Thermophilic esterase from Thermomyces lanuginosus: Molecular cloning, functional expression and biochemical characterization

Protein Expression and Purification 101 (2014) 1–7

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Thermophilic esterase from Thermomyces lanuginosus: Molecular cloning, functional expression and biochemical characterization Xiao-Jun Li, Ren-Chao Zheng, Zhe-Ming Wu, Xu Ding, Yu-Guo Zheng ⇑ Institute of Bioengineering, Zhejiang University of Technology, Hangzhou 310014, PR China Engineering Research Center of Bioconversion and Biopurification of Ministry of Education, Zhejiang University of Technology, Hangzhou 310014, PR China

a r t i c l e

i n f o

Article history: Received 2 March 2014 and in revised form 7 May 2014 Available online 20 May 2014 Keywords: Cloning Characterization Enantioselectivity Esterase Thermomyces lanuginosus

a b s t r a c t A novel esterase encoding gene, tle, was cloned from the thermophilic fungus Thermomyces lanuginosus DSM 10635. The tle had an open reading frame of 945 bp encoding TLE of 314 amino acids with a theoretical molecular mass of 34.5 kDa. The putative catalytic triad of TLE was consisted of Ser151, His279, and Asp249. TLE was heterologously expressed in Escherichia coli in biologically active form and purified to homogeneity. Several biochemical properties of TLE were studied: Among the tested p-nitrophenol esters, TLE showed the highest hydrolytic activity with p-nitrophenyl butyrate (C4) and exhibited the maximum activity at 60 °C and pH 8.5. The enzyme was stable at temperatures below 60 °C and retained 53% of the maximum activity after treatment at 70 °C for 60 min. Esterase activity was notably enhanced by addition of Ca2+ and Ba2+, respectively. Furthermore, TLE showed high enantioselectivity (E = 95) in the kinetic resolution of 2-carboxyethyl-3-cyano-5-methylhexanoic acid ethyl ester (CNDE), which produce a valuable chiral intermediate-(3S)-2-carboxyethyl-3-cyano-5-methylhexanoic acid for Pregabalin. These unique properties of the esterase indicate that TLE is a potential candidate for industrial application. Ó 2014 Elsevier Inc. All rights reserved.

Introduction Esterase (E.C. 3.1.1.1) is a member of a/b-hydrolase superfamily and widely distributed in animals, plants and microbes. Esterase plays important physiological and biotechnological roles in the synthesis or hydrolysis of esters. It was widely used in the chemical and pharmaceutical industries due to its high enantioselectivity in the synthesis of optically pure compounds [1,2]. Discovery of novel esterases with both high enantioselectivity and activity are of great importance for expanding their application in the industry. In recent years, the thermostable enzymes received considerable attention from both academia and industry. Thermophiles are valuable sources of thermostable enzymes with properties often associated with stability in solvents and detergents, giving them considerable potential for industrial applications [3–5]. Thermomyces lanuginosus (previously Humicola lanuginosa) is a widely distributed thermophilic fungus. Extensive studies on the molecular, physiological and ecological properties of T. lanuginosus strains have shown that this thermophilic fungus possesses a number of exceptional properties [6,7]. T. lanuginosus have been ⇑ Corresponding author at: Engineering Research Center of Bioconversion and Biopurification of Ministry of Education, Zhejiang University of Technology, Hangzhou 310014, PR China. Tel./fax: +86 571 88320630. E-mail address: [email protected] (Y.-G. Zheng). http://dx.doi.org/10.1016/j.pep.2014.05.006 1046-5928/Ó 2014 Elsevier Inc. All rights reserved.

regarded as an important source of thermostable enzymes and have attracted industrial interest. More than ten thermostable enzymes from T. lanuginosus have been cloned and characterized, such as thermostable b-xylosidase [8], xylanase [9,10], hemicellulases [7], lipase [11–13], glucoamylase [14], a-amylase [15], phytase [16] and chitinase [17], some of which have been commercialized. In this study, a novel thermophilic esterase gene tle was cloned from T. lanuginosus DSM10635 and overexpressed in Escherichia coli. Enzymatic properties of the recombinant esterase were investigated. To the best of our knowledge, this is the first report regarding the cloning, heterologous expression and biochemical characterization of esterase TLE from T. lanuginosus. Materials and methods Chemicals, strains and plasmids T4 DNA ligase, NdeI and XhoI were purchased from Fermentas (Shanghai, China). LA Taq DNA polymerase, Pfu DNA polymerase and 50 -RACE Kit were purchased from Takara (Dalian, China). The DNA gel extraction, plasmid extraction and PCR product purification kits were purchased from Axygen (Hangzhou, China). The primers were synthesized by Sunny Biological Co., Ltd. (Shanghai, China). p-Nitrophenyl esters with different chain lengths were

2

X.-J. Li et al. / Protein Expression and Purification 101 (2014) 1–7

Table 1 Oligonucleotide primers used for amplification of tle. Amplification reaction

Primer

Sequences (50 –30 )a

Degenerate PCR

DP-1F DP-1R DP-2 oligo(dT)28 P2 P3 P4 P5

AAYTKSCAYGGNAGYGG CCNCCNGMRWTRAAWCC GGSTTYASYKCNGGNGG TTTTTTTTTTTTTTTTTTTTTTTTTTTT CTCGATCGAAGGACTGACGC CAGCTACCAGGGCCAGGTTG GGAATTCCATATGGGCTTGTTTTCAATCCTG CCGCTCGAGTTATCCACTGTGGCCAAACTC

RACE PCR Full-length amplification a

S = G/C, Y = C/T, K = G/T, M = A/C, R = A/G, W = A/T, N = A/G/C/T.

purchased from J&K Scientific Ltd (Beijing, China). 2-Carboxyethyl3-cyano-5-methylhexanoic acid ethyl ester (CNDE)1 was kindly provided by Zhejiang Apeloa Medical Technology Co., Ltd. (Jinhua, China). The other chemicals used in this work were of analytical grade from local suppliers unless otherwise specified. T. lanuginosus DSM 10635 was purchased from German Collection of Microorganisms and Cell Cultures (DSMZ). The E. coli JM109, BL21 (DE3), pGEM-T vector (Promega, Beijing, China) and pET28b(+) (Novagen, Darmstadt, Germany) were used for gene cloning and expression experiments, respectively. Gene cloning and plasmid construction The total RNA from T. lanuginosus DSM 10635 was extracted and taken as the template for 1st strand cDNA synthesis using GoScript Reverse Transcription System Kit (Promega, Beijing, China). To obtain the partial tle gene fragment, the degenerate primers DP1F and DP-1R, degenerate primers DP-2 and oligo(dT)28 (Table 1) were designed according to the sequences of the regions (HGSGF and GFSAGGNL, respectively) that are highly conserved among fungal esterase gene and the ployA tail of mRNA, respectively. A tle gene fragment (630 bp) was amplified by PCR with LA Taq DNA polymerase, using forward primer DP-2 and reverse primer oligo(dT)28. The PCR product was recovered by DNA gel extraction kit and cloned into T/A vector pGEM-T vector, and then the recombinant plasmid was transformed into competent E. coli JM109. The 50 -flanking regions of cDNAs (549 bp) were amplified by RACE (rapid amplification of cDNA ends) with gene-specific primers (primers P2 and P3, Table 1) obtained from the partial cDNA sequences. Based on the sequencing results, primer P4 and primer P5 (Table 1) were designed to amplify the tle gene. The full-length coding sequence of tle was amplified using the Pfu DNA polymerase with the primer P4 and primer P5. The amplified fragments with the expected size were gel-purified and digested with NdeI/XhoI, and then ligated into expression vector pET-28b(+) which had been treated with the same restriction enzymes. Then the constructed recombinant plasmid pET28-TLE was transformed into competent E. coli BL21 (DE3) cells. The positive clones were identified by direct colony PCR and subjected to plasmid isolation, and the fidelity of the inserted fragment into pET-28b(+) vectors was confirmed by sequencing. Sequence analysis of tle gene The recombinant plasmids or PCR products were sequenced on both strands with an Applied Biosystems Model 377 automatic DNA sequencer. The open reading frame (ORF) search and the 1 Abbreviations used: ORF, open reading frame; NCBI, national center biotechnology information; RACE, rapid amplification of cDNA ends; IPTG, isopropyl-b-d-thiogalactopyranoside; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; BSA, bovine serum albumin; CNDE, 2-carboxyethyl-3-cyano- 5-methylhexanoic acid ethyl ester; pNPB, p-nitrophenyl butyrate.

deduced amino acid sequence analysis were performed with BLAST program provided by NCBI [18] and ExPASy [19]. The theoretical molecular mass and pI were calculated using the web site http:// web.expasy.org/compute_pi/. The multiple alignments among similar enzymes were performed with ClustalW [20], and the picture of the sequence alignment was made using the program ESPript [21]. The signal peptide prediction was performed by SignalP 4.1 Server [22]. Structural modeling The three-dimensional homology model of TLE was obtained by homology modeling from the SWISS-MODEL protein-modeling server [23]. The server returned a model using the X-ray crystal structure of an esterase from the hyperthermophilic microorganism Pyrobaculum calidifontis VA1 (PDB ID: 3ZWQ) [24] as template that shares 36% sequence identity with TLE. The visualization was performed with PyMOL program (www.pymol.org). Expression and purification of TLE E. coli BL21 (DE3) cells harboring the pET28-TLE were grown in a 500 mL flask containing 100 mL of LB medium with 50 mg/L kanamycin at 37 °C until optical density at 600 nm reached 0.6, then induced with 0.1 mM isopropyl-b-D-thiogalactopyranoside (IPTG). After incubation at 16 °C for 20 h with shaking at 150 rpm, cells were harvested by centrifugation (8000g, 10 min) at 4 °C and suspended in binding buffer (500 mM NaCl, 20 mM imidazole, 50 mM Tris–HCl, pH 8.0). The cells were disrupted by sonication, and the supernatant was collected by centrifugation (12,000g, 15 min) at 4 °C. The sample was loaded onto a Ni–NTA column (10 mL) that pre-equilibrated with binding buffer. Then the column was washed with washing buffer (500 mM NaCl, 50 mM imidazole, 50 mM Tris–HCl, pH 8.0). Finally, the bound protein was eluted with eluting buffer (500 mM NaCl, 500 mM imidazole, 50 mM Tris–HCl, pH 8.0). The fractions containing the hexahistidine-tagged TLE were collected, dialyzed overnight, lyophilized and stored at 20 °C. The purified enzyme was used for characterization experiments. The purity and molecular mass of the protein were analyzed by 12% sodium dodecyl sulfate– polyacrylamide gel electrophoresis (SDS–PAGE) under denaturing conditions in Laemmli system [25]. The concentrations of proteins were measured according to the method of Bradford [26] using bovine serum albumin (BSA) as the standard. Substrate specificity to various p-nitrophenyl esters Substrate specificities for various p-nitrophenyl esters (acyl chain lengths ranging from C2 to C16) were determined as previously described [27]. One unit of enzyme activity was defined as the amount of enzyme releasing 1 lmol of p-nitrophenol per minute under measurement conditions. Effects of pH and temperature on esterase activity and stability The optimum pH of esterase TLE was determined in a pH range of 6.0–10.0 using citric acid/sodium phosphate buffer (pH 6.0–7.0), potassium phosphate buffer (pH 7.0–8.0), Tris–HCl buffer (pH 7.5–8.9) and Gly-NaOH buffer (pH 9.0–10.0), respectively. The enzyme stability at each pH was estimated by incubating the enzyme solution with different buffers at pH 6.0–10.0 at 4 °C for 12 h. The optimum temperature was tested at different temperatures (30–70 °C) in 100 mM Tris–HCl buffer at pH 8.0 using pNPB as substrate. At each temperature, the buffer and TLE were preincubated for 5 min, and then the pNPB was added to initiate the reaction. To further investigate the thermostability, the purified

X.-J. Li et al. / Protein Expression and Purification 101 (2014) 1–7

enzyme was pre-incubated in Tris–HCl buffer (20 mM, pH 8.0) at various temperatures (50 °C, 60 °C, and 70 °C), and samples were withdrawn at fixed time intervals and then cooled immediately to assay the residual activity. All experiments were conducted in triplicate if not specified. Effects of mental ions on esterase activity The effects of various metal ions and EDTA on the enzyme activity were measured. The esterase was preincubated at 40 °C with various compounds at a final concentration of 1 mM for 30 min in Tris–HCl buffer (100 mM, pH 8.0), and the residual esterase activities were then estimated according to the standard activity assay method mentioned above. Enantioselective hydrolysis towards CNDE The hydrolysis of CNDE was carried out in Tris–HCl buffer (100 mM, pH 8.0) with 10 mM CNDE and 2 mM calcium acetate. After addition of the purified esterase, the mixture was incubated at 40 °C with shaking at 150 rpm. The reaction mixture was extracted with ethyl acetate, and the organic layer was dried over anhydrous sodium sulfate for GC analysis. Enantiomeric compositions of residual ester and the corresponding acid in the reaction system were determined by GC-14C gas chromatography as described previously [13,27]. The conversion and enantiomeric ratio (E) were calculated based on e.e.S and e.e.P as the method developed by Rakels [28].

3

Results and discussion Cloning of tle gene The partial tle gene with length 630 bp was amplified using cDNA as the template with the degenerate primers DP-2 and oligo(dT)28, and BLAST analysis revealed the fragment showed strong homology with fungal esterase/lipase gene. But only little non-specific product was amplified by PCR using degenerate primers DP-1-F and DP-1-R. To obtain the complete structural gene of tle, the 50 -flanking regions (549 bp) was amplified by RACE method using a 50 -RACE Kit. The full-length tle gene consisted of an ORF of 945 bp, was amplified with the primers P4 and P5. It begins with ATG and terminates with TAA and encodes a putative polypeptide of 314 amino acid residue with a predicted molecular weight of 34,531 Da. The tle nucleotide sequence has been deposited in the GenBank database under Accession No. KF305767. Sequence analysis and homology modeling SignalP4.1 Server program analysis revealed the full-length open reading frame of TLE did not contain a predicted signal peptide. The deduced amino acid sequence of TLE was used to perform a BLAST search in the National Center for Biotechnology Information database. The amino acid sequences alignment result (Fig. 1) showed that TLE from T. lanuginosus DSM10635 shares the highest identity (50%) with hypothetical protein from Nectria haematococca

Fig. 1. Multiple alignments of amino acid sequences of TLE and homologous proteins. The putative catalytic triad Ser-His-Asp was annotated with filled circles. Abbreviations: TLE, esterase from T. lanuginosus DSM10635 (GenBank Accession No. KF305767); NHE, Nectria haematococca hypothetical protein (XP_003039087); ACE, Aspergillus clavatus esterase/lipase (XP_001270742); AOE, Aspergillus oryzae esterase/lipase (XP_001824552); ANE, Aspergillus niger esterase/lipase (XP_001400475); AKE, Aspergillus kawachii esterase/lipase (GAA84300); AFE, Aspergillus flavus esterase/lipase (XP_002376763); PCE, Pyrobaculum calidifontis esterase (BAC06606).

4

X.-J. Li et al. / Protein Expression and Purification 101 (2014) 1–7

(Accession No. XP_003039087). In addition, TLE exhibited 41%, 40%, 40%, 39% and 35% identities with Aspergillus niger esterase/ lipase (Accession No. XP_001400475), Aspergillus clavatus esterase/lipase (Accession No. XP_001270742), Aspergillus kawachii esterase/lipase (Accession No. GAA84300), Aspergillus oryzae esterase/lipase (Accession No. XP_001824552), and Aspergillus flavus esterase/lipase (Accession No. XP_002376763), respectively. The newly cloned enzyme belongs to member of the esterase/lipase superfamily based on the amino acid sequence identity. The amino acid sequence of TLE was 36% identity to that of the thermostable esterase from the hyperthermophilic archaeon P. calidifontis VA1 (PestE, GenBank accession No. YP_001056197). The crystal structure data of PestE has been reported in the PDB database (PDB ID: 3ZWQ) [24]. The 3D model of TLE was obtained by SWISS-MODEL serve using 3ZWQ as template. Based on the homology model of TLE (Fig. 2), the amino acid residues Ser151, His279, and Asp249 form the catalytic triad, which is typically found in a/b-hydrolases. The key nucleophile Ser151 is found within the conserved amino acid motif GXSXG (X denotes any amino acid residue). The oxyanion hole is composed of Ser81 and Gly82 within the conserved sequence motif HGSG (amino acid residues 79–82) and Ala152. Heterologous expression and purification of recombinant TLE The recombinant vector pET28-TLE, which places the tle gene under the control of a T7 promoter, was transformed into the E. coli BL21 (DE3) and induced by IPTG. The induced crude extract containing the esterase were analyzed by SDS–PAGE (Fig. 3). Recombinant TLE was purified to homogeneity from the supernatants of cell lysates by single-step affinity chromatography on a

Fig. 3. SDS–PAGE analysis of soluble expressed and purified of TLE. Lane 1, protein molecular weight marker, lane 2, the crude extract of the recombinant strain without induced by IPTG, lane 3, soluble extract of recombinant strain with induced by IPTG, lane 4, the recombinant TLE purified using nickel ion affinity chromatography.

Ni–NTA column. SDS–PAGE of the purified enzyme gave a single band corresponding to a molecular of about 35 kDa (Fig. 3), which

Fig. 2. The overall 3D structure of TLE obtained by homology modelling. Ser151, Asp249, and His279 form the catalytic triad (represented by sticks models, colored green). The oxyanion hole was consisted of Ser81, Gly82 and Ala152 (represented by sticks models, colored blue). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

X.-J. Li et al. / Protein Expression and Purification 101 (2014) 1–7

5

Effect of temperature on TLE activity and thermostability The effect of temperature on the activity and stability of recombinant TLE were determined. As shown in Fig. 6A, the enzyme showed maximum activity at 60 °C and retained 80% of its maximum activity at 65 °C. However, its activity was decreased significantly when the temperature exceed 65 °C. For determination of the thermostability, the purified enzyme was pre-incubated in Tris–HCl buffer (20 mM, pH 8.0) at different temperatures, and the residual activity was measured at fixed time intervals. The enzyme retained 50% of its initial activity after 8 h incubation at optimum temperature (60 °C), and kept even 53% activity after 60 min incubation at 70 °C (Fig. 6B). The thermostability of TLE was similar with the thermophilic lipase and glucoamylase from T. lanuginosus [11,14], and superior to that of the b-xylosidase from T. lanuginosus[8]. TLE was proved to be a thermophilic esterase.

Fig. 4. Substrate specificity of TLE for p-nitrophenyl esters. The activity towards pnitrophenyl butyrate was taken as 100%.

was in accordance with the molecular weight calculated from the amino acid sequence obtained as described above. Substrate specificity to various p-nitrophenyl esters To examine substrate specificity of the enzyme, various p-nitrophenyl esters with different acyl chain lengths (C2–C16) were tested as substrates (Fig. 4). The esters of moderate to short chain fatty acids (C < 8) served as good substrates for the enzyme, and it displayed the highest activity (192 U/mg) towards p-nitrophenyl butyrate (C4). No lipolytic activity was observed against p-nitrophenyl palmitate (C16). These results indicated that TLE is indeed an esterase rather than a lipase. Effect of pH on TLE activity and stability The effect of pH on the activity and stability of recombinant TLE was determined. As shown in Fig. 5A, TLE displayed high activity at pH values between 7.5 and 9.0, and the optimal pH was approximately 8.5. However, the enzyme exhibited low activity below pH 7.0 or above pH 9.0. The pH stability was tested after incubation of purified TLE in various buffers at pH 6.0–10.0. After 12 h incubation at 4 °C, TLE displayed more than 80% residual activity in the pH range from 7.0 to 9.0 (Fig. 5B).

Effects of mental ions on esterase activity As shown in Table 2, the effect of various mental ions and EDTA on the activity of TLE was determined. Interestingly, esterase activity was notably enhanced by Ca2+ and Ba2+. The highest relative activity (143 ± 2.5%) was observed in the presence of Ca2+, which may be due to the conserved calcium-binding site near the active site [29,30]. The presence of Mg2+, Na+, K+, and Li+ did not have significant influence on enzyme activity at the tested concentration. Other metal ions have apparent negative effect on the esterase activity. Especially, Fe3+ caused a marked decrease of relative activity. The metal chelating agent EDTA at the concentration of 1 mM had no significant effect on the esterase activity, suggesting that TLE was not a metalloenzyme. Enantioselective hydrolysis of CNDE Kinetic resolution of racemic CNDE by the purified TLE was performed at a concentration of 10 mM. The reaction profile was shown in Fig. 7 and a conversion of 41.2% with an e.e.P of 96% was achieved after 6 h. The enzyme presented a significant enantiopreference towards (S)-CNDE. The hydrolysis product, i.e., (3S)2-carboxyehtyl-3-cyano-5-methylhexanoic acid, is a valuable chiral intermediate for Pregabalin, which is a lipophilic derivative of 4-aminobutyric acid (GABA) and has been developed to a new blockbuster drug for the treatment of several central nervous system disorders [31]. TLE showed high enantioselectivity toward CNDE, and the E-value of the reaction was 95. Meanwhile, a similar result was obtained by using the recombinant E. coli whole-cell

Fig. 5. Effect of pH on activity (A) and stability (B) of TLE.

6

X.-J. Li et al. / Protein Expression and Purification 101 (2014) 1–7

Fig. 6. Effect of temperature on activity (A) and thermostability (B) of TLE.

Table 3 Comparison of CNDE resolution between TLE and other esterases.

Table 2 Effects of mental ions and EDTA on esterase activity. Chemical reagents

Relative activity (%)

Chemical reagents

Relative activity (%)

Esterase source

Catalyst form

E-Value

Selectivity Reference

Control Fe2+ Fe3+ Ni2+ Cu+ Ca2+ Cu2+ Mn2+ Ba2+

100.0 83.5 ± 1.7 13.7 ± 0.9 59.7 ± 1.9 61.6 ± 2.8 143.0 ± 2.5 59.5 ± 1.8 70.2 ± 2.1 132.0 ± 3.2

Zn2+ Co2+ Mg2+ Al3+ Na+ K+ Li+ EDTA

72.3 ± 2.1 58.6 ± 2.0 110.3 ± 1.9 74.2 ± 0.9 101.7 ± 2.3 104.1 ± 4.6 98.6 ± 2.5 103.9 ± 0.9

Mucor miehei esterase

Lyophilized powder Lyophilized powder Lyophilized powder Wet cells

52

S

2

S

2

S

82

S

[27]

Purified enzyme or recombinant E. coli cell

95

S

This study

Pig liver esterase Cholesterol esterase Morgarella morganii esterase Thermomyces lanuginosus esterase (TLE)

[32]

DSM10635 is a potential candidate for the enantiomeric resolution of CNDE, although there have reported the lipase Lip [13] and LipolaseÒ [32], a commercially available lipase from T. lanuginosus, showed excellent enantioslectivity toward CNDE (E > 200). Further investigations on the engineering of this esterase are in progress, which would make it possible for TLE used in the efficient biosynthesis of chiral intermediate of Pregabalin. Conclusions

Fig. 7. Progress curves of the kinetic resolution of CNDE. Symbols: (d), e.e. value of (3S)-2-carboxyethyl-3-cyano-5-methylhexanoic acid; and (j), the conversion ratio of CNDE, respectively.

instead of the purified TLE as biocatalysts in the kinetic resolution of CNDE. Four esterases, including Morgarella morganii esterase [27], Mucor miehei esterase, pig liver esterase and cholesterol esterase [32] have been used for kinetic resolution of CNDE (Table 3). Nevertheless, only the Mucor miehei esterase and Morgarella morganii esterase were reported for efficient kinetic resolution of CNDE with moderate to good enantioselectivity. Among the reported esterases, TLE showed the highest E-value in the kinetic resolution of racemic CNDE. In this sense, the esterase from T. lanuginosus

A novel esterase gene was successfully cloned from T. lanuginosus DSM10635 with degenerate RT-PCR and RACE-PCR methods. The tle gene (945 bp), encoded a 314 amino acids protein with a predicted molecular mass of 34.5 kDa. The 3D model of TLE was obtained by homology modeling, and the putative catalytic triad of TLE is composed of Ser151, His279, and Asp249. The biologically active form of this esterase was successfully expressed in E. coli. Recombinant enzyme was purified by single-step affinity chromatography on a Ni–NTA column. The characteristics and substrate specificity of the purified TLE were studied. TLE showed the highest hydrolytic activity towards p-nitrophenyl butyrate (C4) among all tested p-nitrophenol esters. The purified TLE was stable at <60 °C (pH 6.0–9.0), and showed the highest activity at 60 °C (pH 8.5). Ca2+ and Ba2+ stimulate the TLE activity. Furthermore, TLE exhibited high enantioselectivity (E = 95) in the kinetic resolution of CNDE into (3S)-2-carboxyethyl-3-cyano-5-methylhexanoic acid, a valuable chiral intermediate for Pregabalin. Taken together, this is the first report on the cloning, heterologous expression and characterization of esterase from T. lanuginosus.

X.-J. Li et al. / Protein Expression and Purification 101 (2014) 1–7

Acknowledgements The authors greatly appreciate the help of Dr Chee Keong Tan for his kindness in editing this manuscript. This research was supported by 863 Program (2012AA022201), 973 Program (2011CB 710806), Key Scientific and Technology Programs of Zhejiang Province (2012C03005-2) and National Major Project of Scientific Instruments Development of China (2012YQ150087).

References [1] T. Panda, B.S. Gowrishankar, Production and applications of esterases, Appl. Microbiol. Biotechnol. 67 (2005) 160–169. [2] U.T. Bornscheuer, Microbial carboxyl esterases: classification, properties and application in biocatalysis, FEMS Microbiol. Rev. 26 (2002) 73–81. [3] G.D. Haki, S.K. Rakshit, Developments in industrially important thermostable enzymes: a review, Bioresour. Technol. 89 (2003) 17–34. [4] I. Lasa, J. Berenguer, Thermophilic enzymes and their biotechnological potential, Microbiologia 9 (1993) 77–89. [5] H.B. Li, X.B. Zhang, Characterization of thermostable lipase from thermophilic Geobacillus sp TW1, Protein Expr. Purif. 42 (2005) 153–159. [6] R. Maheshwari, G. Bharadwaj, M.K. Bhat, Thermophilic fungi: their physiology and enzymes, Microbiol. Mol. Biol. Rev. 64 (2000) 461–488. [7] S. Singh, A.M. Madlala, B.A. Prior, Thermomyces lanuginosus: properties of strains and their hemicellulases, FEMS Microbiol. Rev. 27 (2003) 3–16. [8] Z. Chen, H. Jia, Y. Yang, Q. Yan, Z. Jiang, C. Teng, Secretory expression of a betaxylosidase gene from Thermomyces lanuginosus in Escherichia coli and characterization of its recombinant enzyme, Lett. Appl. Microbiol. 55 (2012) 330–337. [9] A. Schlacher, K. Holzmann, M. Hayn, W. Steiner, H. Schwab, Cloning and characterization of the gene for the thermostable xylanase XynA from Thermomyces lanuginosus, J. Biotechnol. 49 (1996) 211–218. [10] M. Gaffney, S. Carberry, S. Doyle, R. Murphy, Purification and characterisation of a xylanase from Thermomyces lanuginosus and its functional expression by Pichia pastoris, Enzyme Microb. Technol. 45 (2009) 348–354. [11] Y.Y. Zheng, X.H. Guo, N.N. Song, D.C. Li, Thermophilic lipase from Thermomyces lanuginosus: Gene cloning, expression and characterization, J. Mol. Catal. B: Enzym. 69 (2011) 127–132. [12] W. Prathumpai, S.J. Flitter, M. McIntyre, J. Nielsen, Lipase production by recombinant strains of Aspergillus niger expressing a lipase-encoding gene from Thermomyces lanuginosus, Appl. Microbiol. Biotechnol. 65 (2004) 714– 719. [13] X.J. Li, R.C. Zheng, H.Y. Ma, Y.G. Zheng, Engineering of Thermomyces lanuginosus lipase Lip: creation of novel biocatalyst for efficient biosynthesis of chiral intermediate of Pregabalin, Appl. Microbiol. Biotechnol. 98 (2014) 2473–2483. [14] T.S. Thorsen, A.H. Johnsen, K. Josefsen, B. Jensen, Identification and characterization of glucoamylase from the fungus Thermomyces lanuginosus, Biochim. Biophys. Acta, Proteins Proteomics 1764 (2006) 671–676.

7

[15] B.S. Chadha, K. Rubinder, H.S. Saini, Constitutive alpha-amylase producing mutant and recombinant haploid strains of thermophilic fungus Thermomyces lanuginosus, Folia Microbiol. 50 (2005) 133–140. [16] R.M. Berka, M.W. Rey, K.M. Brown, T. Byun, A.V. Klotz, Molecular characterization and expression of a phytase gene from the thermophilic fungus Thermomyces lanuginosus, Appl. Environ. Microbiol. 64 (1998) 4423– 4427. [17] R.F. Guo, B.S. Shi, D.C. Li, W. Ma, Q. Wei, Purification and characterization of a novel thermostable chitinase from Thermomyces lanuginosus SY2 and cloning of its encoding gene, Agric. Sci. China 7 (2008) 1458–1465. [18] S.F. Altschul, W. Gish, W. Miller, E.W. Myers, D.J. Lipman, Basic local alignment search tool, J. Mol. Biol. 215 (1990) 403–410. [19] E. Gasteiger, A. Gattiker, C. Hoogland, I. Ivanyi, R.D. Appel, A. Bairoch, ExPASy: the proteomics server for in-depth protein knowledge and analysis, Nucleic Acids Res. 31 (2003) 3784–3788. [20] D.G. Higgins, CLUSTAL W: multiple alignment of DNA and protein sequences, Methods Mol. Biol. 25 (1994) 307–318. [21] P. Gouet, E. Courcelle, D.I. Stuart, F. Metoz, ESPript: analysis of multiple sequence alignments in PostScript, Bioinformatics 15 (1999) 305–308. [22] T.N. Petersen, S. Brunak, G. von Heijne, H. Nielsen, SignalP 4.0: discriminating signal peptides from transmembrane regions, Nat. Methods 8 (2011) 785–786. [23] K. Arnold, L. Bordoli, J. Kopp, T. Schwede, The SWISS-MODEL workspace. A web-based environment for protein structure homology modelling, Bioinformatics 22 (2006) 195–201. [24] G.J. Palm, E. Fernandez-Alvaro, X. Bogdanovic, S. Bartsch, J. Sczodrok, R.K. Singh, D. Bottcher, H. Atomi, U.T. Bornscheuer, W. Hinrichs, The crystal structure of an esterase from the hyperthermophilic microorganism Pyrobaculum calidifontis VA1 explains its enantioselectivity, Appl. Microbiol. Biotechnol. 91 (2011) 1061–1072. [25] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [26] M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–252. [27] R.C. Zheng, T.Z. Wang, D.J. Fu, A.P. Li, X.J. Li, Y.G. Zheng, Biocatalytic synthesis of chiral intermediate of pregabalin with high substrate loading by a newly isolated Morgarella morganii ZJB-09203, Appl. Microbiol. Biotechnol. 97 (2013) 4839–4847. [28] J.L.L. Rakels, A.J.J. Straathof, J.J. Heijnen, A simple method to determine the enantiomeric ratio in enantioselective biocatalysis, Enzyme Microb. Technol. 15 (1993) 1051–1056. [29] X.J. Fan, X.L. Liu, Y.H. Liu, The cloning and characterization of one novel metagenome-derived thermostable esterase acting on N-acylhomoserine lactones, J. Mol. Catal. B: Enzym. 83 (2012) 29–37. [30] Q.C. Ji, S.J. Xiao, B.F. He, X.N. Liu, Purification and characterization of an organic solvent-tolerant lipase from Pseudomonas aeruginosa LX1 and its application for biodiesel production, J. Mol. Catal. B: Enzym. 66 (2010) 264–269. [31] R.B. Silverman, From basic science to blockbuster drug: The discovery of Lyrica, Angew. Chem. -Int. Ed. 47 (2008) 3500–3504. [32] C.A. Martinez, S. Hu, Y. Dumond, J. Tao, P. Kelleher, L. Tully, Development of a chemoenzymatic manufacturing process for pregabalin, Org. Process Res. Dev. 12 (2008) 392–398.