbiol. 22, 121-137 (1976)

Stetter, K. 0.: Diversity of extremely thermophilic archaebacteria, pp.39-74. In: Thermophiles: General, molecular and applied microbiology (T. D. Brock, ed.). New York, Wiley & Sons, 1986 Stetter, K. 0., Zillig, W.: Thermoplasma and the thermophilic sulfur-dependent archaebacteria, pp. 85-167. In : The Bacteria, Vol. VIII (C. R. Woese and R. S. Wolfe, eds. ). Orlando, Academic Press, 1985 Stetter, K. 0., Konig, H., Stackebrandt, E. : Pyrodictium gen. nov., a new genus of submarine disc-shaped sulphur-reducing archaebacteria growing optimally at 105 °C. System. Appl. Microbiol. 4, 535-551 (1983) Svetlichny, V. A., Siesarev, A. I., Svetlichnaya, T. P., Zavarzin, G. A.: Caldococcus litoralis gen. nov., sp. nov. - a new marine, extremely thermophilic sulfur-reducing archaebacterium. Mikrobiologia 56, 831-838 (1987) (In Russian) Truper, H. G, Schlegel, H. G.: Sulfur metabolism in Thiorhodaceae I. Quantitative measurements on growing cells of Chromatium okenii. J. Microbiol. Serol., 30, 225-232 (1964) Zillig, W., Holz, j., Janekowic, D., Scharer, W., Reiter, W. D.: The archae bacterium Thermococcus celer represents a novel genus within the thermophilic branch of archaebacteria. System. Appl. Microbiol. 4, 88-94 (1983) Zillig, W., Holz, I., Klenk, H.-P., Trent, j., Wunderl, S., Janekovic, D., Erwin, j., Haas, B.: Pyrococcus woesii sp. nov., an ultra-thermophilic marine archaebacterium represents a novel order Thermococcales. System. Appl. Microbiol. 9, 62-70 (1987)

Dr. E. A . Bonch-Osmolovskaya, Institute of Microbiology, USSR Academy of Sciences, Prospekt 60 Letiya Oktybrya 7 k. 2, 1178111 Moscow, USSR