Third trimester NG2-positive amniotic fluid cells are effective in improving repair in spinal cord injury

Experimental Neurology 254 (2014) 121–133

Contents lists available at ScienceDirect

Experimental Neurology journal homepage: www.elsevier.com/locate/yexnr

Third trimester NG2-positive amniotic fluid cells are effective in improving repair in spinal cord injury Daniele Bottai a,⁎, Giuseppe Scesa a, Daniela Cigognini a,1, Raffaella Adami a, Emanuela Nicora a, Sergio Abrignani b, Anna Maria Di Giulio a, Alfredo Gorio a,⁎ a b

Department of Health Science, Faculty of Medicine, University of Milan, Via A. di Rudinì 8, 20142 Milan, Italy Istituto Nazionale di Genetica Molecolare-INGM, Via Francesco Sforza, 28, 20122 Milan, Italy

a r t i c l e

i n f o

Article history: Received 23 September 2013 Revised 20 January 2014 Accepted 23 January 2014 Available online 29 January 2014 Keywords: Amniotic fluid cells Spinal cord injury NG2 Angiogenesis HGF

a b s t r a c t Spinal cord injury presents a significant therapeutic challenge since the treatments available are mostly vain. The use of stem cells to treat this condition represents a promising new therapeutic strategy; therefore, a variety of stem cell treatments have been recently examined in animal models of CNS trauma. In this work, we analyzed the effects of third trimester amniotic fluid cells in a mouse model of spinal cord injury. Among the different cultures used for transplantation, some were able to induce a significant improvement in motor recovery (cultures #3.5, #3.6 and #7.30), evaluated by means of open field free locomotion. All effective cell cultures expressed the surface marker nerve/glial antigen 2, ortholog of the human chondroitin sulfate proteoglycan 4, which is present on several types of immature progenitor cells. The improved motor functional recovery was correlated with higher myelin preservation in the ventral horn white matter and an increased vascularization in the peri-lesion area. Real-Time PCR analysis showed higher expression levels of vascular endothelial growth factor and hypoxia-inducible factor-1α mRNA two days after cells transplantation compared to PBS-treated animals, indicating that an angiogenic pathway might have been activated by these cells, possibly through the production of hepatocyte growth factor. This cytokine appears to be produced mostly in filtering organs, such as the lung, of the transplanted animals and is likely released in the blood suggesting an endocrine role of hepatocyte growth factor in targeting the injury site. © 2014 Elsevier Inc. All rights reserved.

Introduction Spinal cord injury (SCI) is still one of the unresolved issues in medicine. No treatment that would lead to repair and recovery of function of the damaged spinal cord is available yet. Besides the pharmacological approach, a cellular method had been suggested (Puceat and Ballis, 2007; Reier, 2004; Schultz, 2005). Stem cells suitable for transplantation should be characterized by availability, efficient proliferative activity, and capacity to differentiate into cell types specific for the damaged tissue namely, in this case, neurons, oligodendrocytes and astrocytes. On this site, the studies of embryonic appendages are a powerful tool, and the amniotic fluid stem cells could represent a good example (Murphy and Atala, 2013). Human amniotic fluid cells (AFCs) have been used in diagnostics for prenatal detection of genetic anomalies for more than 50 years (Gosden, 1983); however, their therapeutic potential for human diseases has been described only recently (Cananzi et al., 2009). Mesenchymal stem cells (MSCs) were the first to be described within the ⁎ Corresponding authors. Fax: +39 02 50323033. E-mail addresses: [email protected] (D. Bottai), [email protected] (A. Gorio). 1 Cigognini D. C. present address: Network of Excellence for Functional Biomaterials (NFB), National University of Ireland, Galway, IDA Business Park, Dangan, Galway, Ireland. 0014-4886/$ – see front matter © 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.expneurol.2014.01.015

AFCs, and possess proliferation ability and differentiation plasticity comparable to that of adult mesenchymal stem cells; furthermore, they are able to differentiate towards mesodermal lineages (Cananzi et al., 2009). AFCs represent a novel class of pluripotent stem cells with intermediate characteristics between embryonic and adult stem cells, since they can differentiate into lineages representative of all the three germ layers with the advantage of lacking tumorigenic potential in vivo (De Coppi et al., 2007; Li et al., 2009; Siegel et al., 2008). This picture makes AFCs a promising candidate for application to tissue engineering and stem cell therapy in regenerative medicine. We have recently reported the isolation and characterization of AFCs at the term of gestation (Bottai et al., 2012); such a choice was prompted by lesser ethical issues and higher future availability (Hall, 2010). Moreover, these AFCs showed a high proliferation rate and the expression of neural markers, all attributes that could be suggestive for their use in the SCI treatment (Bottai et al., 2012). We previously observed that adult neural and embryonic stem cells improved functional recovery after SCI in the mouse (Bottai et al., 2008, 2010); hence, we aimed at testing the potential AFCs in the same animal model. Here we study five different AFCs cultures in a mouse model of SCI, and we show that three of them promoted recovery of hind limb function, attenuate loss of myelin, and increase angiogenesis at the lesion site.

122

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

Table 1 Real-Time PCR primer showing sequences and product size. Mm: Mus Musculus, Hs: Homo sapiens. GAPDH = Glyceraldehyde 3-phosphate dehydrogenase, HPRT-1 = hypoxanthine phosphoribosyltransferase-1, Ciclo = Cyclophilin, βμ-tub = βμ − tubulin, BDNF = Brain-derived neurotrophic factor, CNTF = Ciliary neurotrophic factor, IL-6 = Interleukin-6, LIF = Leukemia inhibitory factor, NGF = Nerve growth factor, NT3 = Neurotrophic factor-3, TNF-α = Tumor necrosis factor alpha, VEGF = Vascular endothelial growth factor, HIF = Hypoxia-inducible factors, IL-1 = Interleukin-1, PGF = Placental growth factor, HGF = Hepatocyte growth factor. Gene

Forward primer

Reverse primer

Product length bp

Mm GAPDH Mm HPRT-1 Mm Ciclo Mm buTub Mm BDNF Mm CNTF Mm IL6 Mm LIF Mm HIF Mm NGF Mm NT3 Mm TNFa Mm VEGF Mm PGF Mm IL1 HGF Hs IL1

TGCACCACCAACTGCTTAGC TGACACTGGCAAAACAATGCA GCGTCTCCTTCGAGCTGTT ATTCACCCCCACTGAGACTG CATTACCTTCCTGCATCTGTTGG ACATCAGTCTCCCGGTGGCATTAG GACAACCACGGCCTTCCCTAC AACGTGGAAAAGCTATGTGCG TCAGTGCACAGAGCCTCCT TGGGCCCAATAAAGGTTTTGCC ACGTCCCTGGAAATAGTCACACG TCTATGGCCCAGACCCTCACAC ACACGGTGGTGGAAGAAGAG CACTTGCTTCTTACAGGTCC CATGGAATCCGTGTCTTCCT TTGTCCCACATGGAACATGTAAG TTACAGTGGCAATGAGGATGA

GGCATGGACTGTGGTCATGAG GGTCCTTTTCACCAGCAAGCT AAAGTCACCACCCTGGCA TGCTATTTCTTTCTGCGTGC CGTGGACGTTTACTTCTTTCATGG TTCTCCGTGGCTTTGGGGTTTC CGTTGTTCATACAATCAGAATTGCC GCGACCATCCGATACAGCTC GCGGAGAAAGAGACAAGTCC TGGGCTTCAGGGACAGAGTCTCC TTGGATGCCACGGAGATAAGC CAGCCACTCCAGCTGCTCCTC CAAGTCTCCTGGGGACAGAA CACCTCATCAGGGTATTCAT GAGCTGTCTGCTCATTCACG CACTGACCCAAACATCCGAGTT TGTAGTGGTGGTCGGAGATT

86 94 146 182 158 151 169 101 209 165 109 100 145 174 100 149 131

These positive effects correlate with gene expression changes of two of the major players in angiogenesis such as vascular endothelial growth factor (VEGF) and hypoxia-inducible factor-1α (HIF-1α), and are restricted only to nerve/glial antigen 2 (NG2)-positive AFCs. Those cells lacking NG2 expression fail to improve recovery. The therapeutic activity might be driven by the ability of these cells to produce or induce the production of hepatocyte growth factor (HGF), a cytokine involved in the early phases of the angiogenic pathway. Materials and methods Cell culture Third-trimester human AF specimens were isolated and characterized for surface markers included NG2 as already reported (Bottai et al., 2012): briefly human AF specimens were harvested during cesarean births, samples (10–15 ml) were collected by a 20 ml syringe inserted through the uterine wall during cesarean section. Written informed consent was obtained from pregnant women and the study protocol was approved by the Institutional Review Board of the San Paolo Hospital of Milano. Within 2 h from collection, AF specimens were transferred in 15 ml tubes and centrifuged at 300 g for 10 min, the supernatant was discarded, the pellet was resuspended in growth medium and plated in six 35 mm culture dishes containing eight 10 mm round glass coverslips. Cells were cultured in a medium (AFCs medium) composed of Dulbecco's modified Eagle's medium (DMEM; Euroclone) low-glucose, 10% fetal bovine serum (FBS; Euroclone), 5 ng/ml basic fibroblast growth factor (bFGF; Peprotech EC), 2 mM L-glutamine (Euroclone) and penicillin (100 U/ml)/streptomycin (100 mg/ml) solution (Euroclone) (pen/strep) and maintained at 37 °C in a humidified 5% CO2 and 5% O2 incubator. Few days later coverslips were removed and placed in separate wells of a 48-multiwell plate. Once cells populated the well, they were treated with a tripsin-like solution (TrypLE Express; Invitrogen), collected and replated into one well of a 6multiwell plate. Cells were then frozen or cultured. For further culturing, cells were passaged when they reached 80% confluence (every 4–7 days) and seeded at a density of 10,000 cells/cm2. Cell viability before plating was assessed by Trypan Blue exclusion test. NG2 detection Cell cultures #7.30, #3,5, #9.1 and #1.1 were plated in a 48 multiwell plate, containing a round glass coverslip, at the density of 15,000 cells/cm2

in AFCs medium. The following day, the medium was changed with new AFCs. Cells were maintained in AFCs medium until 80% of confluency and then fixed in 4% of paraformaldehyde. The fixed cells were stained for NG2 using rabbit anti-NG2, (AB5320, Chemicon, 1:100) antibody. Cell labeling with Q-dot We used Qtracker Cell Labeling Kit (Invitrogen) (Q-dot) for labeling the cells. This is because Q-dot staining does not interfere with the process of cell proliferation, and the cells retain the label for more than 6 weeks in vitro (Rosen et al., 2007); furthermore, Q-dot does not transfer to adjacent cells after transplantation (Rosen et al., 2007). Briefly, suspended AFCs were incubated with labeling solution for 45 min at 37 °C following the manufacturer instruction. After incubation cells were washed twice with DMEM and suspended in sterile PBS at a concentration of 1 × 104 cells/μl. Cell viability was assessed by Trypan Blue exclusion assay. The efficiency of cell labeling was confirmed by confocal microscopy. Animals Adult male CD1 mice (weighing 28–30 g) were used in this study. Animals were housed under standard conditions (22 ± 2 °C, humidity 65%, and artificial light from 08.00 am to 08.00 pm). Food and water were available ad libitum. All animal procedures were approved by the Review Committee of the University of Milan and met the Italian guidelines for laboratory animals, which conform to the European Communities Directive (86/609/EEC). Spinal cord injury and post-surgical care Moderate spinal cord injury was induced by using an Infinite Horizon (IH) Impactor (Precision Systems and Instrumentation). The surgical procedures and the post-surgical care were performed as described previously (Bottai et al., 2008, 2010) at T8 level. Briefly, mice were anesthetized with 4% chloral hydrate. A laminectomy was performed at T8 level, and the exposed dorsal surface of the cord was subjected to a moderate contusion injury with a force of 50 Kdyne for 1 s and a displacement range between 300 to 600 μm. After injury, the muscles were sutured, and the skin was closed with surgical clips. The animals were administered buprenorphine (0.03 mg/kg) for pain control before awakening. Antibiotics penicillin (100 U/ml)/streptomycin (100 mg/ml) solution (Euroclone) (pen/strep) and lactate Ringer's

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

123

solution were administered for 7 days following the surgery. The expression of mouse's bladder was performed daily until bladder reflex recovered. Experimental groups and transplantation Animals were tested for their free locomotion performance before the lesion and only those scoring 9 to the Basso Mouse Scale (BMS) (Basso et al., 2006) were included in the study. Injured animals were divided into six groups for behavioral analysis. Mice were transplanted by intravenous injection (i.v.) of 106 cells (twice 500,000 in 50 μl of vehicle). Five cultures were tested: #9.1, #7.30, in parallels experiments we also used the cultures #1.1, #3.5, and #3.6. Controls were injected with the vehicle (PBS). The transplantation was performed one week after lesion, while the immunosuppression via intra-peritoneal injection of cyclosporine A (Sigma-Aldrich) was performed according the following scheme: daily 50 mg/kg for the first week, beginning six days after lesioning, then 25 mg/kg for three days and 10 mg/kg for the following 18 days. Immunosuppression was delayed to reduce the high mortality occurring when the transplantation was performed at the same time of SCI induction. Twenty-four animals with vehicle, six with culture #1.1, eleven with culture #9.1, fifteen with culture #3.5, seven with culture #3.6, and fifteen with culture #7.30 were transplanted. Eight animals died within the first week due to urinary problems (2 from control group, 2 from group #9.1, 1 from group #7.30, 2 from group #3.5 and 1 from group #3.6), thus their behavioral data were not included in the study. At the end of the behavioral analysis period (four weeks after transplantation), these mice were processed for immunohistochemical study. The score assessment was performed in a blinded manner. Behavioral testing The recovery of the hind-limb motor performance was evaluated according to the Basso Mouse Scale (BMS) (Basso et al., 2006). The BMS ranges from score 0, indicating no movement of the hind-limb, to a maximum of 9 that corresponds to the movement ability of the unlesioned mouse. The hind-limb performance was assessed observing each mouse for 4 min in an open field and in blinded fashion at 1, 4, 7, 11, 14, 18, 21, 25, 28, 32 and 35 days post-injury. Histology and immunofluorescence study of the spinal cord

Fig. 1. Effect of PBS and AFCs treatments on recovery of open field locomotor activity after SCI. Locomotor recovery was evaluated over one month period (time = days), and the assessment was based upon the 9-point BMS scale. Values represent means ± SEM. We analyzed the statistical differences with Two-way Anova followed by Bonferroni post-test. A. Comparison of the motor recovery between cell-treated and PBS-treated animals. ▼ PBStreated mice (n = 33); □ #3.5 AFCs-treated animals (n = 16); □ #3.6 AFCs-treated animals (n = 8); □ #7.30 AFCs-treated animals (n = 15); □ #9.1 AFCs-treated animals (n = 9); □#1.1 AFCs-treated animals (n = 6). B. ■ T-AFCs-treated mice (n = 39); □ NT-AFCs-treated mice (n = 15); ▼ PBS-treated mice (n = 33). Significance symbols: ***; °°°: p b 0.001; **, °°: p b 0.01; *, °: p b 0.05. ***, ** and * T-AFCs-treated mice versus PBS-treated mice; °°°, °° and ° T-AFCs-treated mice versus NT-AFCs-treated mice. BMS: Basso Mouse Scale.

Two days, one and four weeks after cell transplantation, the animals were deeply anesthetized with 1 ml of 4% chloral hydrate and perfused transcardially with 4% paraformaldehyde in PBS; spinal cords were then dissected-out, maintained overnight in 4% paraformaldehyde at 4 °C, and then rinsed three times in phosphate buffer (PB). The cords were subsequently placed at first in 15% sucrose-phosphate buffer saline (PBS) for 3 h and in 30% sucrose-PBS overnight. Specimen were embedded in optimal cutting temperature compound (OCT), and frozen on dry ice and cut into 10 μm-thick transverse sections by means of a cryostat (Leica CM1850). For immunofluorescence studies, the sections were rinsed with PBS, treated with blocking solution and incubated with primary antibodies overnight at 4 °C. We used the following primary antibodies: rat antimouse macrophages/monocytes (MOMA-2, MAB1852, Chemicon, 1:25), monoclonal anti-glial fibrillary acidic protein (GFAP) (MMS-435P, Covance, 1:500) as a marker for astrocytes, and anti-mouse neuronal class III β-tubulin (TUJ1, PRB-4357, Covance, 1:200, or MAB1637, Chemicon, 1:200) as a marker for neurons; in addition, we used rabbit anti-NG2, (AB5320, Chemicon, 1:100) antibody, mouse anti-nestin monoclonal antibody (MAB353, Chemicon, 1:100), anti CD31 antibody (PECAM-1 (platelet/endothelial cell adhesion molecule-1) sc-1506, Santa Cruz Biotechnology, 1:70). After treatment with primary

124

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

antibodies, sections were washed with PBS and incubated with secondary antibodies Alexa 555-conjugated donkey anti-mouse and Alexa 546conjugated goat anti-rabbit 1:1000 or Alexa 488 conjugated donkey anti-mouse and goat anti-rabbit (Invitrogen, 1:1000), for 1 h at room temperature. Sections were then washed in PBS, counterstained with DAPI and mounted using the FluorSave Reagent (Calbiochem). Negative controls (no primary antibody) were included. Assessment of myelin sparing in the area of injury Myelin preservation was evaluated comparing the levels of myelin in the ventral white matter within an extensive volume around the lesion. The choice of the ventral white matter was based on the knowledge that the reticular spinal pathway descends mostly in the ipsilateral dorsoand ventrolateral funiculi and is directly involved in the regulation of the movement of the mouse foot (Vitellaro-Zuccarello et al., 2007). Green FluoroMyelin (Invitrogen) was used to stain myelin (Bottai et al., 2008, 2010). The sections were washed with PBS and incubated with FluoroMyelin for 20 min. The sections were then washed in PBS, counterstained with DAPI and mounted using the FluorSave Reagent. Negative controls (without FluoroMyelin) were included. The levels of myelin were analyzed by means of a volumetric measurement spanning the lesion site. In order to carry out a homogeneous analysis, the staining with Green FluoroMyelin was performed on sections of control and treated animals placed on the same coverslip. The confocal microscope images for the control and AFCs-treated mice were obtained using the same thickness, wavelength, pinhole and intensity of the acquisition. As reference we used sections close to the ones analyzed and not treated with FluoroMyelin. Assessment of vascular bed volume in the injured area In order to detect the changes in the vascular bed volume, we stained the sections with Texas Red Lectin (Lycopersicon esculentum agglutinin) (Vector laboratories) and CD31. Briefly, for the co-staining of lectin and CD31after the staining with primary antibody anti-CD31 and the secondary antibody Alexa 488 conjugated goat anti-rabbit (Invitrogen, 1:1000), the sections were washed with PBS and incubated with Texas Red Lectin for 2 h. The sections were then washed in PBS, counterstained with DAPI and mounted using the FluorSave Reagent. When the single lectin staining was performed the sections were washed with PBS and incubated with Texas Red Lectin (1:50 in PBS 0.01 M) for 2 h. The sections were then washed in PBS, counterstained with DAPI and mounted using the FluorSave Reagent. Negative controls (without primary antibody and Texas Red Lectin) were included. The relative volume of the vascular bed per unit gray matter volume was estimated by the point counting method (Weibel, 1979). A point grid was randomly overlaid onto confocal images (three for each animal) of ventral horn transverse sections stained with lectin. The area associated to each point was 50 μm2. The vessel size was estimated by counting the points falling on each vascular profile and classified in four arbitrary classes: vessels hit by 1 or 2 points, by 3 or 4 points, by 5–10 points and more than 10 points. Sections were observed by fluorescence and confocal microscopy. Macrophages at the lesion site MOMA-2 positive cells were counted in the transversal sections in a region of 400 μm centered at the lesion site. As negative reference for the confocal analysis we used a consecutive section that was stained omitting the primary antibody. The zero level was adjusted on this

Fig. 2. NG2 expression in four of the transplanted cultures (in decreasing order of expression. A: #7.30, B: #3.5, C: #9.1 and D: #1.1). Scale bar 20 μm.

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

125

Fig. 3. Immunofluorescence staining of the spinal cord 1 mm rostrally to the lesion site. AFCs labeled with Q-dot (magenta) were transplanted in lesioned mice one week after contusion. Ten micrometers tick tissue slice of the mice killed 4 weeks after transplantation were immunostained for GFAP (green), β-tubulin (red) nuclei (blue), and Q-dot staining (magenta). A: low magnification of the spinal cord ventral horn. Magnifications 1, 2, 3 and 4 indicated in Figure A by rectangles. Enlargements also reported their thickness (xz, yz) in order to highlight the cellular localization of the GFAP, β-tubulin, DAPI and Q-dot, Scale bar in A is 75 μm, in the enlargement 1 (representative for all the magnifications) scale bar is 25 μm.

reference and used for all the further analysis (we used a new zero reference for each new staining). The total number of MOMA-2 positive cells was obtained integrating the cells counted in a section for the volume analyzed. The number of cells counted in a section (10 μm thick) was corrected considering the size of the section and the size of the cells, we assumed an overall diameter of 21 μm for macrophage, whereas that of transplanted AFCs was considered 8 μm (Yan et al., 2007). Lung and blood harvesting In another set of experiment 34 animals were lesioned and transplanted with cells #7.30, #9.1, or treated with the vehicle as controls (three animals died due to urinary problems, one for each group). Two days (6 controls, 3 #9.1 treated and 3 #7.30 treated) or one weeks (5 controls, 5 #9.1 treated and 9 #7.30 treated) after transplantation, the animals were killed with an overdose of 4% chloral hydrate and perfused transcardially with PBS. The lungs were split in half; one half was fixed overnight in 4% paraformaldehyde at 4 °C. Then tissues were processed as described for the spinal cord with only a difference in the last step in sucrose treatment at 30% that contained a quarter of a volume of OCT. The other halves of lungs were transferred in a tube containing TRI Reagent (Sigma-Aldrich) for the preparation of RNA. We kept the tissues at − 80 °C until use. Blood was obtained at one, two, and seven days after transplantation from tails or after the animal sacrifice to perform analysis of HGF protein level by means of western blot. Immunohistochemical analysis of the lung The tissues were sliced into 10 μm-thick sections, using a cryostat, and stored at −20 °C. For immunofluorescence studies, the sections were treated as described in the previous paragraph “Histology and immunofluorescence study of the spinal cord”. We used the following primary antibodies: rabbit anti HGFα chain polyclonal (H-145) (sc-7949, Santa Cruz Biotechnologies CA, USA). As secondary antibodies, we used Alexa 488 conjugated goat anti-rabbit 1:1000) for 2 h at room temperature. Negative controls (no primary antibody) were included. HGF positive cells were counted in 10 μm thick lung sections. As negative reference for the confocal analysis we used a consecutive section that was stained omitting the primary antibody. The zero level was

adjusted on this reference and used for all the further analysis (we used a new zero reference for each new staining). RNA isolation from spinal cord and lung tissue The RNA isolation and the Real-Time PCR were performed as already described in previous papers (Bottai et al., 2008, 2010). Briefly, two and seven days after transplantation, lesioned mice were tested for their motor performance by BMS analysis and then they were anesthetized and killed by decapitation. Laminectomy was performed between T5 and T12, and the spinal cord was exposed. Three mm of tissue across the injured area were removed, collected and immediately placed into 1 ml of TRI Reagent (Sigma-Aldrich). We kept the tissues at − 80 °C until use. cDNA synthesis and Real-Time PCR Total RNA was isolated from spinal cord and lung using TRI Reagent method (Sigma Aldrich) according to the manufacturer's instructions. Total RNA concentrations were determined reading its absorbance with a spectrophotometer (NanoDrop 2000c Thermo Fisher Scientific Inc). The genomic DNA was removed by DNase I (1 U for 5 μg of RNA) (BioLabs) treatment. Next, 0.5 μg of total RNA was reverse-transcribed using iScriptTM cDNA Synthesis Kit (Bio-Rad) according to the manufacturer's protocol. Real-Time PCR was performed with an MJ Opticon 2. The 15-μl reaction contained iQ SYBR Green Supermix (BioRad), sense and antisense gene-specific primers (Table 1) and cDNA template. The housekeeping genes choice and the analysis of the RealTime PCR results were performed by qbase platform (Biogazelle, Belgium). After incubation at 95 °C for 10 min, samples were subjected to 40 cycles at 95 °C for 15 s, 60 °C for 1 min. Negative controls (RNA not reverse-transcribed) were included in order to exclude the presence of genomic DNA. The sequence and the product size of the primers used for Real-Time PCR are reported in Table 1. Plasma preparation Blood obtained from the tail or after euthanasia was treated with citric acid (final concentration 3.8% w/v) and centrifuged at 1,800 g for

126

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

10 min. The supernatant was transferred to a new tube, and the protein concentration was evaluated by means of Lowry–Ciocalteau method. Quantitative assays of HGF levels Western blotting in the plasma Ten micrograms of denatured plasma proteins were loaded per lane and analyzed by 10% SDS–PAGE. Proteins were transferred to nitrocellulose membranes (Amersham, Arlington Height, USA), and blocked at room temperature for 2.5 h with 5% dry milk (Merck, Darmstadt, Germany) in Tween-Tris Buffer Saline Solution (T-TBS) (Tween 20 0.05%); membranes were, then, incubated overnight at 4 °C with antibodies against HGFα (1:200; Santa Cruz, Biotechnology), in T-TBS and

BSA 5%. Subsequently, membranes were washed and incubated for 1 h with the appropriate Horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5000; Chemicon). The reaction was quantified by using the SuperSignal West femto Chemiluminescent Substrate (Pierce, Rockford, IL, USA). Densitometric analysis was performed by Kodak MJ project program measuring the volume of the bands corresponding to HGF. Data were expressed as relative changes in optical density. In vitro treatments with inflammation inducers Cell cultures #7.30 and #9.1 were plated in a 48 multiwell plate containing a round glass coverslip at the density of 15,000 cells/cm2 in AFCs medium. The following day, the medium was changed with AFCs

Fig. 4. Analysis of the level of myelin. A: Volumetric analysis of the levels of myelin in a T-AFCs (in red) treated mouse and in a PBS-treated control (in black), B: FluoroMyelin staining of the 10 μm transverse section respectively at 1.2 mm rostrally to the lesion (a and b), at the lesion (c and d) and 1.5 mm caudally to the lesion (e and f), a, c and e T-AFCs treated animal, b, d and f PBS treated animal), arrows indicate the ventral funicoli were the ventral reticular spinal tract is located. C: Statistical analysis of the changes in myelin levels in transplanted animals compared to the control PBS-treated animals. These results represent the difference in myelin levels in a cord region spanning the lesion site; the data were obtained as average of the outcome of different cellular treatments: #3.5, #3.6 and #7.30 compared to the vehicle treatment. Values represent means ± SEM. We analyzed the statistical differences with unpaired t test. Significance symbols: **: p b 0.01. Scale bar 100 μm. AU: arbitrary unit.

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

127

Fig. 5. Vascular compartment in the ventral horn 0.9 mm rostrally to the site of injury. A and B confocal analysis of lectin (red) and CD31 (green) co-staining of 10 μm thick transverse section. A: Lesioned not transplanted animal (PBS); B: Lesioned and cell transplanted animal (T-AFCs); Sections 1 and 2 respectively from panel A and B (indicated by the squares) represent the enlargements of some vessels where it is clear the co-localization between lectin and CD31 staining. Some non-vessel staining is present for CD31 (green channel) and most likely represents the presence of platelets and some sub-populations of T-lymphocytes. C: Statistical analysis of the relative changes in lectin levels in transplanted animals compared to the control animals. Values represent means ± SEM. We analyzed the statistical differences with unpaired t test. AU: arbitrary units. Scale bar 100 μm for A and B, scale bar 10 μm for enlargement 1 and 2. Significance symbols: **: p b 0.01.

induction medium containing Interleukin (IL)-1β (Chemicon) (concentration 0.1 ng/ml) or Lipopolysaccharide (LPS) (Sigma-Aldrich) (concentration 200 ng/ml). Cells were maintained in these media for 2, 8, 16, and 24 h. Cells were then fixed with 4% paraformaldehyde for 5 min and washed with PBS. As control cultures, #7.30 and #9.1 were maintained in AFCs medium and fixed in paraformaldehyde. The fixed cells were stained for HGF antibody in order to evaluate any difference in protein level expression. Statistical analysis Data are expressed as mean (AV) ± Standard Error Mean (SEM). Data from BMS scores was evaluated by two-way Anova followed by Bonferroni post-test, Real-Time PCR was evaluated using unpaired t test. The statistic differences of the myelin level, the number of the vessels, and the macrophage infiltration were evaluated by unpaired t test. The statistic differences in HGF expressing cells number in the lung, the changes in HGF levels in the in in vitro experiments, and the HGF protein level in the blood were analyzed by means of one way Anova followed by Bonferroni's multiple comparison test. Results were considered statistically significant at p b 0.05. Results AFCs transplantation and recovery of hind-limb function The hind limb motor function of the lesioned mice was analyzed in open field and the score was determined according to the BMS (Basso et al., 2006). The experimental animals scored the maximum (9 points) prior injury; then such score fell to 0 the day after lesioning (Fig. 1). Treatment with cyclosporine was initiated six days after SCI and was followed by i.v. injection with 106 cells of the cultures #7.30, #3.5, #3.6, #9.1 and #1.1 or the vehicle (50 μl twice) the day after. The outcome of locomotion tests of the different animals groups is reported in Fig. 1A. The result of the cell treatment was variable, with cultures #7.30, #3.5 and #3.6 that induced a significant difference (p b 0.05) in the motor behavior respect to the vehicle-treated sample and #9.1 and #1.1 cultures-treated mice did not show any significant difference if compared with the PBS-treated animal as demonstrated by means of a Two-way Anova analysis followed by Bonferroni posts-test. On the basis of these results we grouped separately the animals treated with the cultures, #7.30, #3.5 and #3.6 which have a therapeutic outcome (Therapeutic-AFCs treated mice: T-AFCs) and those treated with the cultures #9.1 and #1 that did not show any therapeutical effect (Non Therapeutic-AFCs treated mice: NT-AFCs) as reported in Fig. 1B. Starting from

the fourth day after transplantation, the treatment with T-AFCs (Fig. 1B) promoted a significant improvement in recovery compared to vehicle 4.83 ± 0.23 n = 33 versus PBS: 3.80 ± 0.22 n = 33 p b 0.01). These scores correspond respectively to occasional or frequent plantar stepping without coordination, for the T-AFCs treated animals, and to plantar placement with or without weight support for the PBS-treated animals. Differently, NT-AFCs promoted a recovery of function comparable to that of PBS. Finally, T- and NT-AFCs showed a significantly different capacity to induce a motor recovery with a value at 28 days after injury of T-AFCs: 4.83 ± 0.230 n = 33 p b 0.01 versus NT-AFCs: 3.36 ± 0.210 n = 7.

NG2 expression in AFCs An interesting outcome of the transplantation experiments was that all the cultures with therapeutic properties expressed the surface marker (Chondroitin Sulfate Proteoglycan) NG2 (# 3.5, # 3.6 and # 7.30) in all their cells (100% of expression); on the contrary, the NT-AFCs (#1.1 and # 9.1) did not express such a marker (0% of expression), as it was demonstrated by means of immunocytochemistry in Fig. 2 and Fluorescence-activated cell sorting (FACS) (Bottai et al., 2012). This surface marker is found on cells considered precursors of oligodendrocytes and may have a role in angiogenesis.

The behavioral improvement is not due to substitution of lost cells Since the transplantation of the T-AFCs induced a significant improvement in hind limb functional recovery compared to the PBStreated controls, we assessed the possible accumulation of the transplanted AFCs into the lesioned spinal cord at 35 days after lesioning. Differently than expected, only a minute number of the transplanted cells was detected in the injured cord. The Q-dot positive cells were 496 ± 109, (Average ± SEM) in the 0.4 mm wide region spanning the lesion. Moreover, these cells found in the lesion site were shown different fate (Fig. 3). The enlargements 1, 2, 3, and 4 show Q-dot positive (in magenta) cells of a AFCs transplanted mouse with different characteristics. Enlargement 1 shows a cell that does not express GFAP nor β-tubulin III; magnification 2 displays a cell which expresses GFAP (green) and β-tubulin III (red); enlargement 3 exhibits a cell which express only β-tubulin III; and finally magnification 4 shows a cell which expresses only GFAP.

128

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

Chemokine and Growth Factor expression in the injured spinal cord The positive behavioral effect was suggestive of a modification of the environment at lesion site by AFCs; thus, the expression of neurotrophic factors and inflammatory cytokines was assayed two days after AFCs administration. We analyzed the mRNA levels of several different cytokines: BDNF; CNTF; IL6; IL1; LIF; NGF; NT3; PGF, and TNF-α. The assessment was performed comparing the T8 lesioned region of the spinal cord of animals treated with PBS, AFCs #7.30 or #3.5 and #9.1. The choice of housekeeping genes and the analysis of the Real-Time PCR results were performed by qbase platform (Biogazelle, Belgium). No statistical significant difference among groups (data not shown) was observed in the expression of BDNF; CNTF; IL6; IL1; LIF; NGF; NT3; PGF, and TNF-α, suggesting that other cytokines might be involved in the recovery of motor function.

confocal analysis at one month after transplantation (Fig. 6). The estimated MOMA-2 positive cells number was 827 ± 244 (n = 3) in PBStreated animals (Fig. 6C), and 300 ± 52 (n = 6) (p b 0.05) in T-AFCs-

Preservation of ventral myelin An important pathway involved in the coordination of the rhythmic stepping movements and in eliciting locomotion is the reticulospinal tract that descends mainly in the ipsilateral dorso- and ventrolateral funiculi (Ballermann and Fouad, 2006; Mori et al., 1998). The reticulospinal tract may be partially spared by our lesioning paradigm which mainly affects the dorsal and central part of the spinal cord. Here we analyzed the ventral white matter level of myelin in the region spanning the lesion site (Fig. 4A). Sequential transversal cryosections were stained with FluoroMyelin, and the fluorescence labeling of the ventral horn of PBSand AFCs-treated mice was compared. Pictures 4B (a, b, c, d, e and f) indicate the level of the myelin at different distance from the lesion site. A complete volumetric assessment across the lesion was performed; in Fig. 4A is shown that the levels of myelin of the ventral white matter of mouse treated with #7.30 culture was higher than the PBS-treated mouse in 6 mm region across the lesion. Compared to PBS-treated animals, the levels of myelin were higher in the cord of the T-AFCs-treated mice both rostrally and caudally to the lesion site (Fig. 4A and B a, c and e compared to b, d and f). One month after transplantation the levels of preserved myelin in T-AFCs-treated-mice (average of #3.5, #3.6 and #7.30 cultures) were significantly higher (181.7% ± 17, n = 7) than in the PBS-treated mice (100% n = 4 p b 0.01), Fig. 4C. No difference in myelin preservation was observed between animals transplanted with NT-AFCs and controls (data not shown). Enhanced angiogenesis at lesion site The relative volume of the vascular compartment in the ventral horn at the lesion site was significantly different among the experimental groups (Fig. 5A, and enlargement 1, and B and enlargement 2, should be considered representative pictures of the lectin level in PBS- and TAFCs-treated animals respectively, at 900 μm from the epicenter of the lesion). The quantification of the small size vessels number revealed that the vascular bed increased more than 65% in the T-AFCs-(#7.30) treated mice compared to the PBS-treated mice (Fig. 5C) (167.71 ± 4.83 n = 4 versus 100.00 ± 6.36, n = 2, p b 0.001) as obtained by means of lectin staining. In Fig. 5A and B and relative enlargements 1 and 2) is also showed the colocalization of the staining of lectin and CD31). Analogous results were obtained when the animals were treated with #3.5 and #3.6 cell cultures. No difference between animals treated with NT-AFCs cells and these with PBS was observed. The enhanced angiogenesis might have contributed to both improved hind limb recovery and myelin preservation, and it suggests subtle molecular differences in the path of action between effective and not-effective AFCs. Reduced macrophage infiltration at the lesion site MOMA-2 positive macrophage cells were quantitatively estimated in the 400 μm spanning the lesion site by means immunostaining and

Fig. 6. Confocal analysis of the 10 μm transverse section at the lesion site. Staining for MOMA-2 (macrophages staining) 100 μm rostrally to the lesion epicenter, four weeks after the transplantation. MOMA-2 in red, nuclei in blue, Q-dot in green. A) PBS-treated mouse; B) T-AFCs-treated mouse; 1, 2, 3, 4, 5 and 6 were enlargements located by rectangles on the panels A and B indicating the thickness (xz, yz) of the slice and the distribution of the MOMA-2 staining and the presence (enlargements 4, 5 and 6) of Q-dot derived from phagocytosed transplanted cells. C) Relative number of macrophages. Values represent means ± SEM. We analyzed the statistical differences with unpaired t test. Significance symbols: *: p b 0.05. Scale bar 50 μm in B is representative also for panel A. Enlargements 1, 2, 3, 4, 5 and 6 scale bar 10 μm.

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

129

Table 2 Summary of the Real-Time PCR analysis in two tissues (Spinal cord and Lung) and with different cells treatments CTR (PBS)-, T- and NT-treated mice. T- and NT-AFCs. Fold changes: relative change of the mRNA transcript between samples. Mm: Mus musculus. Gene of interest

Sample

Tissue

Fold changes

Time (days)

Statistical significance

MmVEGF MmVEGF MmHIF MmHIF HGF HGF MmIL1b HGF

Therapeutic/PBS Therapeutic/PBS Therapeutic/PBS Therapeutic/PBS Therapeutic/PBS Therapeutic/PBS Therapeutic/Non therapeutic Therapeutic/Non therapeutic

Spinal cord Spinal cord Spinal cord Spinal cord Spinal cord Spinal cord Lung Lung

2.4 2.4 1.7 0.15 no no 2.28 1.4

2 7 2 7 2 7 2 2

p p p p

treated animals. Fig. 6A and B show a representative image of the sections taken 100 μm from the lesion site of PBS-treated animal and T-AFCs cells-treated respectively. The magnifications 1, 2 and 3 for panel A and 4, 5, and 6 for panel B show the cellular localization of the MOMA-2 staining and for enlargements 4, 5, and 6 also the presence of Q-dot labeling indicating that some macrophages phagocytosed Q-dot positive transplanted cells (Q-dot dots are here indicated in green). Indeed, many of the MOMA-2 positive cells 36.9% ± 10.8% (n = 6) were also Q-dot stained indicating the fate of a fraction of the

b b b b

0.0286 0.0285 0.0140 0.0290

p b 0.036 p b 0.047

transplanted AFCs. In details, 26.2% ± 7.4% (n = 6) of Q-dot positive cells, that were still present in the lesion, was also positive for MOMA-2. Changes in mRNA transcripts of angiogenic factors at lesion site A significant increased expression of MmVEGF mRNA at the lesion site was observed in #7.30 AFCs treated animals at both two and seven days after transplantation (2.4 folds increase versus PBS p b 0.05 at both the time points) (Table 2). Differently, HIF-1α mRNA changes in a

Fig. 7. HGF expressing cells in the lung two and seven days after transplantation. A-H immunostaining for HGF: A, F: PBS; B, D and G: #9.1 and C, E, and H: #7.30. In blue are stained the nuclei, in green are stained the HGF positive cells, in red are stained Q-dot positive cells. A, B, C, D and E: two days after transplantation. F, G and H: one week after transplantation. I: quantification of the HGF expressing cells in the lung two days after transplantation; black bar: PBS; gray bar: #9.1 and white bar: #7.30. J: quantification of the HGF expressing cells in the lung seven days after transplantation; gray bar: PBS; dark gray bar: #9.1 and white bar: #7.30. Scale bar 50 μm in B is representative for all the pictures with the exception of D where the bar scale is 30 μm (and it is representative also for E). Significance symbols: *, °: p b 0.05, **: p b 0.01. * groups #9.1 and 7.30 compared to the PBS group; ° comparison between group #9.1 and 7.30. The statistical analysis was performed by means of one way Anova followed by Bonferroni's multiple comparison test.

130

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

biphasic fashion, higher at two days after transplantation of #7.30 AFCs (MmHIF 1.7 fold greater than PBS p b 0.014) and lower at one week compared to PBS-treated animals (MmHIF 0.15 fold than PBS p b 0.05) (Table 2). Moreover, we analyzed other transcripts which might be involved in the angiogenic pathway. In particular, we focused on HGF, that is also produced by MSC and is involved in angiogenesis, but no differences in mRNA were observed. HGF in lungs Mesenchymal stem cells are known to be able to produce many different cytokines (Soleymaninejadian et al., 2012). The evidence that our AFCs are able to induce a modulation of the levels of HIF-1α and VEGF mRNA, encouraged us to explore the possibility that HGF could have a role in the functional recovery of the cell treated animals. Filtering organs such as lungs, spleen and kidneys may be the site of accumulation of exogenous cells when these are applied through i.v. routes. By

means of Real-Time PCR analysis, we have detected a significant 1.4 fold (p b 0.05) increase of the HGF mRNA levels in the lungs of the #7.30 AFCs-treated animals compared to the #9.1 AFCs-treated animals (Table 2) two days after transplantation. The increased levels of HGF mRNA in lungs suggest that this might be the releasing site of circulating HGF. Two days after transplantation the number of HGF producing cells in lung of both the T- and NTAFCs-treated group was significantly greater than the PBS-control group, p b 0.01 (Fig. 7A, B, C and I). A trend difference in HGF expressing cells number was detected at two days between T- and NT-AFCs-treated group. This difference became significant one week after transplantation p b 0.05 (Fig. 7J). Moreover, a significant (p b 0.01) differences was observed between CTR and T-AFCs groups one week after transplantation (Fig. 7F, G, H and J). Finally, the number of AFCs (Q-dot labeled) in the lung tissue of T-AFCs (#7.30 cells) transplanted animals was almost double of NT-AFCs (#9.1 cells) treated animals (Fig. 7D and E) two days after transplantation.

Fig. 8. In vitro induction of HGF by means of inflammatory stimuli. Interleukin (IL)-1β and LPS treatments of the cultures #7.30 (T-AFCs) and #9.1 (NT-AFCs) for 0, 2, 8, 16 and 24 h. In the lower panels are represented the summary and the statistical analysis of the results obtained in four different experiments. Scale bar 75 μm is representative for all the pictures. The statistical analysis was performed by means of one way anova followed by Bonferroni's multiple comparison test. Significance symbols: *: p b 0.05.

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

In vitro HGF production by AFCs The ability of producing and releasing HGF protein in response to the application of inflammatory stimuli such LPS and IL-1β is an intrinsic feature of AFCs. T-AFCs #7.30 treated with IL-1β, increased HGF protein production of 4.19 folds at 16 h (p b 0.05), and when treated with LPS the increase was of 1.51 fold at the same time point (p b 0.05). Differently, NT-AFCs (#9.1) responded to IL-1β exposure by increasing HGF production by only 1.73 folds (p b 0.05) (Fig. 8). No significant effect was observed after LPS exposure of NT-AFCs cultures. Serum levels of HGF The higher expression of HGF in the blood of T-AFCs-treated mice was observed by means of western blot analysis at seven days after transplantation (Fig. 9). The HGF protein increase was 2.57 fold higher than after PBS treatment (p b 0.05). On the contrary, no significant difference was detected when animal were treated with NT-AFCS. No differences were detected two days after transplantation (data not shown). Discussion This study shows that the transplantation of a specific subclass of AFCs is capable of promoting motor functional recovery after spinal cord injury in the mouse. Similarly to previous observations made in our laboratory (Bottai et al., 2008, 2010), the effectiveness of the transplanted AFCs appears not mediated by the substitution of the lost neural tissue, but rather by attenuation of myelin loss and reduction of inflammatory cell influx into the lesion site. This quite complex effect might have been mediated by a specific cytokine such as HFG. Only NG2-positive AFCs are capable of enhancing HGF release and promoting recovery of function; meanwhile the NG2-negative cells, which can be considered as cellular negative control, were not able to do so. This expression of surface protein may represent a useful marker for early selection of AFCs or any kind of cells for treating such condition. The evaluation of motor function recovery, according to the BMS scale, indicates an average score for the T-AFCs-treated animals of 4.83 ± 0.23 versus 3.80 ± 0.22 for PBS-treated mice. The improvement seems slightly weaker than that observed using adult neural stem cells transplantation (Bottai et al., 2008), where the NSCs-treated animals

Fig. 9. HGF releasing in the blood circulation. Western blot analysis of the HGF level in the circulating blood. A: western blot, in each lane was loaded the same amount of protein as obtained by means of protein quantification. B: quantification of the panel A (n = 4 for each sample), gray bar: PBS; dark gray bar: #9.1 and white bar: #7.30. The statistical analysis was performed by means of one way anova followed by Bonferroni's multiple comparison test. Significance symbols: *: p b 0.05.

131

scored up to 5.14 ± 0.06. The explanation of such difference may lay in the transplant timing, that in this study was performed one week after lesioning, when the secondary degenerative process is already in full progress, while in the previous case it was done shortly after lesioning. In view of the reported results AFCs can be considered a reasonable source of stem cells effective in improving functional recovery after spinal cord injury. Recent studies have indicated that MSCs possess immunomodulatory properties (Uccelli et al., 2008). MSCs can inhibit the proliferation of T lymphocytes and microglial cells, and can modulate the cytokine production of other immune cells (Meirelles Lda et al., 2009). On the basis of these data the use of an immunosuppression should be not required; however, when we started the project we were not aware of this feature of the mesenchymal stem cells and we preferred to work in a safe side since we performed a xenograft of human stem cells in a mouse recipient; moreover, we were not aware of the homogeneity of our mesenchymal stem cells so that it was difficult to exclude whether a subset of our AFCs might have had some immunogenicity. Only a minute number of AFCs survived and was found in the lesioned cord a few weeks after transplantation; a large percentage of labeled cells were phagocytosed by macrophages. The positive action of T-AFCs cells likely occurred early after their administration as suggested by the precocious increase of VEGF (Bartholdi et al., 1997; Xiaowei et al., 2006) and HIF1α (Xiaowei et al., 2006) in the lesioned spinal cord that might be responsible of the promoted angiogenesis. Both increased angiogenesis and reduced influx of inflammatory cells might have strongly contributed to myelin sparing that is likely essential for achieving the improved recovery function. Our study failed to reveal the implication of a number of other cytokines except for HGF. It has been known for many years that HGF is a mesenchymal- or stromal-derived multipotent polypeptide which mediates epithelial– mesenchymal interactions. During embryogenesis, HGF supports organogenesis and morphogenesis of various tissues and organs, including the liver, kidney, lung, gut, mammary gland, tooth, skeletal system by means of its binding to c-Met a tyrosine kinase receptor. In adult tissues, HGF elicits a potent organotrophic function which supports the regeneration of organs including the liver, kidney, and lung (Matsumoto and Nakamura, 1996). HGF is produced by mesenchymal cells (Soleymaninejadian et al., 2012), and plays a role in angiogenesis (Nakamura and Mizuno, 2010); moreover, both HGF and its receptor (c-Met) are up-regulated after injury mainly in reactive astrocytes around the injured region, and continued to be up-regulated at least up to 56 days after spinal cord injury (Shimamura et al., 2007), moreover, in animal models of multiple sclerosis, HGF, produced by MSC and interacting with its receptor cMet, is able to promoting functional recovery through a concert of immune suppression and induction of myelination (Bai et al., 2012). In this scenario, the efficacy of HGF treatments in spinal cord injury was already demonstrated in animal models such as rats (Jeong et al., 2012) and monkeys (Kitamura et al., 2011). While no changes were observed at the lesion site in all experimental groups, Real-Time PCR showed a significant increase of the HGF mRNA levels in the lungs of T-AFCs-treated animals compared to the NTAFCs-treated animals (Table 2). The major homing site of AFCs was the lung. As already demonstrated (Detante et al., 2009; Schrepfer et al., 2007), transplanted MSC homed mostly in lung, when intravenously injected in a rodent model of stroke (Detante et al., 2009). Consistently with these results, we found that the HGF levels in serum of the TAFCs-treated animals were significantly higher than in NT-AFCstreated or PBS-treated animals indicating that the therapeutic cells have a superior capacity of producing HGF; moreover, these data were supported by the finding that the relative number of HGF producing cells detected in the lungs was significantly different between T- and NT-AFCs-treated animals. These data are consistent with the results of Park (Park et al., 2010) which demonstrated that Human mesenchymal stem cell-derived Schwann cell-like were able to induce neuroprotective effects by means of the production of HGF and VEGF.

132

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133

Fig. 10. Hypothesis of the transplanted cells motor recovery mechanisms. The increased levels of HGF mRNA and protein in lung sustained by T-AFCs transplantation is detected in the injured organs by means of the phosphorylation of the c-Met receptor at these sites. This binding is able to induce an increase of HIF-1α and VEGF at the lesion site and this induces an increased angiogenesis that reflects in myelin preservation. On the other site, the increased levels of HGF protein in lung induce a lower macrophage infiltration at the lesion site and consequently a superior preservation of myelin.

Although the increase of HGF is mostly systemic rather than local, the action of this growth factor is probably localized at spinal cord level. Indeed, an increased plasma levels of HGF suggest a systemic exposure to higher circulating HGF, with a predominant accumulation of effects in the injured organs (Nakamura and Mizuno, 2010). Intact organs can escape HGF receptor (c-Met) activation by blood HGF, because the phosphorylation status of amino-acid Ser-985 of the c-Met receptor is bidirectionally regulated through reverse activities of Protein Kinase C (PKC) δ/ϵ and protein phosphatase 2A (PP2A), a serine/threonine protein phosphatase. The Ser-985 phosphorylation of c-Met mediated via PKCs and PP2A is a distinctive mechanism, which confers cellular responsiveness/unresponsiveness to HGF, depending on the extracellular environment and conditions (Hashigasako et al., 2004; Nakamura and Mizuno, 2010). The molecular aspects underlying the therapeutical effect of some cultures (#3.5, #3.6 and #7.30) compared to others (#1.1 and #9.1) are described in Fig. 10. Our study suggests that the production of HGF in the lungs might be the main actor to be responsible of the myelin sparing at the lesion site. NG2-positive AFCs capability to bring about the production of HGF might have been produced by means of IL1 increased levels caused by SCI inflammation (Gorio et al., 2007; Pan et al., 2002). The higher blood level of HGF may induce HIF-1α expression and activity in the spinal cord, and an increase in angiogenesis with a better preservation of myelin at lesion site. In this view, some cultures such as #1.1 and #9.1 were not able to give rise to significantly different motor recover if compared with PBS-treated controls. Even if these cells were able to increase HGF levels, this increment was not sufficient to exert a therapeutic action. Another specific aspect of these cells deserves further investigation. We previously reported (Bottai et al., 2012) that, a few AFCs express NG2. Human CSPG4, originally called high molecular weightmelanoma-associated antigen (HMW-MAA) or melanoma chondroitin sulfate proteoglycan (MCSP), was first identified 30 years ago on human melanoma cells (Wilson et al., 1981). Analogous investigations identified the rat ortholog of CSPG4 termed nerve/glial antigen 2 (Stallcup, 2002) or mouse ortholog AN2 (Stegmuller et al., 2002). CSPG4 and NG2 are highly conserved, and many of the significant ideas regarding the significance and functions of CSPG4 are based on studies from the orthologs. NG2 is expressed on several types of immature progenitor cells; not only by glioma cells and oligodendrocyte progenitors, but also by pericytes, where they play a role in cell proliferation and migration which stimulates endothelial cells motility during microvascular morphogenesis (Stallcup and Huang, 2008). Many of the attributes of pericytes, especially the ones found in the brain, are reminiscent to MSCs (Dore-Duffy and Cleary, 2011; Kang et al., 2010), pericytes are also able to produce HGF (Liu et al., 2007). Indeed, brain pericytes and MSCs express similar markers such as CD44 +, CD73 +, CD90 +, CD105+, Sca-1+, CD9, CD45− and CD11b− (Crisan et al., 2008; Kang et al., 2010), that are very close of our AFCs immunological markers

pattern (CD73+, CD90+, CD105+ and CD45 − (Bottai et al., 2012)). In addition, pericytes, MSC, and third trimester AFCs, in a lesser extent, show a differentiation potential towards the mesoderm lineage (Bottai et al., 2012; Crisan et al., 2008; De Coppi et al., 2007; Farrington-Rock et al., 2004). We cannot state that some of third trimester AFCs cells are pericytes; however, the presence of NG2 proteoglycan in all the cells of the cultures #3.5, #3.6, #7.30, and its complete absence in cultures #1.1 and #9.1 (detected by means of immunocytochemistry and Fluorescence-activated cell sorting (FACS), (Bottai et al., 2012)) could be related with their capability to improve recovery of function following spinal cord injury. The knock down of the NG2 in therapeutical cells might indicate whether this gene could be, in a future, a useful marker for the purification of effective T-AFCs from freshly obtained amniotic fluid. Acknowledgments The project was supported by FAIP (Federation of Paraplegic Associations of Italy), Fondazione Il Sangue, Milan, Italy, and Neurogel en Marche, Crolle, France, to Alfredo Gorio. The project was also supported by the Vertical Foundation (IT) to Daniele Bottai. References Bai, L., Lennon, D.P., Caplan, A.I., DeChant, A., Hecker, J., Kranso, J., Zaremba, A., Miller, R.H., 2012. Hepatocyte growth factor mediates mesenchymal stem cell-induced recovery in multiple sclerosis models. Nat. Neurosci. 15, 862–870. Ballermann, M., Fouad, K., 2006. Spontaneous locomotor recovery in spinal cord injured rats is accompanied by anatomical plasticity of reticulospinal fibers. Eur. J. Neurosci. 23, 1988–1996. Bartholdi, D., Rubin, B.P., Schwab, M.E., 1997. VEGF mRNA induction correlates with changes in the vascular architecture upon spinal cord damage in the rat. Eur. J. Neurosci. 9, 2549–2560. Basso, D.M., Fisher, L.C., Anderson, A.J., Jakeman, L.B., McTigue, D.M., Popovich, P.G., 2006. Basso Mouse Scale for locomotion detects differences in recovery after spinal cord injury in five common mouse strains. J. Neurotrauma 23, 635–659. Bottai, D., Madaschi, L., Di Giulio, A.M., Gorio, A., 2008. Viability-dependent promoting action of adult neural precursors in spinal cord injury. Mol. Med. 14, 634–644. Bottai, D., Cigognini, D., Madaschi, L., Adami, R., Nicora, E., Menarini, M., Di Giulio, A.M., Gorio, A., 2010. Embryonic stem cells promote motor recovery and affect inflammatory cell infiltration in spinal cord injured mice. Exp. Neurol. 223, 452–463. Bottai, D., Cigognini, D., Nicora, E., Moro, M., Grimoldi, M.G., Adami, R., Abrignani, S., Marconi, A.M., Di Giulio, A.M., Gorio, A., 2012. Third trimester amniotic fluid cells with the capacity to develop neural phenotypes and with heterogeneity among sub-populations. Restor. Neurol. Neurosci. 30, 55–68. Cananzi, M., Atala, A., De Coppi, P., 2009. Stem cells derived from amniotic fluid: new potentials in regenerative medicine. Reprod. Biomed. Online 18 (Suppl. 1), 17–27. Crisan, M., Yap, S., Casteilla, L., Chen, C.W., Corselli, M., Park, T.S., Andriolo, G., Sun, B., Zheng, B., Zhang, L., Norotte, C., Teng, P.N., Traas, J., Schugar, R., Deasy, B.M., Badylak, S., Buhring, H.J., Giacobino, J.P., Lazzari, L., Huard, J., Peault, B., 2008. A perivascular origin for mesenchymal stem cells in multiple human organs. Cell Stem Cell 3, 301–313. De Coppi, P., Bartsch Jr., G., Siddiqui, M.M., Xu, T., Santos, C.C., Perin, L., Mostoslavsky, G., Serre, A.C., Snyder, E.Y., Yoo, J.J., Furth, M.E., Soker, S., Atala, A., 2007. Isolation of amniotic stem cell lines with potential for therapy. Nat. Biotechnol. 25, 100–106. Detante, O., Moisan, A., Dimastromatteo, J., Richard, M.J., Riou, L., Grillon, E., Barbier, E., Desruet, M.D., De Fraipont, F., Segebarth, C., Jaillard, A., Hommel, M., Ghezzi, C.,

D. Bottai et al. / Experimental Neurology 254 (2014) 121–133 Remy, C., 2009. Intravenous administration of 99mTc-HMPAO-labeled human mesenchymal stem cells after stroke: in vivo imaging and biodistribution. Cell Transplant. 18, 1369–1379. Dore-Duffy, P., Cleary, K., 2011. Morphology and properties of pericytes. Methods Mol. Biol. 686, 49–68. Farrington-Rock, C., Crofts, N.J., Doherty, M.J., Ashton, B.A., Griffin-Jones, C., Canfield, A.E., 2004. Chondrogenic and adipogenic potential of microvascular pericytes. Circulation 110, 2226–2232. Gorio, A., Madaschi, L., Zadra, G., Marfia, G., Cavalieri, B., Bertini, R., Di Giulio, A.M., 2007. Reparixin, an inhibitor of CXCR2 function, attenuates inflammatory responses and promotes recovery of function after traumatic lesion to the spinal cord. J. Pharmacol. Exp. Ther. 322, 973–981. Gosden, C.M., 1983. Amniotic fluid cell types and culture. Br. Med. Bull. 39, 348–354. Hall, J., 2010. Midwifery basics: Blood tests for investigating maternal wellbeing. 1. Overview. Pract. Midwife 13, 40–42. Hashigasako, A., Machide, M., Nakamura, T., Matsumoto, K., 2004. Bi-directional regulation of Ser-985 phosphorylation of c-met via protein kinase C and protein phosphatase 2A involves c-Met activation and cellular responsiveness to hepatocyte growth factor. J. Biol. Chem. 279, 26445–26452. Jeong, S.R., Kwon, M.J., Lee, H.G., Joe, E.H., Lee, J.H., Kim, S.S., Suh-Kim, H., Kim, B.G., 2012. Hepatocyte growth factor reduces astrocytic scar formation and promotes axonal growth beyond glial scars after spinal cord injury. Exp. Neurol. 233, 312–322. Kang, S.G., Shinojima, N., Hossain, A., Gumin, J., Yong, R.L., Colman, H., Marini, F., Andreeff, M., Lang, F.F., 2010. Isolation and perivascular localization of mesenchymal stem cells from mouse brain. Neurosurgery 67, 711–720. Kitamura, K., Fujiyoshi, K., Yamane, J., Toyota, F., Hikishima, K., Nomura, T., Funakoshi, H., Nakamura, T., Aoki, M., Toyama, Y., Okano, H., Nakamura, M., 2011. Human hepatocyte growth factor promotes functional recovery in primates after spinal cord injury. PLoS One 6, e27706. Li, C., Zhou, J., Shi, G., Ma, Y., Yang, Y., Gu, J., Yu, H., Jin, S., Wei, Z., Chen, F., Jin, Y., 2009. Pluripotency can be rapidly and efficiently induced in human amniotic fluidderived cells. Hum. Mol. Genet. 18, 4340–4349. Liu, Y., Wilkinson, F.L., Kirton, J.P., Jeziorska, M., Iizasa, H., Sai, Y., Nakashima, E., Heagerty, A.M., Canfield, A.E., Alexander, M.Y., 2007. Hepatocyte growth factor and c-Met expression in pericytes: implications for atherosclerotic plaque development. J. Pathol. 212, 12–19. Matsumoto, K., Nakamura, T., 1996. Emerging multipotent aspects of hepatocyte growth factor. J. Biochem. 119, 591–600. Meirelles Lda, S., Fontes, A.M., Covas, D.T., Caplan, A.I., 2009. Mechanisms involved in the therapeutic properties of mesenchymal stem cells. Cytokine Growth Factor Rev. 20, 419–427. Mori, S., Matsui, T., Kuze, B., Asanome, M., Nakajima, K., Matsuyama, K., 1998. Cerebellarinduced locomotion: reticulospinal control of spinal rhythm generating mechanism in cats. Ann. N. Y. Acad. Sci. 860, 94–105. Murphy, S.V., Atala, A., 2013. Amniotic fluid and placental membranes: unexpected sources of highly multipotent cells. Semin. Reprod. Med. 31, 62–68. Nakamura, T., Mizuno, S., 2010. The discovery of hepatocyte growth factor (HGF) and its significance for cell biology, life sciences and clinical medicine. Proc. Jpn. Acad. B Phys. Biol. Sci. 86, 588–610.

133

Pan, J.Z., Ni, L., Sodhi, A., Aguanno, A., Young, W., Hart, R.P., 2002. Cytokine activity contributes to induction of inflammatory cytokine mRNAs in spinal cord following contusion. J. Neurosci. Res. 68, 315–322. Park, H.W., Lim, M.J., Jung, H., Lee, S.P., Paik, K.S., Chang, M.S., 2010. Human mesenchymal stem cell-derived Schwann cell-like cells exhibit neurotrophic effects, via distinct growth factor production, in a model of spinal cord injury. Glia 58, 1118–1132. Puceat, M., Ballis, A., 2007. Embryonic stem cells: from bench to bedside. Clin. Pharmacol. Ther. 82, 337–339. Reier, P.J., 2004. Cellular transplantation strategies for spinal cord injury and translational neurobiology. NeuroRx 1, 424–451. Rosen, A.B., Kelly, D.J., Schuldt, A.J., Lu, J., Potapova, I.A., Doronin, S.V., Robichaud, K.J., Robinson, R.B., Rosen, M.R., Brink, P.R., Gaudette, G.R., Cohen, I.S., 2007. Finding fluorescent needles in the cardiac haystack: tracking human mesenchymal stem cells labeled with quantum dots for quantitative in vivo three-dimensional fluorescence analysis. Stem Cells 25, 2128–2138. Schrepfer, S., Deuse, T., Reichenspurner, H., Fischbein, M.P., Robbins, R.C., Pelletier, M.P., 2007. Stem cell transplantation: the lung barrier. Transplant. Proc. 39, 573–576. Schultz, S.S., 2005. Adult stem cell application in spinal cord injury. Curr. Drug Targets 6, 63–73. Shimamura, M., Sato, N., Sata, M., Wakayama, K., Ogihara, T., Morishita, R., 2007. Expression of hepatocyte growth factor and c-Met after spinal cord injury in rats. Brain Res. 1151, 188–194. Siegel, N., Rosner, M., Hanneder, M., Freilinger, A., Hengstschlager, M., 2008. Human amniotic fluid stem cells: a new perspective. Amino Acids 35, 291–293. Soleymaninejadian, E., Pramanik, K., Samadian, E., 2012. Immunomodulatory properties of mesenchymal stem cells: cytokines and factors. Am. J. Reprod. Immunol. 67, 1–8. Stallcup, W.B., 2002. The NG2 proteoglycan: past insights and future prospects. J. Neurocytol. 31, 423–435. Stallcup, W.B., Huang, F.J., 2008. A role for the NG2 proteoglycan in glioma progression. Cell Adhesion Migr. 2, 192–201. Stegmuller, J., Schneider, S., Hellwig, A., Garwood, J., Trotter, J., 2002. AN2, the mouse homologue of NG2, is a surface antigen on glial precursor cells implicated in control of cell migration. J. Neurocytol. 31, 497–505. Uccelli, A., Moretta, L., Pistoia, V., 2008. Mesenchymal stem cells in health and disease. Nat. Rev. Immunol. 8, 726–736. Vitellaro-Zuccarello, L., Mazzetti, S., Madaschi, L., Bosisio, P., Gorio, A., De Biasi, S., 2007. Erythropoietin-mediated preservation of the white matter in rat spinal cord injury. Neuroscience 144, 865–877. Weibel, E.R., 1979. Stereological Methods. Practical Methods for Biological Morphometry, vol. I. Academic Press, New York. Wilson, B.S., Imai, K., Natali, P.G., Ferrone, S., 1981. Distribution and molecular characterization of a cell-surface and a cytoplasmic antigen detectable in human melanoma cells with monoclonal antibodies. Int. J. Cancer 28, 293–300. Xiaowei, H., Ninghui, Z., Wei, X., Yiping, T., Linfeng, X., 2006. The experimental study of hypoxia-inducible factor-1alpha and its target genes in spinal cord injury. Spinal Cord 44, 35–43. Yan, J., Li, Y., Qiu, H., Lu, G., Wu, Z., Lin, J., Zhang, W., 2007. Immunohistochemical study of the presence of mast cells in idiopathic orbital inflammatory pseudotumor: possible role of mast cells in the course of its pathogenesis. Int. Ophthalmol. 27, 235–239.